ID: 900633268

View in Genome Browser
Species Human (GRCh38)
Location 1:3649856-3649878
Sequence CCGCCCCCGGCCCTGCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 937
Summary {0: 1, 1: 0, 2: 11, 3: 139, 4: 786}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900633256_900633268 17 Left 900633256 1:3649816-3649838 CCGCACCTGCAGGATCCCCAAGC 0: 1
1: 0
2: 1
3: 22
4: 261
Right 900633268 1:3649856-3649878 CCGCCCCCGGCCCTGCCCGCCGG 0: 1
1: 0
2: 11
3: 139
4: 786
900633260_900633268 0 Left 900633260 1:3649833-3649855 CCAAGCTGCCTCCACCCACGCGG 0: 1
1: 0
2: 0
3: 19
4: 171
Right 900633268 1:3649856-3649878 CCGCCCCCGGCCCTGCCCGCCGG 0: 1
1: 0
2: 11
3: 139
4: 786
900633258_900633268 2 Left 900633258 1:3649831-3649853 CCCCAAGCTGCCTCCACCCACGC 0: 1
1: 0
2: 1
3: 30
4: 332
Right 900633268 1:3649856-3649878 CCGCCCCCGGCCCTGCCCGCCGG 0: 1
1: 0
2: 11
3: 139
4: 786
900633262_900633268 -8 Left 900633262 1:3649841-3649863 CCTCCACCCACGCGGCCGCCCCC 0: 1
1: 1
2: 10
3: 96
4: 1159
Right 900633268 1:3649856-3649878 CCGCCCCCGGCCCTGCCCGCCGG 0: 1
1: 0
2: 11
3: 139
4: 786
900633257_900633268 12 Left 900633257 1:3649821-3649843 CCTGCAGGATCCCCAAGCTGCCT 0: 1
1: 0
2: 4
3: 20
4: 254
Right 900633268 1:3649856-3649878 CCGCCCCCGGCCCTGCCCGCCGG 0: 1
1: 0
2: 11
3: 139
4: 786
900633255_900633268 24 Left 900633255 1:3649809-3649831 CCGGGCACCGCACCTGCAGGATC 0: 1
1: 0
2: 0
3: 18
4: 184
Right 900633268 1:3649856-3649878 CCGCCCCCGGCCCTGCCCGCCGG 0: 1
1: 0
2: 11
3: 139
4: 786
900633259_900633268 1 Left 900633259 1:3649832-3649854 CCCAAGCTGCCTCCACCCACGCG 0: 1
1: 0
2: 1
3: 11
4: 135
Right 900633268 1:3649856-3649878 CCGCCCCCGGCCCTGCCCGCCGG 0: 1
1: 0
2: 11
3: 139
4: 786
900633253_900633268 29 Left 900633253 1:3649804-3649826 CCTGTCCGGGCACCGCACCTGCA 0: 1
1: 0
2: 1
3: 6
4: 102
Right 900633268 1:3649856-3649878 CCGCCCCCGGCCCTGCCCGCCGG 0: 1
1: 0
2: 11
3: 139
4: 786

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900633268 Original CRISPR CCGCCCCCGGCCCTGCCCGC CGG Intronic
900001580 1:17577-17599 CACCCCTCGGCCCTGCCCTCTGG + Intergenic
900004746 1:37513-37535 CCGCCCTTGGCCCTGCCCTCAGG - Intergenic
900021299 1:188101-188123 CACCCCTCGGCCCTGCCCTCTGG + Intergenic
900109278 1:998805-998827 CCGCCCCCAGCCCGCCCCCCCGG + Intergenic
900148139 1:1167209-1167231 CCGACCCCGTCCCGGCCCCCAGG + Intergenic
900177251 1:1296342-1296364 CCACCCCCGGCCTGGCCCTCAGG + Intronic
900185644 1:1331964-1331986 CCCCACCCAGCCCTGCCCGTGGG + Intronic
900190084 1:1349521-1349543 CCGGCCCCGCCCCCGCGCGCGGG + Intergenic
900210027 1:1450833-1450855 ACACCCCCGGCCCTACCCACCGG - Intronic
900222388 1:1516163-1516185 ACACCCCCGGCCCTACCCACCGG - Intronic
900240833 1:1616421-1616443 CTGCCCCCGGGGCTGCCCGCCGG - Intronic
900284325 1:1891749-1891771 CGGCCCCCGCCCCTGCCAGGCGG - Intergenic
900332747 1:2144365-2144387 CCGACCCCGCCCGTGCCCCCCGG - Intronic
900402392 1:2477915-2477937 CTGCCCCCGCCCCTGGCCACAGG - Intronic
900457798 1:2785882-2785904 CCCCGCCTGGCCGTGCCCGCAGG + Exonic
900629232 1:3624975-3624997 GCGCCCCCGGCCCCGCCCCGCGG - Intergenic
900633268 1:3649856-3649878 CCGCCCCCGGCCCTGCCCGCCGG + Intronic
901048842 1:6416066-6416088 CTGCGCCCGGCCTTGCCCACTGG + Exonic
901088234 1:6625128-6625150 GCGGCCCCGCCCCTCCCCGCAGG + Exonic
901511937 1:9721875-9721897 CCGCCCCCTGCCCGCCCCCCAGG - Intronic
901526227 1:9824589-9824611 CCGCCCCGGGACCTGCCCCCGGG + Intergenic
901540196 1:9910404-9910426 CCGGGCCCCGCCCCGCCCGCAGG - Intergenic
902398562 1:16145263-16145285 CTGCCCCCGGCCCTGCCTGCGGG - Intronic
902505971 1:16939201-16939223 CCGCCCCCGCCCCCACCCGGAGG - Intronic
902545482 1:17186893-17186915 CAGGCCCCTGCCCTGCCCTCTGG - Intergenic
903179684 1:21598857-21598879 CAGACCCAGGCCCTGCCTGCTGG - Intronic
903263448 1:22143176-22143198 CCGCCCCCGGCCCGCCCCCCCGG - Intronic
903282469 1:22257788-22257810 CCTTCCCCGGCCCTCCCAGCTGG + Intergenic
903283401 1:22262935-22262957 CCACACCAGGCCCTGCCCCCTGG - Intergenic
903649578 1:24914544-24914566 CCGCTCGCCTCCCTGCCCGCTGG - Intronic
903664846 1:24999966-24999988 CCGCCACAGCCCCTGCCCTCAGG - Intergenic
903738378 1:25544261-25544283 CCGCCCCCTGCCCGACCCACCGG + Intronic
903925232 1:26826926-26826948 CCGCCCCCGCCCCGCCGCGCTGG + Exonic
904528772 1:31154949-31154971 CCGCCCCCGCCCCCGCCCCAAGG - Intergenic
904696779 1:32335696-32335718 CGGTCCCCGGCGCTGCCCCCCGG - Intronic
905037878 1:34929487-34929509 GCGCCCCCGGCCCGGGCCGCCGG - Exonic
905179287 1:36156429-36156451 CCGCCCCCAGCTCCGCACGCGGG - Exonic
906214257 1:44030143-44030165 CCGACCGCGCCCCTGCCCGCCGG - Intronic
906321511 1:44820317-44820339 CCGCACCCGGCGCCGCCCACGGG - Intronic
907050918 1:51329713-51329735 CTGCCCCCTGCCCTGCCCACTGG + Intronic
907136251 1:52142155-52142177 GCGCCCCCGGCCCGGCTCGGCGG + Exonic
907223879 1:52927290-52927312 CCGCCCGCGGCCCTGGCTTCGGG + Exonic
909957770 1:81800989-81801011 CCGGCCCCGGCTCCGCCGGCGGG - Intronic
910145666 1:84077890-84077912 CCGCCCCAGGCTCTGCCAGCTGG + Intergenic
912557075 1:110524186-110524208 CCTCCCCATGCCCTGCCTGCAGG - Intergenic
914755792 1:150561048-150561070 CAGCCCCAGGCCCTGCAGGCTGG + Intergenic
914899435 1:151704023-151704045 CTGCCCCCGGCCCTGACCTTGGG + Intronic
915225028 1:154405662-154405684 CCGCTCCCGGCGCGGCCAGCAGG - Exonic
915246293 1:154558472-154558494 CGGCCCCCGGCGCCGCCCCCTGG + Exonic
915367741 1:155324991-155325013 TCGCCCCCGGCCCTGCTCTCAGG + Intronic
915932749 1:160070171-160070193 CCGACCCCGGCCCCGGCCCCCGG - Exonic
915932881 1:160070656-160070678 CCGCCTTCGGCGCTGCCTGCAGG - Intergenic
915967841 1:160327460-160327482 CCCCCCCCAGCCCCGCCCCCCGG - Intronic
916084537 1:161258994-161259016 CGGCCCCCGGCGCTGTCGGCAGG + Intronic
916651647 1:166839574-166839596 CCACCCCGCGCCCTGGCCGCTGG + Intronic
917846734 1:179026135-179026157 CCGCCCCCGGCGCGGCGGGCGGG + Intronic
917931304 1:179824556-179824578 GCTCCCCCGGCCCTGGCCACAGG + Intergenic
919760263 1:201093674-201093696 TTGCCCCCGACCCTGCCCGCAGG - Intronic
919826562 1:201507275-201507297 CTGCCCCCGCCCCTGCCGGCCGG - Exonic
920002331 1:202808253-202808275 CCGCGCCCGGCGCTGCCCCTCGG - Exonic
920184591 1:204152082-204152104 CCGCCCCCGCCCCGGCCCGCGGG + Intergenic
920250433 1:204619152-204619174 AGTCCCCCGGCCCTACCCGCTGG + Exonic
920504629 1:206507466-206507488 CCGCCCCCGCCCCGCCCAGCAGG + Intergenic
921029781 1:211327024-211327046 CCGCCTCGCGCCCTCCCCGCCGG - Intronic
921432832 1:215083134-215083156 TCGCCCTCTGCCCAGCCCGCCGG + Intronic
922612433 1:226940333-226940355 CCGCGCCCGCCTCTGCGCGCTGG - Intronic
922718091 1:227887286-227887308 CCCCCACCCTCCCTGCCCGCGGG - Intergenic
922725707 1:227922103-227922125 CAGGCCCAGGCCCTGCCGGCGGG + Intronic
922787623 1:228290821-228290843 CTGCCCTGGGCCCTGGCCGCCGG + Intronic
922809855 1:228409356-228409378 CTGCCCCCGCCCCTGCCTGAGGG + Intronic
