ID: 900630511

View in Genome Browser
Species Human (GRCh38)
Location 1:3632702-3632724
Sequence TAAGGGTACTGACGCTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900630511_900630514 -7 Left 900630511 1:3632702-3632724 CCACCTCAGCGTCAGTACCCTTA 0: 1
1: 0
2: 0
3: 14
4: 99
Right 900630514 1:3632718-3632740 ACCCTTAGACTTTCCGGCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 103
900630511_900630520 21 Left 900630511 1:3632702-3632724 CCACCTCAGCGTCAGTACCCTTA 0: 1
1: 0
2: 0
3: 14
4: 99
Right 900630520 1:3632746-3632768 CCATCATCACAGCAGAAGCAGGG 0: 1
1: 0
2: 1
3: 29
4: 298
900630511_900630518 20 Left 900630511 1:3632702-3632724 CCACCTCAGCGTCAGTACCCTTA 0: 1
1: 0
2: 0
3: 14
4: 99
Right 900630518 1:3632745-3632767 ACCATCATCACAGCAGAAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 235
900630511_900630521 22 Left 900630511 1:3632702-3632724 CCACCTCAGCGTCAGTACCCTTA 0: 1
1: 0
2: 0
3: 14
4: 99
Right 900630521 1:3632747-3632769 CATCATCACAGCAGAAGCAGGGG 0: 1
1: 0
2: 4
3: 40
4: 288
900630511_900630522 28 Left 900630511 1:3632702-3632724 CCACCTCAGCGTCAGTACCCTTA 0: 1
1: 0
2: 0
3: 14
4: 99
Right 900630522 1:3632753-3632775 CACAGCAGAAGCAGGGGCTGTGG 0: 1
1: 0
2: 5
3: 79
4: 682

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900630511 Original CRISPR TAAGGGTACTGACGCTGAGG TGG (reversed) Intronic
900630511 1:3632702-3632724 TAAGGGTACTGACGCTGAGGTGG - Intronic
903267245 1:22165167-22165189 GGAGGGTAGTGAGGCTGAGGAGG + Intergenic
903427787 1:23267317-23267339 TACTGGGACTGAGGCTGAGGTGG - Intergenic
905276245 1:36819945-36819967 TGAGGATATTGACGCTGAGGCGG - Intronic
905972845 1:42154386-42154408 TGAGGGAACTGAGGCTGAGTGGG + Intronic
907354436 1:53860982-53861004 TAAGGGCACTGACCCCAAGGGGG - Intronic
907918986 1:58895700-58895722 GAAGGGTACTTCCTCTGAGGAGG + Intergenic
908459440 1:64335058-64335080 TAAGATTACTGAAGTTGAGGAGG - Intergenic
908837853 1:68245935-68245957 AAAAGTTACTGAAGCTGAGGAGG - Intergenic
918294472 1:183143162-183143184 CAAGAGTACTGAGACTGAGGAGG - Exonic
924716277 1:246577298-246577320 TAAAGGGAGTGACGCTGTGGTGG - Intronic
1062972896 10:1662115-1662137 TAAGGTTACTGACCCTGCAGTGG + Intronic
1065289221 10:24213481-24213503 TAAGGGTACAGAGACTGAGGGGG - Intronic
1071150040 10:82623238-82623260 TAAGGATTCTGAAGCTGAGGTGG + Intronic
1072807064 10:98430269-98430291 TAAGGGCACTGAGGCTCTGGGGG + Intronic
1073293351 10:102424160-102424182 TTAGGCAACTGGCGCTGAGGAGG - Exonic
1075974756 10:126685695-126685717 TATGGGTACTGAAGCAGAGGGGG + Intergenic
1087138009 11:94739852-94739874 TCAGGCTACTGACTCAGAGGGGG + Intronic
1087407385 11:97746106-97746128 AATGGGTACTGAGGCCGAGGAGG + Intergenic
1089437323 11:118481234-118481256 GAAGGGTAGTGAGGTTGAGGGGG - Intronic
1090240596 11:125178868-125178890 TAAGAGAACTGAGGCTCAGGAGG - Intronic
1090924372 11:131236504-131236526 TAAGGGCACTGGGGCTGAGACGG - Intergenic
1091382461 12:70921-70943 AAAGGGTAGTGAGGCAGAGGAGG - Intronic
1095090412 12:38099378-38099400 AAAGGGCACTAAGGCTGAGGGGG + Intergenic
1097104322 12:56612205-56612227 TAATGGTAGTGACGCTGAACAGG - Exonic
