ID: 900627494

View in Genome Browser
Species Human (GRCh38)
Location 1:3615670-3615692
Sequence GTGGCTCAGGGCCCTCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900627494_900627501 5 Left 900627494 1:3615670-3615692 CCTGCAAGAGGGCCCTGAGCCAC No data
Right 900627501 1:3615698-3615720 CTGGCATGGAAGCCCGCGTGTGG No data
900627494_900627502 6 Left 900627494 1:3615670-3615692 CCTGCAAGAGGGCCCTGAGCCAC No data
Right 900627502 1:3615699-3615721 TGGCATGGAAGCCCGCGTGTGGG No data
900627494_900627498 -9 Left 900627494 1:3615670-3615692 CCTGCAAGAGGGCCCTGAGCCAC No data
Right 900627498 1:3615684-3615706 CTGAGCCACAGCACCTGGCATGG No data
900627494_900627505 20 Left 900627494 1:3615670-3615692 CCTGCAAGAGGGCCCTGAGCCAC No data
Right 900627505 1:3615713-3615735 GCGTGTGGGACCCACCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900627494 Original CRISPR GTGGCTCAGGGCCCTCTTGC AGG (reversed) Intergenic
No off target data available for this crispr