922832395 1:228610422-228610444 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922832955 1:228612663-228612685 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922833516 1:228614904-228614926 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922834076 1:228617145-228617167 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922834633 1:228619386-228619408 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922835185 1:228621601-228621623 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922835744 1:228623821-228623843 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922836302 1:228626063-228626085 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922836860 1:228628302-228628324 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922837419 1:228630544-228630566 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922837980 1:228632785-228632807 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922838538 1:228635025-228635047 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922839096 1:228637250-228637272 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922839656 1:228639491-228639513 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922840217 1:228641722-228641744 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922840777 1:228643963-228643985 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922841340 1:228646194-228646216 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922937247 1:229432227-229432249 CCGCCGCCGGCCCTCCCGCCCGG + Intronic
923631086 1:235649892-235649914 CCTCCCCCGGCCCTGGACGCTGG + Exonic
923744299 1:236686400-236686422 CCGCCCCCGGCCCCGCCCGTCGG - Intergenic
924118465 1:240771575-240771597 CCCGCCCCTGCCCTGCGCGCTGG - Intergenic
924801540 1:247332071-247332093 CCGCGCCCGGGCTTCCCCGCGGG + Intergenic
1062774708 10:135504-135526 CCGCGCCCGGCCCTCCCCTCCGG - Intronic
1064179188 10:13100180-13100202 CCGCCACCGCCGCCGCCCGCCGG + Exonic
1065588508 10:27242103-27242125 CCGCCCCTCGCCCTGCCCCGCGG + Intronic
1065712948 10:28533902-28533924 CCCCCGCCGCCCCTCCCCGCGGG - Intronic
1066180477 10:32957563-32957585 CCGCCCGCGGCGCTGGCCCCAGG + Intronic
1067096542 10:43305058-43305080 CCGCCCCCGCCCCCGCCCCCGGG + Intergenic
1067116233 10:43437274-43437296 CAGACCCGGCCCCTGCCCGCCGG - Intronic
1067452408 10:46390439-46390461 CCACCCCCGGCCCTGCTCCCAGG + Intronic
1067584826 10:47469316-47469338 CCACCCCCGGCCCTGCCCCCAGG - Intronic
1067769912 10:49115574-49115596 CCGCCCCCGGCCCGCCCCTTGGG + Intergenic
1067937546 10:50624251-50624273 CCGTCTCCGGCCCTGCCCCAAGG - Intronic
1069024045 10:63521334-63521356 CCCCGCCCGCCCCCGCCCGCCGG - Intergenic
1069673890 10:70233431-70233453 GCGCTCCCCGCCCCGCCCGCCGG - Intronic
1069769351 10:70887921-70887943 CCGCCCCCGCCCCCGCCCCGGGG + Intronic
1069769550 10:70888555-70888577 CCGCCGCCTGCCCTCTCCGCTGG - Exonic
1069953302 10:72034416-72034438 CCGCCCCCTCCCCTGCTTGCTGG + Intergenic
1070865501 10:79706123-79706145 CCGCTCCCGGCCCAGCACACGGG + Exonic
1070879295 10:79844254-79844276 CCGCTCCCGGCCCAGCACACGGG + Exonic
1071632401 10:87228344-87228366 CCGCTCCCGGCCCAGCACACGGG + Exonic
1071645854 10:87360562-87360584 CCGCTCCCGGCCCAGCACACGGG + Exonic
1071679331 10:87689042-87689064 CTGGCCCCGGCCCTGACCCCTGG - Intronic
1072151717 10:92689781-92689803 CCCACCCCGGCCCGCCCCGCCGG - Intergenic
1072421004 10:95290732-95290754 CCGTCCCCGACCGCGCCCGCGGG + Intronic
1072421127 10:95291135-95291157 CCGCTCCCCGCCCTGCGCGCCGG + Intergenic
1072451423 10:95542196-95542218 CCGCCCCCCACCCTGTCCCCAGG + Intronic
1072454168 10:95561508-95561530 CCGCCCCCGGCACCGCCCGCTGG - Intergenic
1072591428 10:96832096-96832118 CCGCCCCGCGCGCCGCCCGCCGG - Intergenic
1072654701 10:97321509-97321531 CCTCCCCCAGCCATGCCAGCTGG + Exonic
1072757644 10:98031086-98031108 CCACCCTCGGTCCTGCGCGCAGG - Intergenic
1072915541 10:99535512-99535534 CCGCCGCCGCCGCCGCCCGCCGG - Exonic
1072949808 10:99839217-99839239 CGGCCCCCCGCCCGGCCAGCCGG - Intronic
1073030176 10:100519642-100519664 CCCGCGCCTGCCCTGCCCGCGGG - Intronic
1073338342 10:102727164-102727186 CCTCCCACGGCCCTGCCCCCAGG - Intronic
1073481936 10:103791537-103791559 CCGCCTCGGGGCCTGCCCTCAGG - Intronic
1074085611 10:110207463-110207485 CCGCCCCTGCCCGTCCCCGCAGG - Intergenic
1074088357 10:110225917-110225939 CCGCCCCTGCCTCTGCCCCCTGG - Intronic
1075445385 10:122509415-122509437 CCCCCCACATCCCTGCCCGCTGG - Intronic
1075686456 10:124368092-124368114 CCTCCCCTGGCCCGGCCTGCTGG - Intergenic
1075714750 10:124549732-124549754 CCCACCCCGGCCATGCCCACAGG - Intronic
1075802012 10:125159914-125159936 CCGCCGCCGCCGCTGCCCTCCGG + Intronic
1075871297 10:125774086-125774108 CCGCTCCAGGCGCTCCCCGCGGG - Exonic
1076003162 10:126928326-126928348 GCGTCCCAGGCCCTGCCCCCAGG + Intronic
1076404684 10:130203895-130203917 CCGCCCCCGCCCGATCCCGCCGG + Intergenic
1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG + Intergenic
1076707057 10:132307877-132307899 CCGCTCCCGGCCCTGCCGGCCGG - Exonic
1076737582 10:132465683-132465705 CCGCACCCGGCCCTCCGCTCGGG + Intergenic
1076792828 10:132785990-132786012 CCGCCGCCGCCCCTGCCCGCCGG + Exonic
1076878757 10:133230122-133230144 GCGCGCCCCGCCCCGCCCGCCGG - Intergenic
1076908212 10:133373598-133373620 CCGCCCCCGCCCCAGCCCTCGGG + Exonic
1077011708 11:381672-381694 CCACCTCCAGCCCTGCCTGCAGG - Exonic
1077020836 11:416576-416598 CCGCGGCCGCCCCTGCCCGGTGG + Intronic
1077034445 11:487999-488021 CCACGCCCGGCCCTGCCCACGGG - Intronic
1077034467 11:488068-488090 CCACGCCCGGCCCTGCCCACGGG - Intronic
1077034491 11:488138-488160 CCACACCCGGCCCTGCCCACGGG - Intronic
1077043721 11:535436-535458 TCGGCCCCGGCCCTGGCCCCGGG - Exonic
1077106065 11:843141-843163 CCGCCTCGGCCTCTGCCCGCGGG + Intronic
1077106400 11:844283-844305 CCGCCCCTGTTCCTGCCTGCAGG + Intronic
1077210818 11:1370240-1370262 CCGCCCGCTGCCCTCCACGCTGG + Intergenic
1077292250 11:1803273-1803295 CCCCTCCTGGCCCTGCCCACAGG - Intergenic
1077481273 11:2815780-2815802 CTGCCCCCAGCCCTTCCTGCTGG + Intronic
1077485145 11:2835071-2835093 CAGCCCCCGGGCCTGCACCCAGG - Intronic
1077539412 11:3139556-3139578 AGGCACCCAGCCCTGCCCGCAGG + Intronic
1077865454 11:6217975-6217997 CCGCCTCCAGCCCTGGCCGACGG - Exonic
1078527287 11:12110669-12110691 CCTGCCTCGGCCCTGGCCGCGGG - Exonic
1080625718 11:34028967-34028989 CCGCCCCCGGCCCTGAATGTTGG - Intergenic
1081749766 11:45501677-45501699 CCGGCCCCAGCTCTGCCCGATGG + Intergenic
1083272889 11:61580915-61580937 CCGCCCTCGGACCCGCCCCCGGG - Intronic
1083657182 11:64235111-64235133 CCGCCCCCGGCGGTGCCCAGGGG - Intronic
1083661716 11:64254541-64254563 CAGACCCCTGCCCTGCCCGTGGG + Intronic
1083753752 11:64778232-64778254 CCGCCGCCGCCCCCGCCCGTGGG - Exonic
1083753864 11:64778564-64778586 CCGCCCCCGGCCCGCCCCCGCGG - Intronic
1083885357 11:65570813-65570835 CCTTCCCCGGCCCTCCCCTCTGG + Intronic
1083904860 11:65662842-65662864 GCGACCCCGGCCCCGCCCCCGGG - Exonic
1084109220 11:67002732-67002754 CCTCCCCGGGCCCTGCCCCCGGG + Intergenic
1084175276 11:67419543-67419565 CTGCACCCAGCTCTGCCCGCGGG - Exonic
1084192165 11:67504267-67504289 CGGCCCCGAGCCCTGCGCGCCGG + Intronic
1084295736 11:68212876-68212898 CCGGCCCCGACGCTGCCCGGCGG + Intronic