1097938118 12:65276124-65276146 TAAGGGTAAAGACCCAGAGGAGG - Intergenic
1106502047 13:30338293-30338315 TAAGGAAACTGAGGCTGAGAAGG - Intergenic
1108667264 13:52645174-52645196 TGAGTGTACTGAGGCTGAGGTGG - Intergenic
1111852757 13:93597632-93597654 TAAAGGTCTTCACGCTGAGGAGG - Intronic
1114635097 14:24182812-24182834 TCAGGATACTGACGAGGAGGAGG - Exonic
1121248497 14:92482413-92482435 TAAGGAAAGTGAGGCTGAGGGGG - Intronic
1121936501 14:98024220-98024242 TAAGGGTACTGAGGCTTAAAGGG + Intergenic
1128756968 15:70189773-70189795 TAAGGAAACTGAGGCTTAGGGGG + Intergenic
1128826539 15:70723083-70723105 TGAGGAAACTGACGCTCAGGGGG - Intronic
1134168096 16:11946458-11946480 TAAGGAGGCTGAGGCTGAGGTGG + Intronic
1134807212 16:17136341-17136363 CAAGGGTACTTACGATCAGGGGG - Intronic
1136633266 16:31502175-31502197 TGAGGGCACTGACCCTGAGGTGG + Intronic
1137689336 16:50410640-50410662 TCAGGTTACTGTCGCTGTGGGGG - Intergenic
1140936250 16:79672967-79672989 TGAGGATACTGAGGCTGAGAAGG - Intergenic
1151993542 17:77594019-77594041 TAAGGGTCCCCACACTGAGGTGG + Intergenic
1153567772 18:6436882-6436904 GAAGGGAACTGAGTCTGAGGGGG - Intergenic
1163584017 19:18154317-18154339 TGGGGGTACTGCAGCTGAGGAGG - Intronic
1163606423 19:18278312-18278334 GAAGGGAACTGAGGCTGAGGTGG - Intergenic
1163919605 19:20276296-20276318 GAAGGGTACTGAGGCTGAGCTGG + Intergenic
1164017977 19:21269624-21269646 GAAGGGGACTGAGGCTGAGATGG + Intronic
1164554592 19:29241442-29241464 TAAGAGTTCTGACACTGAGCAGG + Intergenic
1166364974 19:42273766-42273788 TAGGGGTGCTGGCGCTCAGGTGG - Intronic
1166661823 19:44652303-44652325 TCAGGAGACTGAGGCTGAGGTGG - Intronic
925288977 2:2734055-2734077 TAAGGTCACTGAGGCTGAGCGGG + Intergenic
932503814 2:72209399-72209421 TCAGGTTTCTGAGGCTGAGGTGG + Intronic
935275931 2:101474985-101475007 TATGGGGACTCACGTTGAGGTGG - Intergenic
936992711 2:118383121-118383143 CAAGGGTAATGACACCGAGGAGG + Intergenic
939447035 2:142323331-142323353 TAAGAGTGCTGTGGCTGAGGAGG - Intergenic
941933550 2:170965678-170965700 TAAGGAAACTGAAGTTGAGGAGG - Intronic
948643493 2:239389744-239389766 GAAGGGGACAGATGCTGAGGAGG - Intronic
1169229039 20:3874826-3874848 GAAGGGTATTGACTCTGAGAGGG + Exonic
1171117369 20:22536628-22536650 TAAGGAAACTGAGGCTGAGAAGG + Intergenic
1173450813 20:43162375-43162397 TAAGGAAACTGAGGCAGAGGTGG + Intronic
1176282746 20:64323914-64323936 AAAGGGTAGTGAGGCAGAGGAGG + Intergenic
1181086743 22:20443369-20443391 TAAGGGTGCAGACCCTGAGATGG + Intronic
1182201914 22:28581292-28581314 TACGGGTACTGTGGCTGGGGAGG - Intronic
1183681005 22:39329172-39329194 AAAGGGAACTGAGGCTGAGAAGG - Intergenic
949647145 3:6108856-6108878 TGAGGGAACTGGCGCTCAGGAGG - Intergenic
949917863 3:8978544-8978566 CAAGACTACTGAAGCTGAGGAGG + Intergenic
950048319 3:9965306-9965328 TACCAGTACTGAGGCTGAGGTGG + Intronic
953751264 3:45610257-45610279 TAAAGGCACTGACACTCAGGAGG - Intronic
954822989 3:53347591-53347613 TGAGGGGACTGACGCAGATGGGG - Exonic
955335280 3:58080387-58080409 TGATGGTACTGAAACTGAGGTGG + Intronic
961802973 3:129467001-129467023 TCAGGGTAGTGAGGCAGAGGAGG + Exonic
962272363 3:133987188-133987210 TAAGAGTACTCTGGCTGAGGAGG - Intronic