1084309433 11:68308169-68308191 CCTCCTCCGGCGCTGCCCTCAGG + Intergenic
1084325476 11:68397450-68397472 CTGCCCCCGGCCCTCTCCCCTGG + Intronic
1084546695 11:69818391-69818413 CCGTCCCCGGTCCGGCCCGCTGG - Intronic
1084651395 11:70491410-70491432 CCCCTCCAGGCCCTGCCTGCCGG - Intronic
1084706478 11:70818957-70818979 CCGCCACCACCCCTGCCCCCAGG - Intronic
1084810231 11:71607537-71607559 CGGCCGCCGGCCCTGCCCGTAGG + Intergenic
1084892614 11:72244009-72244031 CGGCCCCCGCCCCCGCCCCCCGG - Exonic
1088686739 11:112290203-112290225 CCGCCCGCGTCCCCGCCCCCCGG - Intergenic
1088801905 11:113314499-113314521 CCGCCCCGGGCCCTGGCTCCTGG + Intergenic
1089494987 11:118903299-118903321 CCGCCCCCGCCCCCGCCCCCAGG + Exonic
1089533856 11:119149219-119149241 CCCGCCCCGGCCCGGGCCGCCGG + Exonic
1089681082 11:120119335-120119357 CAGCCCCCAGCCCTCCCCACAGG - Intronic
1091262523 11:134245646-134245668 CCGCCCCCGCCCCCAGCCGCTGG - Exonic
1091378158 12:39564-39586 CCGCCCTTGGCTCTGCCCTCAGG - Intergenic
1091434278 12:460741-460763 CCGAGCCCGGGCCTGCCCGCCGG + Intronic
1092318028 12:7440212-7440234 CCGCGGCCGGCCCTCCGCGCAGG + Intronic
1092385356 12:8032651-8032673 CCTCCCCCTCCCCCGCCCGCCGG - Intergenic
1094703997 12:32896964-32896986 CCGCCCCCGCCCCCGCCCCCGGG - Intergenic
1095050067 12:37547005-37547027 CCGACCCCGATCCTGCCAGCGGG - Intergenic
1095349141 12:41188766-41188788 GCGACTTCGGCCCTGCCCGCCGG + Exonic
1096109674 12:49021307-49021329 CCACACCTGGCCCTGCCTGCCGG - Exonic
1096336946 12:50764058-50764080 CCGCCCCCGCCCCCGCCCCCAGG + Intronic
1096796742 12:54082573-54082595 CCGGCCCCGGCCCCGGCCCCCGG - Intergenic
1097042784 12:56165554-56165576 CCACCACCAGCCCTGCCCCCAGG - Exonic
1097222628 12:57460037-57460059 CTCCCGCCGGCCCAGCCCGCCGG - Intergenic
1098105983 12:67069354-67069376 CAGCCCCCAGCCTTGCCCGGCGG - Intergenic
1100391454 12:94148933-94148955 CCGCCGCGCGCCCTGCCCGGGGG + Exonic
1101640133 12:106581637-106581659 CCGCCCCCGCCGCGGCCCGCCGG + Intronic
1101910483 12:108857389-108857411 CCGCGCCCGGCCTGGGCCGCCGG - Intronic
1102147050 12:110661811-110661833 CCTCCCCACGCCCTGCCCACTGG - Intronic
1102414548 12:112749231-112749253 CAGCCCCCAGCCCAGCCCACTGG + Intronic
1102471400 12:113161797-113161819 CCGCCCCCGCCCCCGCCCCCAGG + Intronic
1102508502 12:113398843-113398865 CCACCCCCGACCCTGGCAGCGGG - Exonic
1102571269 12:113828497-113828519 CCGCCCCCTGCCCTTCACCCCGG - Intronic
1103698492 12:122835433-122835455 CCGCGCCCGGGCCCGCCCGCCGG - Exonic
1103775690 12:123364864-123364886 CCTCCCCCGCCCCTCCCGGCGGG - Intergenic
1103905513 12:124325496-124325518 CCCCCACCGGGCCTCCCCGCGGG - Exonic
1103920401 12:124396496-124396518 CAGCCCCAGGCCCTACCAGCTGG + Intronic
1104989671 12:132618651-132618673 CCGGCCCCGCCCCGCCCCGCAGG - Intergenic
1104989952 12:132619417-132619439 CCGGCGCCGCCCCTGCCCGCAGG + Exonic
1105327278 13:19382235-19382257 CCGCCCTCGTCCCGTCCCGCAGG - Intergenic
1105492610 13:20902935-20902957 CCGCCCCCGCCCCAGCGCGGCGG - Intronic
1105808366 13:23972531-23972553 CAGCCCCCCGCCCGGCCAGCCGG - Intergenic
1106308381 13:28532765-28532787 CAGGCCCCGGCCCTGACCTCAGG - Intergenic
1107467993 13:40666493-40666515 CCGTCCGCGGCCCTGTCAGCTGG - Exonic
1107711228 13:43152375-43152397 CTGCCCCCGGCCCAGGCCCCAGG + Intergenic
1107935363 13:45341381-45341403 CCGCCCCCACCCCTACCCGCTGG - Intergenic
1108676090 13:52739171-52739193 CCTCTCCCGCCCCGGCCCGCAGG - Exonic
1108727793 13:53201120-53201142 CCGCCGCCGCCGCTGCCCTCGGG + Intergenic
1112091849 13:96091011-96091033 CCGTCCCGGGTCCCGCCCGCCGG + Exonic
1113473285 13:110561769-110561791 CCGCCCCCGCCCCCGCCCCCGGG + Intergenic
1113492846 13:110705987-110706009 CCGCTCGCCGCCCGGCCCGCAGG + Exonic
1113649153 13:112023044-112023066 CCACCCCTGCCCCTGCCCTCAGG + Intergenic
1113660795 13:112105196-112105218 CTGCCCCGCGCCCTGCCCGCGGG - Intergenic
1113841711 13:113364498-113364520 GCGCCCCCGATTCTGCCCGCGGG - Intergenic
1113927867 13:113951341-113951363 CCGGCTCCAGCCCGGCCCGCAGG - Intergenic
1113932140 13:113974166-113974188 CCGCCCCAGCCCCGGCCTGCAGG - Intergenic
1113932153 13:113974213-113974235 CCGCCCCAGCCCCGGCCTGCGGG - Intergenic
1113932181 13:113974307-113974329 CCGCCCCAGCCCCGGCCTGCGGG - Intergenic
1113932209 13:113974401-113974423 CCGCCCCAGCCCCGGCCTGCGGG - Intergenic
1113932223 13:113974448-113974470 CCGCCCCAGCCCCGGCCTGCGGG - Intergenic
1114422779 14:22598448-22598470 CCACCCCCCGCCCTCCCCGGAGG - Intronic
1114487539 14:23071779-23071801 CAGCCCCCTCCCCTGCCCCCTGG - Intronic
1115028198 14:28766627-28766649 CCCACCCCCGCCCCGCCCGCCGG - Intergenic
1115720085 14:36151282-36151304 ACCCCCCCGCCCCTGCCCTCTGG + Intergenic
1115852607 14:37599621-37599643 CCCCACCCGGCCTCGCCCGCGGG + Intronic
1115910938 14:38255773-38255795 CGGGCCCTGGGCCTGCCCGCAGG + Exonic
1116018432 14:39432903-39432925 CCCCTCCCGGCACAGCCCGCCGG - Intergenic
1116886936 14:50231318-50231340 AGGCCACCGGCCCGGCCCGCGGG - Exonic
1118024081 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG + Intergenic
1118388866 14:65280086-65280108 CCACGCCCGGACCTGCCCTCCGG + Intergenic
1120950415 14:90035836-90035858 CCACCCCCAGCCCTGCACCCTGG + Intronic
1121439157 14:93937904-93937926 CCGCTGCCGTCCCTGGCCGCAGG - Intronic
1122108791 14:99480897-99480919 CCGCCCCGGACCCCGCCCCCGGG + Intergenic
1122137957 14:99645479-99645501 CCGCGCCCCGCCCCGCCCGGTGG - Intronic
1122231064 14:100306500-100306522 CCCACCCGGGCCCTGCCGGCAGG - Exonic
1122286305 14:100654832-100654854 CCCCGCCCGACCCTGCCCCCCGG + Intergenic
1122486775 14:102087193-102087215 CCGCCCCCGCGCCTTCCTGCGGG + Intronic
1122718095 14:103707255-103707277 CAGTCCCCAGCCCTGCCCGCAGG - Intronic
1122719930 14:103716162-103716184 GCGCCTCCCGCCCTCCCCGCGGG - Intronic
1122796933 14:104210709-104210731 CCTCCCCCAGCCCTGCCCCCCGG - Intergenic
1122818357 14:104326495-104326517 CTGCCCCCTGCCCTGCCTTCTGG + Intergenic
1122840468 14:104460027-104460049 CCTCCCCCCGCCCCGCCCCCAGG - Intergenic
1122959513 14:105088062-105088084 CACCTCCCTGCCCTGCCCGCAGG - Intergenic
1122959603 14:105088345-105088367 CCGCCCCCAGCCCTCCGCCCGGG - Intergenic
1122960975 14:105093518-105093540 CCGCCCCCGGCCCGCGCCCCGGG + Intergenic
1123004606 14:105315150-105315172 CCCCCCGCGCCCCCGCCCGCCGG + Exonic
1123037991 14:105479075-105479097 CCGCCCCCGCCCCCGCCCCGGGG + Intronic
1125540554 15:40467457-40467479 CAGCCCCAGCCCCTGCCCCCAGG - Exonic
1125589358 15:40844672-40844694 GCGCCCCCTGGGCTGCCCGCGGG + Exonic
1126103790 15:45135082-45135104 CCCCCTCCTGCACTGCCCGCAGG + Exonic
1127221713 15:56887310-56887332 CCGCGCGCGGCCCGGCCCGGCGG - Intronic
1127293679 15:57591880-57591902 CCGCCCCCGGCCCCACCCCCGGG + Intergenic
1127995551 15:64151645-64151667 CCACCCCAGGCCCCGCCCCCAGG - Intergenic
1128454979 15:67827169-67827191 CCGGGCCCGCCCCTGCCCCCGGG - Intronic
1128815681 15:70606422-70606444 CAGCCTCCAGCCCTGCCTGCAGG + Intergenic
1128850897 15:70954893-70954915 TCGCCCACAGCCCTGCCCACTGG - Intronic
1128982616 15:72198019-72198041 CCGCGCCAGGCCCTGGCCTCCGG - Intergenic
1129253710 15:74322293-74322315 CTGCTCCCGCCCCTGCCCGTAGG - Intronic
1129287980 15:74541165-74541187 CCGCCCCCGCCCCTGGCTGGCGG + Exonic
1129298922 15:74614714-74614736 CCGCCCATGCCCCTCCCCGCGGG - Intronic
1129334295 15:74843197-74843219 CTGCCCCCAGCGCCGCCCGCCGG + Exonic
1129604419 15:77017908-77017930 GCACCCCCGGCCCTGTCAGCTGG + Intronic
1129723340 15:77889629-77889651 GTGCCCTCGGCCCTGCCTGCAGG - Intergenic
1130076629 15:80695391-80695413 CCGCCGCCGGCCCGGCTGGCTGG - Exonic
1130531175 15:84748675-84748697 CCCCGCTCGGCCCGGCCCGCGGG - Intronic
1130584332 15:85168776-85168798 CCGCCCCCACCCCCGCCCCCAGG - Intergenic
1130994191 15:88895056-88895078 GCGCCCCAGGCCCTGCCCCTGGG - Intronic
1132405907 15:101541777-101541799 CCGCGCCAGGCCCTGCCTCCTGG - Intergenic
1132448764 15:101953431-101953453 CCGCCCTTGGCCCTGCCCTCAGG + Intergenic
1132451929 15:101973359-101973381 CACCCCTCGGCCCTGCCCTCTGG - Intergenic
1132494230 16:253210-253232 CCACCCCCGGTCCGGCCAGCAGG + Intronic
1132503709 16:296522-296544 CAGCCCCTGCCGCTGCCCGCCGG - Intronic
1132586244 16:706753-706775 CCTCCCCCGGCCCTGCTCCCAGG - Intronic
1132723971 16:1330879-1330901 CCGCCACCGGCCCGGCCCTAAGG + Intergenic
1132741416 16:1414930-1414952 CAGCCCCCGGCCCGGGACGCTGG + Intergenic
1132749945 16:1452868-1452890 CATCCACCGGCCCTGCCTGCAGG - Exonic
1132779351 16:1614311-1614333 CCGGCCCCGGCCCCGGCCCCGGG - Intronic
1132804364 16:1768872-1768894 CTGACCCCCGCCCGGCCCGCGGG + Exonic
1132828905 16:1918164-1918186 CCTCCCCGGCCGCTGCCCGCCGG - Exonic
1132831255 16:1929553-1929575 CCGCCCCTGGCTCTGTCCTCCGG + Intergenic
1132842264 16:1983989-1984011 CCGTCCCCGCCCCTGTCCTCGGG + Intronic
1132851516 16:2026961-2026983 TCCCCCGCGCCCCTGCCCGCGGG + Exonic
1132885093 16:2179016-2179038 GCGCCCCCCGCCCCGCCCGAAGG - Exonic
1132935036 16:2475668-2475690 CAGCCCCCGGCCCTGTCCAGTGG + Intronic
1133032925 16:3020308-3020330 CCGCCCCCGCCCCCGCCTTCCGG - Exonic
1133045553 16:3086671-3086693 GCGGCCCCAGCCCTGCCCGGGGG - Intergenic
1133233051 16:4375297-4375319 CCTCTCCCAGCCCTGCCAGCTGG + Intronic
1133784428 16:8963598-8963620 CCGGCCCCGGCCCCGGCGGCGGG - Intronic
1134121380 16:11586952-11586974 CCGCCCCCGTCCCCGCCGCCCGG - Intronic
1135557923 16:23452798-23452820 CCGCTCGGGGCCCTGGCCGCGGG - Intronic
1135572293 16:23558090-23558112 CCGGCCCCGGCCCAGCCCCCTGG + Exonic
1135994195 16:27236047-27236069 CCTCCCCTGGCCCTGCCAGCAGG + Intronic
1136403602 16:30031066-30031088 CCGCCCCAGTCCCTGCCGCCCGG + Exonic
1136455738 16:30378761-30378783 TCGCCCCAGGCCCTGCCTCCTGG - Intronic
1136519453 16:30786700-30786722 CCGCCCCTGCCCCGGCCCCCGGG + Intronic
1136556509 16:31010520-31010542 CCGGCCCCGCCCCCGCCCGCAGG - Exonic
1136578065 16:31135774-31135796 CCTCCCCTGGCCCCGCCCACTGG + Intergenic
1138178593 16:54928373-54928395 CCGCCCCCGCCCCCGCCCCGTGG - Intergenic
1138591037 16:58000097-58000119 CTCCCGCCGGCCCTGCCTGCAGG + Intronic
1138619134 16:58197875-58197897 CCGCGCCAGGCCGGGCCCGCGGG + Exonic
1139476882 16:67207300-67207322 CAGCACCAGACCCTGCCCGCTGG + Exonic
1139511616 16:67431220-67431242 CCCGCCCCGCCCCAGCCCGCTGG + Exonic
1139584485 16:67893198-67893220 CCGCCCCCGACCCGCCCCGTAGG + Intergenic
1139630621 16:68230008-68230030 CCACCCCCAGCCCTGCATGCAGG + Exonic
1139664936 16:68448626-68448648 CTCCCTCCGGCCCCGCCCGCAGG + Exonic
1139960155 16:70712882-70712904 CCTTCCCCAGCCCTGCCCGTGGG - Intronic
1140393283 16:74606776-74606798 CAGCCCCCGCTCCTCCCCGCCGG + Exonic
1141430496 16:83968428-83968450 CCGCCCCCACCCCCGCCGGCCGG - Intergenic
1141563395 16:84885138-84885160 CCACCCCCGCCCCTACCCGAGGG - Intronic
1141599026 16:85114112-85114134 CCGCTCCCGTCCCTGCCCCATGG - Intergenic
1141682601 16:85553298-85553320 CCGCCGCCGCCGCTGCCGGCGGG + Intergenic
1141761181 16:86029653-86029675 CCGCCCCCACCGCTGCCGGCTGG - Intergenic
1142154922 16:88528530-88528552 CCGCCCCCGCGTCTGCCCCCAGG - Intronic
1142285848 16:89171297-89171319 CTAGCCCTGGCCCTGCCCGCCGG + Intergenic
1142303286 16:89271174-89271196 CGGTCCCCAGCCCTGCCCCCAGG + Intronic
1142350044 16:89575690-89575712 CCCTCCCCGGCCCCGCCCCCCGG + Intergenic
1142517628 17:443140-443162 CCGACCCCAGCCCAGCCTGCTGG + Exonic
1142547257 17:713747-713769 CCACGCGCGGCCCTGCCTGCAGG - Intronic
1142631538 17:1229306-1229328 CCGCCCCGGGCCCGGCGGGCAGG + Intergenic
1142643651 17:1299096-1299118 CAGACCTCGGCCCTCCCCGCTGG - Exonic
1142672092 17:1491949-1491971 GCGGCCCTGGCCCGGCCCGCAGG - Intronic
1142685967 17:1577152-1577174 CCGCGCCCGGCCCTGCTGGGTGG + Intronic
1142749187 17:1977518-1977540 CCGCCCCCCACCCCGCCCGCCGG + Intronic
1142763420 17:2053840-2053862 CCGCCCCCCGCGCTGTCCTCTGG - Intergenic
1142810314 17:2392987-2393009 CCTCCCCCGGCCTCGACCGCGGG - Intronic
1142854974 17:2724324-2724346 CCGACCCGGGACCTGCCTGCGGG + Intergenic
1143176654 17:4959487-4959509 CTGCCCCCTGCCCTGCCCCAGGG + Exonic
1143479465 17:7220151-7220173 CCCGGCCCGGCCCTGCCCGGCGG + Exonic
1143499459 17:7330359-7330381 CCGCCCCCACCGCTGCCGGCCGG - Intergenic
1143519678 17:7438230-7438252 CCGCCCCCTGCCCCGCCCCCGGG + Intergenic
1144339711 17:14301505-14301527 CTGCCCCATGCGCTGCCCGCGGG - Exonic
1145279430 17:21457100-21457122 CGGGCCCCGCCCCTCCCCGCAGG + Intergenic
1145912900 17:28552642-28552664 CCGCCCCCGGCCGGGGCCCCAGG + Exonic
1145976225 17:28985946-28985968 CAGCCCCCGGCCCTGCGGGAGGG - Intronic
1146022587 17:29292806-29292828 CCGCCCCCGCCCCTCACCCCAGG + Intronic
1146356939 17:32142491-32142513 CCGCCGCCGCCACAGCCCGCTGG + Exonic
1146465638 17:33084075-33084097 CCACTCCCGGCTCTGCCAGCTGG - Intronic
1146654454 17:34626806-34626828 CCACCCCGGGCCCGGCCCCCCGG - Intronic
1147123800 17:38352202-38352224 CCTCGCGCGGCCCGGCCCGCGGG + Intergenic
1147163043 17:38578865-38578887 CAGGCCCCGCCCCTTCCCGCAGG - Intronic
1147168561 17:38605582-38605604 CCGCCCCCGCCCCCGGCCGAGGG + Intronic
1147184451 17:38705795-38705817 GCGCCCCCGGCCGCGCCCTCCGG + Intronic
1147285301 17:39398032-39398054 CCCCCCCCCCCCCCGCCCGCCGG - Intronic
1147677708 17:42219272-42219294 GCCCCTCCTGCCCTGCCCGCTGG + Intronic
1147686218 17:42288305-42288327 CCACGCCCGGCGCCGCCCGCCGG + Exonic
1147688328 17:42300299-42300321 GCCCCTCCTGCCCTGCCCGCTGG - Intronic
1147879768 17:43646118-43646140 CGGCCCCCTGCCCTGCTCCCCGG - Intronic
1147896551 17:43755316-43755338 CCGCCCGCGCCCCTCCCCACCGG - Exonic
1147935201 17:44006963-44006985 CCGCCCCTGGCCCCGCCCACCGG - Intronic
1147967339 17:44200171-44200193 CCGCCCCCGTCCCCGTCCGCCGG - Intergenic
1148095734 17:45051672-45051694 CCTCTCCCGGCCCCGCCTGCTGG - Exonic
1148104289 17:45111101-45111123 CTGCACCCGCCCCTGCCAGCAGG - Exonic
1148122604 17:45221843-45221865 CTGCCCCCGGCCCAGCCCTCTGG + Exonic
1148206485 17:45783390-45783412 CCTCCCCACGCCCTGCCCGCGGG + Intergenic
1148209332 17:45798776-45798798 CCGCCCCCGGCCTTTCTCCCTGG - Intronic
1148491001 17:48024002-48024024 CCGCCCAGAGTCCTGCCCGCTGG - Intergenic
1148873916 17:50675521-50675543 CCTCCCCAGGCCCTGCCAGATGG + Intronic
1149430624 17:56593749-56593771 CCGCGGCCGGCTCTGCCCGGCGG - Exonic
1149629471 17:58110470-58110492 CAGCCCCCAGCCCTGCCTGCAGG + Intergenic