962680846 3:137798700-137798722 TAAGGTTTCTGACGCAGAGTTGG + Intergenic
963025233 3:140912806-140912828 TAGGGGTACTGAGGGAGAGGAGG - Intergenic
964894825 3:161583078-161583100 TGAGGGTACTGAGGCTCAGTGGG + Intergenic
966833139 3:184028212-184028234 TAAGGAAACTGAGGCTGAGAGGG + Intergenic
975547149 4:75571407-75571429 CAAGGGCACAGACCCTGAGGAGG - Intergenic
978010933 4:103683046-103683068 TAAAGGTAATGAAGATGAGGAGG + Intronic
979208101 4:118065694-118065716 TAAGGGCACTGAAACTGAGGTGG - Intronic
983092829 4:163525190-163525212 TAAGGGTCCTGGGGCTGAGGTGG - Exonic
984761867 4:183369352-183369374 TTAGGGTTCTGACGAGGAGGTGG + Intergenic
985588365 5:752230-752252 AAAGGGAACTCAGGCTGAGGAGG + Intronic
986463068 5:7993113-7993135 TAGGGGGGCTGAGGCTGAGGTGG + Intergenic
991418952 5:66421248-66421270 TATGGGTTCTGAAGCTGAGGAGG + Intergenic
991948720 5:71927056-71927078 TAAGGAAACTGAGGCTGAGAGGG - Intergenic
995847493 5:116509734-116509756 TAAGGGGACCCAGGCTGAGGTGG + Intronic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
1000025775 5:157357991-157358013 TGAGGGAACTGAGGCTCAGGTGG - Intronic
1000171451 5:158706726-158706748 TAAGGGCACAGACTCTGATGGGG + Intronic
1001083001 5:168680607-168680629 TTATTGTACTGATGCTGAGGAGG + Intronic
1003169470 6:3709765-3709787 CGAGGGTCCTGACGCTGAGGGGG - Intergenic
1003315676 6:5009788-5009810 TAGGGGTGGAGACGCTGAGGTGG - Intergenic
1006315665 6:33290028-33290050 GAAGAGTACTGAGACTGAGGCGG - Intronic
1008308286 6:49933550-49933572 AATGGGTGCTGAGGCTGAGGAGG - Intergenic
1012884517 6:104830692-104830714 TAATGGTACTGACTTTGAGTTGG + Intronic
1020502918 7:8945291-8945313 TAAGGATACTGAAGCTCAAGAGG - Intergenic
1021467825 7:20966244-20966266 TGAGGCAACTGAGGCTGAGGAGG + Intergenic
1024464795 7:49700794-49700816 AAAGGGTAGTGATGATGAGGAGG - Intergenic
1027872450 7:83725975-83725997 TAAAGGTACTCAAGCAGAGGTGG - Intergenic
1028738032 7:94240061-94240083 TGAGGCTACAGAGGCTGAGGCGG + Intergenic
1029364313 7:100107350-100107372 AAAGGGCACTGCCGCTGAGTGGG + Exonic
1029572743 7:101381384-101381406 TAAGCATACTGAAGTTGAGGGGG - Intronic
1040869024 8:52080875-52080897 TGAGGACACTGAGGCTGAGGAGG + Intergenic
1042820049 8:72920528-72920550 TCAGGATACTGAGGCTGAGGTGG + Intronic
1046595102 8:116252075-116252097 CAAGGGTACAAACCCTGAGGTGG + Intergenic
1047751959 8:127888530-127888552 TAAGGCTAAGGACCCTGAGGTGG + Intergenic
1050943911 9:11494177-11494199 TAAGAGAGCTGACCCTGAGGAGG - Intergenic
1053442777 9:38129717-38129739 TAAGGGTACAGACGTTGAGATGG - Intergenic
1053581535 9:39409825-39409847 TAAGGGCATTGTTGCTGAGGGGG + Intergenic
1054103115 9:60968577-60968599 TAAGGGCATTGTTGCTGAGGGGG + Intergenic
1055942362 9:81662751-81662773 TAAGAGTAATTATGCTGAGGTGG + Intronic
1057899484 9:98937069-98937091 TTTGGGTACTGATGCTGAAGAGG + Intergenic
1059678694 9:116565579-116565601 TCAGGAGACTGAGGCTGAGGTGG - Intronic
1189595419 X:42559838-42559860 TAAGGATACTGACCTTGAGATGG - Intergenic
1191635208 X:63368350-63368372 TGAGGGTACTGACTCTTAGAAGG + Intergenic
1194764837 X:97837850-97837872 TAAGGACACTGACCTTGAGGAGG - Intergenic