1149828156 17:59848436-59848458 CCGCGCCCGGCCCTGATCACAGG + Intergenic
1149994632 17:61400133-61400155 CCGGCCCCGGCCCCGGCCCCCGG + Exonic
1150273668 17:63882465-63882487 CCGCCCCCGCCCCCGCCCCAAGG - Intergenic
1150373669 17:64662381-64662403 CCGGCCCCGCCCCGCCCCGCCGG - Intergenic
1150747318 17:67825984-67826006 CCCCCCCCGGCCCGGGGCGCTGG - Exonic
1151224935 17:72640787-72640809 CCACGCCCGGCCCTGCCTGAGGG - Intergenic
1151836506 17:76585905-76585927 CCCTGCCCCGCCCTGCCCGCCGG + Exonic
1151933386 17:77247145-77247167 CCGCCCCGGGCGCCGCCTGCGGG + Intergenic
1151978512 17:77495825-77495847 GAGGCCCCGGCCCTGCCTGCTGG + Intronic
1152067999 17:78121977-78121999 ACCTCCCCAGCCCTGCCCGCTGG + Intronic
1152111358 17:78359344-78359366 CGGCTCCCGCCCCTGCCGGCAGG + Intronic
1152241653 17:79164208-79164230 CCGCCACCGCCCCTGCCAGGTGG - Intronic
1152357022 17:79812487-79812509 CCCCGGCCGGCCCGGCCCGCTGG + Intergenic
1152471501 17:80492300-80492322 CCGCCACCTGCCCTGCCACCTGG - Intergenic
1152471524 17:80492374-80492396 CCGCCACCTGCCCTGCCACCTGG - Intergenic
1152544050 17:80991995-80992017 CCGGCCCCAGCCCTGACCCCGGG - Intronic
1152594261 17:81230591-81230613 CCGCACCCGGCCGTGGCTGCAGG - Exonic
1152643414 17:81458316-81458338 TGGCCCCCGGCTCTGCCCGCAGG - Exonic
1152721914 17:81927540-81927562 CCGCCCCGGCCTCGGCCCGCCGG - Exonic
1152729052 17:81961026-81961048 TCGCCCCCGCTCCCGCCCGCCGG + Exonic
1153238689 18:3012635-3012657 CCGCCCCCGGCCCTGCGGGAGGG - Intronic
1153457231 18:5295278-5295300 CCGCCCCCGCCCCCGGCCGCGGG - Intronic
1153688056 18:7566687-7566709 CCGCTCCCGGCCGGGCCCGCCGG - Intergenic
1154330772 18:13427379-13427401 CTGCCCCCAGCCTTGCCCTCAGG - Intronic
1155071855 18:22324247-22324269 CCAAGCCCAGCCCTGCCCGCTGG - Intergenic
1155555220 18:27011371-27011393 CCGCTCACGGCCCTGCACTCAGG - Intronic
1155654297 18:28176927-28176949 CCGCCCGTGGCCCGGCCCGCGGG + Intronic
1156036601 18:32772086-32772108 CCGCCCGCGCGCCGGCCCGCCGG + Exonic
1156448561 18:37253980-37254002 CCGCCCGGGGCGCTGCCGGCGGG + Intronic
1157975519 18:52323079-52323101 CCACCCCTGGCTCTGCCCACAGG - Intergenic
1158954144 18:62523557-62523579 CCGCCGCCGCCGCCGCCCGCGGG + Exonic
1160321505 18:77900299-77900321 GCAGCCCCGGCCCGGCCCGCGGG + Intergenic
1160453461 18:78980201-78980223 CCGCCCCGCGCCGTCCCCGCCGG + Intergenic
1160636498 19:79122-79144 CCGCCCTTGGCCCTGCCCTCAGG - Intergenic
1160725519 19:616374-616396 CCGCGCCCAGCCCGGACCGCAGG + Exonic
1160736652 19:665750-665772 CCGCGCCCGGCCCTTTCCCCTGG + Intergenic
1160745254 19:708527-708549 GCACCCCCGGCCCCGCTCGCAGG - Intergenic
1160749414 19:726986-727008 CCCCACCCGGCCCTCCCCACAGG + Exonic
1160752332 19:740293-740315 CCGCCCCCGCACCCCCCCGCCGG - Intronic
1160775523 19:853407-853429 GCGCCCCCCGCCCCGCCCGGCGG - Intronic
1160861264 19:1238039-1238061 CCGCCCCCCGCCCCGCCGGAAGG - Intergenic
1160863727 19:1248458-1248480 TGGCCCCCGCCCCTGCCTGCCGG - Intergenic
1160874880 19:1292293-1292315 CCACCCCCGGCTCTGCCTGCCGG - Intronic
1160875444 19:1294443-1294465 CAGCCCCCAGCCCTGCCTCCAGG - Intronic
1160876764 19:1300104-1300126 CCGCCCCAGGACCAGCCCTCAGG + Exonic
1160887052 19:1354975-1354997 CCGCCGCCGCCGCTCCCCGCGGG - Intronic
1160898640 19:1415540-1415562 CCGCCCACATCCCTGCCAGCAGG - Intronic
1160919689 19:1513685-1513707 CCGCCTCCCGCCCTCCCTGCCGG + Intergenic
1160939428 19:1613448-1613470 CTGCCCCCAGCCCTGCCCTGGGG - Intronic
1160988720 19:1851998-1852020 GCGCCCCCGGGGCTGCTCGCCGG - Intergenic
1160990974 19:1860187-1860209 CCGCCCCCGCCCCAACTCGCTGG + Intronic
1161027256 19:2042397-2042419 GAGCCCCCAGCCCTCCCCGCGGG + Intronic
1161029411 19:2050892-2050914 CCGCCCTCGGGCCTCCCCCCGGG - Exonic
1161066968 19:2243437-2243459 CCGCTCCCGGTCTTGCCCCCGGG - Exonic
1161153475 19:2721134-2721156 CGTCCCCCGTCCCTTCCCGCCGG - Intronic
1161157466 19:2740059-2740081 CCGCCCACGCCCCTGCCCATTGG + Exonic
1161394533 19:4038203-4038225 CCGCCCCGCGCCCTCCCCTCCGG + Exonic
1161407445 19:4098555-4098577 CCGCCCCCGGCTCTTCCCTCAGG + Intronic
1161487640 19:4544262-4544284 CCGCCTCCGCCCCGGCCCCCGGG + Exonic
1161495378 19:4583499-4583521 CCGCCCCGTGTCCTGCCCGCTGG + Intergenic
1161604390 19:5206669-5206691 CCACCTCCTGCCCTGCCCACTGG + Exonic
1161620145 19:5293278-5293300 CCGCCCCTTGCCCCGCCCCCAGG - Intronic
1161681007 19:5679763-5679785 CTCCTCCCGTCCCTGCCCGCAGG - Exonic
1161682516 19:5687195-5687217 CCGGCCCTGGCCCCGCCCTCTGG + Intronic
1161924730 19:7292456-7292478 CCCCCCCCAGCCCCGCCCCCAGG - Intronic
1161976530 19:7610809-7610831 CCGCCCCCGACCCGGCCCCCAGG - Intronic
1162109684 19:8393397-8393419 CTGCCCCAGGCCCTGTCCTCTGG + Intronic
1162176186 19:8832208-8832230 CCGAGCCCGGCCCCTCCCGCGGG + Exonic
1162315539 19:9936273-9936295 CCGCGCCCGCACCTGCCCGCCGG + Intronic
1162363099 19:10231219-10231241 CGGCTCCCGGCCCTGGCCGGAGG + Exonic
1162371978 19:10285038-10285060 CCCCACCCAGCTCTGCCCGCCGG - Intronic
1162459849 19:10808218-10808240 CCGCCCCCACCCCTGCCCAATGG - Intronic
1162486026 19:10961109-10961131 CTGCCCCCGGCCCCGCGCGGAGG + Exonic
1162486038 19:10961120-10961142 CCTCCCCCGCCCCTCCGCGCGGG - Exonic
1162733788 19:12734584-12734606 CCGCCACCGCCACCGCCCGCGGG + Exonic
1162767777 19:12930399-12930421 CTGCCCCCTGACCAGCCCGCAGG + Intronic
1162797781 19:13095551-13095573 CCGCCCCCAGCCCTGCATGCAGG + Exonic
1162914188 19:13865487-13865509 CCGCCGCGCCCCCTGCCCGCGGG - Intronic
1162951126 19:14072706-14072728 CGGTGCCCGGCCCTGCCCCCGGG + Intronic
1163118371 19:15201067-15201089 CCGCCCCCCGCCCGGCCTCCCGG + Intergenic
1163148679 19:15398835-15398857 CTGCCTTCTGCCCTGCCCGCCGG - Intronic
1163158042 19:15449683-15449705 CCGCCCCCGCCCCCGCCCCGGGG + Intronic
1163406473 19:17126173-17126195 TCGCCTCCAGCCCTGCCTGCTGG + Intronic
1163427136 19:17245877-17245899 CCGCCACCGACCCCGCGCGCCGG + Exonic
1163441282 19:17323776-17323798 CGGCCCCCGACACCGCCCGCAGG - Exonic
1163508022 19:17719687-17719709 CCGCCGCCGCCCCACCCCGCCGG - Intronic
1163517801 19:17775365-17775387 CCGCCCCCCGCCCTGCCCCCAGG - Intronic
1163666533 19:18606402-18606424 GCGCCCCCGGCGCAGCCCTCGGG - Intronic
1163777634 19:19227455-19227477 CAGCTCCCAGCCCTGCCCCCTGG + Exonic
1164283359 19:23788771-23788793 CCTCCCTGGGCCCTGCCCACAGG + Intronic
1164594880 19:29526246-29526268 CCAGCCCCTGCCCGGCCCGCCGG + Intergenic
1164594944 19:29526443-29526465 GCGCCCCCTCCCCTGGCCGCCGG - Intergenic
1164648031 19:29873406-29873428 CCGCTCCGCGCCCTCCCCGCGGG + Intergenic
1165073118 19:33267082-33267104 CCTCCCCCGGCGCTGGCAGCTGG + Intergenic
1165420006 19:35717953-35717975 CTCCCCCCGGCCCTGCGCACGGG + Intergenic
1165795630 19:38517547-38517569 CCCCCTTCCGCCCTGCCCGCCGG + Exonic
1165871301 19:38975474-38975496 CCGCGCCAGGCCCTGCCCGGAGG - Intronic
1166250379 19:41565328-41565350 CCGCCCCCGCCCCTTCCCCAAGG - Intronic
1166340332 19:42133273-42133295 CCGCAGCCGGCCCCGCCCTCCGG - Intronic
1166529558 19:43534384-43534406 CCGCCCCGCGCCCTGCCCCTAGG + Exonic
1166876671 19:45901916-45901938 CCGCCCCCACTCCTGCCCCCGGG - Intronic
1166996445 19:46721875-46721897 CCTCCCCCAGCCCTGGCCCCCGG + Intronic
1167103332 19:47417223-47417245 CCTCCCCAGCCCCTGCCCCCAGG - Exonic
1167149771 19:47701945-47701967 CCTCCCCGTGCCCTGCCTGCGGG - Exonic
1167307140 19:48715704-48715726 CTGGCCCCGGCCTTGCCCTCGGG - Exonic
1167390006 19:49188788-49188810 CAGCCCCCGTCCCTGCTCCCAGG - Intronic
1167659901 19:50790481-50790503 CCACCCCGGGCCCTGCCAGAAGG + Exonic
1167688306 19:50969724-50969746 CCGCCCTCCCGCCTGCCCGCCGG - Intergenic
1168116144 19:54222233-54222255 CAGCCCCAGGCTCTGCCCTCAGG - Intronic
1168119127 19:54241981-54242003 CAGCCCCAGGCTCTGCCCTCAGG - Intronic
1168121910 19:54256444-54256466 CAGCCCCAGGCTCTGCCCTCAGG - Intronic
1168125376 19:54279746-54279768 CAGCCCCAGGCTCTGCCCTCAGG - Intronic
1168132505 19:54330500-54330522 CAGCCCCAGGCTCTGCCCTCAGG - Intergenic
1168133995 19:54338351-54338373 CAGCCCCAGGCTCTGCCCTCGGG - Intronic
1168153454 19:54460933-54460955 CTGCCCCCGCCCCTCCTCGCTGG - Exonic
1168169107 19:54574605-54574627 CAGCCCCAGGCTCTGCCCTCAGG + Intronic
1168171889 19:54594975-54594997 CAGCCCCAGGCTCTGCCCTCAGG + Intronic
1168173796 19:54608398-54608420 CAGCCCCAGGCTCTGCCCTCAGG + Intronic
1168181210 19:54664061-54664083 CAGCCCCAGGCTCTGCCCTCAGG + Intronic
1168185419 19:54697087-54697109 CAGCCCCAGGCTCTGCCCTCAGG + Intronic
1168187401 19:54708909-54708931 CAGCCCCAGGCTCTGCCTGCAGG + Intergenic
1168247012 19:55117504-55117526 CCGCCCCCGGGCCAGCCGCCGGG + Exonic
1168267212 19:55229567-55229589 CTGCCCAAGGCCCTGCCCACAGG + Intergenic
1168270496 19:55247253-55247275 CCCGCCCCGGGACTGCCCGCAGG + Intronic
1168287944 19:55343646-55343668 TCGCCCACAGCCCTGCCCCCTGG + Intronic
1168314148 19:55476755-55476777 CAGCCCCAGGACCTTCCCGCGGG - Exonic
925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG + Intergenic
926268252 2:11344923-11344945 GCGCCCCCTGCCCCTCCCGCCGG + Intronic
927558219 2:24050343-24050365 CCGCTCACAGCCCGGCCCGCAGG - Intronic
927809343 2:26173037-26173059 CCGACCCCGGCCCCGCCCCCGGG - Intergenic
927810780 2:26179200-26179222 CCGCCCCTGGCCCTGCGGGAGGG + Intronic
927988340 2:27429031-27429053 CCGCCCCCGCCCCCACCCGCCGG - Intronic
929107203 2:38377000-38377022 CCGCCGCCGCGCCTGCCCGCCGG - Intronic
929242306 2:39665755-39665777 CCGCCCCCGGCCCGGCCCCCGGG - Intronic
929450361 2:42032877-42032899 CCGCCCCCGCCCCCACCCCCGGG - Intergenic
930651650 2:53970505-53970527 TTCCCCCCGGCCCGGCCCGCAGG + Intronic
931463503 2:62467817-62467839 CCACCCCAGGCCCTGCCACCTGG - Intergenic
931763478 2:65435804-65435826 CCCACCCCGGCCCTTCCCGCGGG + Intergenic
932144691 2:69307075-69307097 CCGCACCCGGCTCGGCCGGCGGG + Intergenic
932340468 2:70960094-70960116 CCTCCCCCAGCCATGCCTGCTGG - Intronic
932621771 2:73269085-73269107 CCGGCCCCGGCCCTTGCCCCGGG - Exonic
932725725 2:74178555-74178577 CCGCCCCCGCCTCGGCCCCCAGG + Intronic
932828003 2:74958960-74958982 CCGCCCTAAGCCCCGCCCGCGGG - Intronic
933700679 2:85253351-85253373 CCGCCCCCGCCCCTGTGAGCAGG - Intronic
934579299 2:95425873-95425895 CCTTCCCCTTCCCTGCCCGCTGG - Intergenic
934600146 2:95650851-95650873 CCTTCCCCTTCCCTGCCCGCTGG + Intergenic
935301473 2:101697409-101697431 CCGCTGCCCGCGCTGCCCGCCGG + Intronic
935396947 2:102619500-102619522 CCCGCCCCGCCCCCGCCCGCGGG + Intergenic
935820459 2:106887532-106887554 CTCCCCGCGGCCCCGCCCGCAGG - Intergenic
936090953 2:109501142-109501164 CCTCCCCCGCCCCTGCCCCTGGG + Intronic
936564983 2:113575918-113575940 CCGCCCTTGGCCCTGCCCTCAGG + Intergenic
937231972 2:120403448-120403470 CTGCCCCCTGCCCTGCCCCGGGG + Intergenic
937307345 2:120880516-120880538 CCAGCCCCGGCTCTGCCCGCAGG + Intronic
937311852 2:120907601-120907623 CAGCCACCTGCCCTGCCCACTGG - Intronic
937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG + Exonic
937951080 2:127388188-127388210 CCGCCCCCGCCCCTGCCCCGGGG + Intronic
938080923 2:128369745-128369767 CCCTCCCAGGCCCTGCCGGCAGG - Intergenic
938101082 2:128498644-128498666 CCTCCCCAGGCCCTGCTCCCTGG - Intergenic
938149846 2:128872948-128872970 CCCCTCCTGGCCCTGCCCGAAGG + Intergenic
938262681 2:129906737-129906759 CCTCCCCCGTGCCTGCCCGAGGG + Intergenic
938285377 2:130109854-130109876 CAGCCCCCTGCTCTGGCCGCTGG - Intronic
938336022 2:130498396-130498418 CAGCCCCCTGCTCTGGCCGCTGG - Intronic
938338896 2:130522730-130522752 CGGCCCGTGGCCCTCCCCGCAGG - Intronic
938350942 2:130598020-130598042 CGGCCCGTGGCCCTCCCCGCAGG + Intronic
938353801 2:130622269-130622291 CAGCCCCCTGCTCTGGCCGCTGG + Intronic
938430226 2:131229046-131229068 CAGCCCCCTGCTCTGGCCGCTGG + Intronic
938475045 2:131602224-131602246 CAGCCCCCTGCTCTGGCCGCTGG + Intergenic
938949586 2:136244251-136244273 CCACCCCCGGCCCTCCCTGGGGG - Intergenic
942046518 2:172102300-172102322 CCGCCGCCGCCGCCGCCCGCCGG + Exonic
942970834 2:181956047-181956069 CCGCCGCCACCCCTGCCCACAGG + Intronic
943669788 2:190648852-190648874 CCGCCCCCGCCCCCGCCCGGCGG + Intronic
944522461 2:200586186-200586208 TCTGCCCCGGCCCTGGCCGCAGG - Intronic
944675847 2:202033873-202033895 CCGCCGCCGCCGCCGCCCGCCGG - Intergenic
945993038 2:216412598-216412620 TCGCCCCCGGCCCTGACCCCAGG - Exonic
946185499 2:217978563-217978585 CCGCCCCTGCCCCCGCCCCCGGG + Intronic
946196159 2:218033989-218034011 GCGTCTCCGCCCCTGCCCGCCGG - Intergenic
946339186 2:219057399-219057421 CGGCCCCGGGCCCAGCCCCCCGG + Intronic
946622316 2:221573114-221573136 CTGCCCCCAACCCTGCCCCCGGG - Intronic
947745061 2:232503185-232503207 GCGCTCCCGCCCCCGCCCGCGGG + Intergenic
948115764 2:235493822-235493844 ACCCCCCTGGCCCGGCCCGCCGG + Intergenic
948174949 2:235935970-235935992 CCTGGCCCGGCCCTCCCCGCTGG + Intronic
948438055 2:237967194-237967216 GCGCCCTCCGCCCGGCCCGCAGG - Intronic
948769925 2:240246489-240246511 CATCCCCCGGCTCTGCCCTCAGG + Intergenic
948795344 2:240399632-240399654 CCGTCCCCTGCCCTCCCCTCAGG - Intergenic
948801558 2:240435633-240435655 CCGCCGCCGGCCCGGCCCCTAGG - Intergenic
948829619 2:240591954-240591976 CCGCCACCTGCCCGGCCCACAGG - Exonic
948867246 2:240782359-240782381 CCGCCCCAGGCCCTGCCGTGAGG + Intronic
948910249 2:240999097-240999119 GCGCCCCGGCCGCTGCCCGCCGG + Intronic
948945889 2:241218488-241218510 CCTCCCCCGGCCTTGCCCGGCGG - Intronic
949006970 2:241655214-241655236 CCGCCCCCAGCCCTGACCTCTGG - Intronic
949021712 2:241744517-241744539 CCGACCCCGGGCGTGCCCCCTGG + Intronic
1168769759 20:407957-407979 CCGGCCCCGGCCCCGGCCCCCGG + Intronic
1169207821 20:3749899-3749921 CCGGCCCCGCCACTGCCCCCTGG + Intronic
1169262431 20:4148720-4148742 CCTCCCCGGGCCCGCCCCGCCGG - Intronic
1169367224 20:5001366-5001388 GCGCCCCCTGCCCGGCCTGCGGG - Intronic
1171122549 20:22579279-22579301 CGGCCCCCGGCCCTGCCTCTCGG + Intergenic
1171974847 20:31587901-31587923 GCGCCCTCGCCCCCGCCCGCCGG + Intergenic
1172121394 20:32601001-32601023 CCAGCCCAGGCCCTGCCCACTGG + Intronic
1172618698 20:36306387-36306409 CCGCCCCGGCTCCGGCCCGCGGG - Exonic
1172658069 20:36549055-36549077 CCCACCCTGCCCCTGCCCGCAGG + Exonic
1173516230 20:43667229-43667251 CCGCTCCGGGCTCTGCCGGCGGG + Exonic
1173548160 20:43914841-43914863 CCCGCCCAGGCACTGCCCGCGGG + Intergenic
1173852403 20:46227455-46227477 CCGCCCCTGGCCCCGCCCCACGG + Intronic
1174204335 20:48828005-48828027 CCGCCCCCGGCCCAGCCGCCCGG - Intergenic
1174287814 20:49484379-49484401 CCGCCCCCGGCCTCCCCGGCAGG - Intergenic
1174305897 20:49614099-49614121 CCGCCCCCGACCCTGGCACCTGG - Intergenic
1174386375 20:50190539-50190561 CCGCCCCCGGACCGCCCCTCTGG - Intergenic
1174573523 20:51521239-51521261 TGGCCTCGGGCCCTGCCCGCTGG - Intronic
1175074031 20:56358896-56358918 CCCTCCCCGGCCCCGCCCGCCGG - Exonic
1175415811 20:58800308-58800330 CCGCCCCCGCCACTGACCTCAGG - Intergenic
1175831057 20:61965745-61965767 CCGCCCCGGGCCTTACCCACGGG + Intronic
1175847034 20:62064851-62064873 CCGCCCCCGCCCCGGCCGCCGGG - Exonic
1175895246 20:62333140-62333162 CCTGCCCCGGCCCTGCCCCACGG - Exonic
1175927005 20:62475929-62475951 CTGCCGCCCTCCCTGCCCGCTGG - Exonic
1175940241 20:62534440-62534462 CAGCCCCCGGGGCTGCTCGCTGG + Intergenic
1175943885 20:62550042-62550064 CCACCCCCGGCCCTGCAGCCTGG + Intergenic
1175955503 20:62607001-62607023 CCCCACCTGGCCCTGCCCACGGG + Intergenic
1175992051 20:62794507-62794529 CCGGCCCCGGCCCCGCCCCGCGG + Intergenic
1176173532 20:63707333-63707355 CCGGCCCCTCCCCTGCTCGCGGG + Intronic
1176178785 20:63740214-63740236 CCGCCCCCAGCCCGGCGCGGCGG - Intronic
1176180354 20:63746902-63746924 CAGCCACCGACCCTGCCGGCGGG + Exonic
1176390457 21:6160473-6160495 CCACCCCCAGACCTGGCCGCAGG - Intergenic
1176685812 21:9847701-9847723 TGACCCCCGCCCCTGCCCGCCGG + Intergenic
1178104136 21:29299279-29299301 CCACCCCCCTCCCTGCCCTCGGG + Intronic
1178584849 21:33863363-33863385 CCGTGCCCGGCCCCGGCCGCTGG - Intronic
1178610191 21:34073377-34073399 CCGACCCCAGCCCAGCCCGCCGG - Intronic
1178913290 21:36693336-36693358 CTACCCCCGGCCCTGGGCGCCGG - Intergenic
1178981411 21:37267900-37267922 CCGCACCCTGCCCTTCCCGCGGG + Intronic
1179529738 21:42010434-42010456 CCCCCCCCCGCCCCGCCCTCCGG - Intergenic
1179733010 21:43377767-43377789 CCACCCCCAGACCTGGCCGCAGG + Intergenic
1180060857 21:45384143-45384165 CACCCCCCGGCCCTGCCCCCAGG - Intergenic
1180095891 21:45555223-45555245 CCGCCCCCTGCGCCGCCCCCCGG - Intergenic
1180099260 21:45576792-45576814 CGGCCCCTGGCCCTGCCCCAGGG - Intergenic
1180559172 22:16601795-16601817 CCGCCCGCGGCCCCTCCCCCGGG - Intergenic
1180699509 22:17773987-17774009 CTGCACCCGGCCAGGCCCGCGGG + Exonic
1181030571 22:20147305-20147327 CCACCCCCAGCCCTGCCCCAGGG - Exonic
1181087704 22:20449949-20449971 CCGCCGCCGCCCCGGCCCGGAGG - Intronic
1181458085 22:23070748-23070770 CCGCCCCCTGCCCACCTCGCAGG - Intronic
1181466256 22:23112250-23112272 CAGCCCCAGGCCCTGCCTGGGGG + Intronic
1181512735 22:23396073-23396095 CCACCCCCAGCCCTGCCCCAGGG + Intergenic
1181532091 22:23522667-23522689 CCGCGCCCGGCACAGCCTGCTGG - Intergenic
1181695982 22:24593000-24593022 CAGCCTCGGGCCCGGCCCGCCGG + Exonic
1181697918 22:24603119-24603141 CCTCCCCCCGCCCCGCCCCCAGG + Intronic
1182093164 22:27609600-27609622 CCGCTCCCGTCCCTTCCCCCAGG + Intergenic
1182296065 22:29311728-29311750 CGGTCCCCAGCCCTGCCCGGCGG + Intronic
1182338847 22:29603513-29603535 CTGCTCCCGGCCCCGCCCTCAGG - Intergenic
1182422908 22:30257293-30257315 CTACCCCCGGCCCTGCCCCTGGG + Intergenic
1182586127 22:31345301-31345323 CTGCCCCCGGCCCCGCCGCCTGG + Exonic
1182586513 22:31346715-31346737 CAGCCCCCGGCCCCGCGGGCGGG - Intergenic
1183063279 22:35348167-35348189 CAGCCACCGCCCCTGCCCGGAGG + Intergenic
1183081905 22:35462225-35462247 CCGCCTCGGGCCCTGGCCACTGG + Intergenic
1183293865 22:37018934-37018956 CCGGCCCCGCCCCTCCCAGCCGG + Exonic
1183358936 22:37373472-37373494 CTGCCCCCGCCGCTGCCCGCCGG + Exonic
1183665538 22:39244020-39244042 CAGCCCCCCACCCTGGCCGCGGG - Exonic
1183702162 22:39457101-39457123 GCGCCCCCGGCCCGGCGCGGCGG + Intergenic
1183955955 22:41381177-41381199 CGGTCCCCGGCCCTGCCCTCAGG + Intronic
1184037731 22:41926502-41926524 CCCCTCCAGGCCCTGCCCACAGG + Intronic
1184472153 22:44702172-44702194 CCGCCCCTGGGCCCGCCCCCGGG + Intronic
1184659812 22:45960567-45960589 CGGCCCCTGGCCCTGGCTGCCGG + Intronic
1184662284 22:45970898-45970920 CCGCAGCCGGGGCTGCCCGCCGG + Intronic
1185011197 22:48315677-48315699 CCGCCTCCGGCCATGGGCGCGGG - Intergenic
1185037997 22:48489722-48489744 CCGGCCCCGGCACGGCCCTCTGG + Intronic
1185047947 22:48538312-48538334 CTGCCCCGAGCCCTGCCCTCAGG + Intronic
1185259589 22:49854038-49854060 CCGGCCCCGGCGCGGTCCGCGGG - Intronic
1185259647 22:49854178-49854200 CGGACCCCGGCCCTGACAGCTGG + Intronic
1185333456 22:50261653-50261675 CCGCTCCCGGCCCTTCCCTCAGG + Exonic
949987516 3:9552684-9552706 CCGCCGCCGGCCCCGCCTCCGGG - Exonic
949999994 3:9649439-9649461 CCGGCCCCGCCCCGTCCCGCCGG - Intronic
950167958 3:10815989-10816011 CTTCCCGCGGCCCTGCCCACTGG - Intergenic
950578924 3:13850393-13850415 CCCACCCCTGCCCTGGCCGCAGG - Intronic
950729852 3:14947825-14947847 CCGCGCCCTGCCCTCCGCGCCGG + Intronic
950968879 3:17166809-17166831 TCGGCCCTGGCCCTGGCCGCTGG + Exonic
953031226 3:39181063-39181085 CCGCCCCCGCCCCTCCTCGGCGG + Intergenic
954249734 3:49358416-49358438 CCGGCCCCCGCCCTACCCGGAGG + Exonic
954313282 3:49786493-49786515 CAGCTCCCGGCGCTGCCCACTGG + Intronic
954411418 3:50372854-50372876 GTGCCCCTGGCCCTGCCTGCAGG - Intronic
954468993 3:50675382-50675404 GTGCCCCCGCCACTGCCCGCAGG + Intronic
956195608 3:66651097-66651119 CCCCCCCCCGCCATCCCCGCTGG - Intergenic
960974990 3:123164659-123164681 CAGGCACCAGCCCTGCCCGCAGG + Intronic
961106900 3:124250045-124250067 CCCCCCCAGGCCATGCCCACTGG - Intronic
961182384 3:124887050-124887072 CCGGCCCCAGCCCCGGCCGCCGG - Exonic
961331375 3:126142838-126142860 CAACCCCCGACCCTGCCCGTGGG - Intronic
961453702 3:127014130-127014152 CCGCCCACTGCCCACCCCGCCGG - Intronic
961574497 3:127823325-127823347 GCGCCCCCGCTCCTCCCCGCGGG - Intergenic
961754921 3:129121836-129121858 CCGCCCCCGGCTCCGCCCTCAGG + Intronic
961754934 3:129121871-129121893 CCGCCCCCAGCCCAACCCTCGGG + Intronic
962319915 3:134381916-134381938 CCGCCCCAAACCCTGCCTGCTGG - Intergenic
962891740 3:139678069-139678091 CTGCCCCCGCCCCCGCCCGCTGG + Intergenic
963107666 3:141660408-141660430 CCGGCCCCTGCCCGCCCCGCCGG - Intergenic
963827283 3:149970187-149970209 GCGGCCCCGGCCCGGCCCCCGGG - Intronic
963904637 3:150763274-150763296 CGGCCCCCTGCGCTGCCAGCTGG - Exonic
966350140 3:179024838-179024860 CCTCCCCCCGCCCCGCCCCCGGG + Exonic
966372142 3:179261336-179261358 CGCCCCCTGGCCCGGCCCGCGGG - Intronic
966886615 3:184380620-184380642 CCGCCCCGGGGGCTGCCCGCGGG - Intronic
967055359 3:185825132-185825154 CCGCCTCCGCCTCTGCCCCCGGG - Intergenic
967255857 3:187591230-187591252 CCGCCCCCTGCCCCTCCCCCTGG - Intergenic
967493655 3:190120433-190120455 CCGCTCCCGCCCCCGCCCCCCGG - Exonic
968133696 3:196207635-196207657 CCGCCCCTGGCCCCGCCCCCAGG + Intronic
968178122 3:196568827-196568849 CCACTCCCGCCCCTGCCCGGGGG - Exonic
968293449 3:197555866-197555888 CCCCCCTCGGCTCTCCCCGCAGG - Exonic
968341572 3:197960172-197960194 CCGGCCCCGCCCCTCGCCGCTGG - Intergenic
968434143 4:576308-576330 GCGCCCCCTCCCCAGCCCGCGGG + Intergenic
968457164 4:705736-705758 CCGCCCACGCCCCTTGCCGCGGG + Intronic
968457664 4:707203-707225 CCCCCCCGGGCCCTGCCAGGTGG - Intronic
968479186 4:826261-826283 CCGCCTCCGCCCCCGCCCCCGGG - Intergenic
968479330 4:826487-826509 CCACCCCCGCCCCCGCCCCCGGG - Intergenic
968506443 4:973353-973375 CCGGCCCCGGCCCCGGCCCCGGG + Exonic
968601323 4:1511381-1511403 CCGCCCCAGTCCCTGCCACCAGG + Intergenic
968653971 4:1770773-1770795 CCTCCCCCACCCCTGCCCGATGG - Intergenic
968701159 4:2058965-2058987 CCGACCCCGGGCCCGACCGCTGG - Intergenic
968809323 4:2792971-2792993 CCGGCCCCGCCCCTCCCCGGCGG - Intergenic
968965260 4:3766283-3766305 CCGCCCTCGGCCCGGCTCACGGG - Intergenic
969271356 4:6105443-6105465 CCGCCCCCTCCCCCGCCCGCGGG - Intronic
969506889 4:7593650-7593672 CCGCCCCCACCCCCGCCCCCAGG - Intronic
969694197 4:8725562-8725584 CCGCCCCTGGCCCCTCCAGCCGG - Intergenic
970636979 4:18021185-18021207 CCTCCGGCCGCCCTGCCCGCCGG + Intronic
970967863 4:21948813-21948835 GCGCCCCCGGCGCCCCCCGCCGG - Intergenic
971324505 4:25633147-25633169 CCGCGCCCGGCCTTGCCTCCGGG + Intergenic
972543145 4:40056694-40056716 CCGCCCCCCCCCAAGCCCGCCGG - Intergenic
973317687 4:48779518-48779540 TCCCCGCCAGCCCTGCCCGCCGG + Intronic
974047136 4:56907864-56907886 CCGCCGCCGCCACCGCCCGCGGG - Intronic
974637114 4:64579702-64579724 TGACCCCCGCCCCTGCCCGCTGG + Intergenic
975118537 4:70705072-70705094 CCGCCGCCGGCCTCCCCCGCCGG + Intronic
976398467 4:84582789-84582811 CCGCCCCCGCCTCTGCGTGCTGG - Intergenic
980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG + Intronic
982380605 4:154744017-154744039 CTGCCCCCGGCACGGCCCCCAGG + Exonic
983238615 4:165207386-165207408 CCGCCCGCGTCCCGGCCTGCGGG + Intronic
983249286 4:165326892-165326914 CCGCCCCCGCCCCCGCCCCCGGG + Intergenic
983932744 4:173471339-173471361 CCGCCACTGGGCCTGACCGCTGG + Intergenic
984947193 4:184979035-184979057 CTGCCCCTGCCCTTGCCCGCTGG + Intergenic
985129094 4:186723876-186723898 TCCGCCCCGGCCCCGCCCGCCGG + Intronic
985489046 5:168349-168371 GCGCCCCCGGCCTTGCTCTCCGG + Intronic
985530176 5:429478-429500 CCGGCCCTGCCCCTGCCCCCTGG + Intronic
985611806 5:893299-893321 CCGACCCGAGCCCTGCGCGCAGG + Intronic
985630010 5:1009228-1009250 CCGCCCCCCGCCCCGCCCGTCGG - Intronic
985769389 5:1799503-1799525 CCGGAGCCGGCCCTGCGCGCGGG + Intronic
985791593 5:1931145-1931167 CCGCCCCCGTGCCTCTCCGCAGG + Intergenic
985896293 5:2751562-2751584 CCGCCGCCGCCCCGGCCCGCGGG - Exonic
987084640 5:14457379-14457401 CCCCCCCCCGCCCCGCCCCCCGG + Intronic
987340671 5:16936356-16936378 CCGCTCGCGGCCCCGCCCCCAGG + Intergenic
990175992 5:53109546-53109568 GCGCCCCCGCCCCCGCCCCCGGG - Exonic
991769206 5:70025290-70025312 CCGCCAACGGCCCCGCCCGCTGG - Exonic
991848501 5:70900708-70900730 CCGCCAACGGCCCCGCCCGCTGG - Exonic
992249808 5:74866011-74866033 CTGCGCCAGGCCCAGCCCGCAGG + Intronic
992627661 5:78649156-78649178 CCGCCTCCGGCCCTCCCGGCAGG - Intronic
994947767 5:106417449-106417471 CCGCCGCCGGCCTCCCCCGCCGG - Intergenic
996862765 5:128084096-128084118 CCGCCGCCGTCCCGGCTCGCGGG - Exonic
997253591 5:132410544-132410566 CCGGCCCGGGACCTGACCGCTGG - Intergenic
997282764 5:132659104-132659126 CCCACCCTGGCCCTTCCCGCAGG + Intronic
997297533 5:132777303-132777325 CCGCCCCTGCCCCCGCCCGCGGG + Exonic
997365668 5:133323682-133323704 CAGCCCCTGGCCCTGGCCTCAGG + Intronic
998119157 5:139561746-139561768 CCGCCCCCGTCCCCGCCCCGGGG + Exonic
998367531 5:141640696-141640718 CACCCCCTGGCCCTGCCAGCTGG - Exonic
998374007 5:141679777-141679799 CTGCCCCCACCCCTGCCCTCAGG - Exonic
999604079 5:153296730-153296752 CAGCCCCCCGCCCGGCCAGCTGG - Intergenic
1001476497 5:172054534-172054556 CTGCCCCTGCCCCTGCCCCCAGG - Intronic
1001646182 5:173283950-173283972 CCGGAACCAGCCCTGCCCGCCGG + Intergenic
1001823177 5:174725345-174725367 CAGCCCTCGGCCCTGCGCTCTGG + Intronic
1002432116 5:179209665-179209687 CTCCCCACAGCCCTGCCCGCAGG - Intronic
1002603917 5:180370843-180370865 CTGGCCCCTGCCCTGCCTGCAGG - Intergenic
1002622102 5:180494940-180494962 CCGCCCCGGGCCGCGCCCCCGGG + Intronic
1002925736 6:1604890-1604912 CCGGCCCCGGCCCAGGCCCCCGG + Intergenic
1003545016 6:7051863-7051885 CAGCCCCCGGCCCGGCCCGGTGG + Intergenic
1004396260 6:15248549-15248571 CTTCCCGCGGCCCTGCCTGCGGG + Intronic
1004690226 6:17987290-17987312 CCGCCTCCGCCCCGGCCCCCCGG + Intronic
1006220401 6:32484604-32484626 ACCCTCCCGGCCCTCCCCGCAGG + Intergenic
1006504082 6:34476770-34476792 CCGCCCCCGGCCCTGTCCAGGGG - Intronic
1007111183 6:39314271-39314293 CAGCCCCGGACCCTGCCCTCGGG + Exonic
1007320926 6:41028346-41028368 CCTCCTCCGGCCCTGCCCGCTGG + Exonic
1007701777 6:43770118-43770140 CCGCCCCCGGCCCGCCCCGGGGG - Intergenic
1007785267 6:44276194-44276216 CGGGCCCCGGGCCGGCCCGCGGG - Exonic
1007844054 6:44739368-44739390 CCGGCCGCCACCCTGCCCGCGGG - Intergenic
1010244800 6:73653514-73653536 CCGCCCCCGCCCCCGCCCGGTGG + Intronic
1010415005 6:75602327-75602349 GCGCGCCCGGGCCTGTCCGCGGG - Exonic
1011640373 6:89412002-89412024 CCGTCCCCGGGCCGGCCGGCCGG - Exonic
1011640439 6:89412193-89412215 CCCTCCCCCGCCCCGCCCGCCGG + Exonic
1012939648 6:105403118-105403140 CCGCCGCTGGGCCCGCCCGCCGG - Intergenic
1013155747 6:107490069-107490091 CCGCCCCCGGCTCGGCTCGCGGG + Exonic
1013793310 6:113859011-113859033 CCCAGCCGGGCCCTGCCCGCAGG - Intronic
1015039811 6:128703533-128703555 CGCCCCCCAGCCCTGCCCCCCGG + Intergenic
1015251920 6:131135798-131135820 TCGCCCCCGCCCCGGCCCGCTGG - Intronic
1015626275 6:135182817-135182839 CCCCGCCCAGCCCAGCCCGCGGG - Intronic
1016448321 6:144155329-144155351 CCGCCCCTGCCGCTGCCCCCAGG - Intronic
1016949577 6:149566623-149566645 GGACCCCCGCCCCTGCCCGCCGG - Intronic
1017163777 6:151390281-151390303 GCGCCCCCGGCCCCGCCCCGGGG - Intronic
1017383486 6:153857017-153857039 CCACCCCCGCCCCTGCCCCATGG - Intergenic
1017497637 6:154995561-154995583 CCGCGCGCCGCCCCGCCCGCAGG - Intronic
1018330988 6:162727513-162727535 CCGTCCCCGGCCCGCGCCGCCGG - Intronic
1018628727 6:165804788-165804810 CCGCCCGCGGCCCGGCCCCGGGG - Intronic
1019047835 6:169161977-169161999 CCTCCCCCTGCCCTGTCCACGGG + Intergenic
1019164774 6:170091061-170091083 CTGCTCCCGGCCTTGCCCCCTGG + Intergenic
1019299418 7:295943-295965 CCGGCCCCCGCCCTGCCCCAGGG + Intergenic
1019343825 7:520271-520293 CCGCCCCCGCCCCGGCGCTCCGG + Intronic
1019363104 7:616091-616113 CCAGGCCCAGCCCTGCCCGCGGG + Intronic
1019437184 7:1028278-1028300 CCGGCGCCGTCCGTGCCCGCGGG - Intronic
1019496814 7:1344634-1344656 CTGCTCCCGGCTCTGCCCGCCGG + Intergenic
1019711162 7:2518918-2518940 CCATCCCCGGCCCTTCCCACGGG - Intronic
1019917872 7:4144991-4145013 CCGCCCCAGGCCTCCCCCGCTGG - Intronic
1020049462 7:5072355-5072377 CCGACAGCCGCCCTGCCCGCAGG + Exonic
1020086789 7:5314946-5314968 CCGCCCACCGCCCTGCCCTGGGG + Intronic
1020105674 7:5421268-5421290 CAGCCCCCCACCCGGCCCGCAGG + Exonic
1020140338 7:5608180-5608202 CCTGCCCAGGCCCTGCCCTCTGG + Intergenic
1020225365 7:6275491-6275513 CCGCACCCGGCCCAGTCCCCAGG + Intergenic
1021776539 7:24059930-24059952 CCGCCGCCACCCCTCCCCGCAGG - Intergenic
1022092002 7:27113900-27113922 CCGCCCCCTGCCCTTCCCGAGGG + Intronic
1022207710 7:28180106-28180128 CCGCCCCGCGCCCCGCGCGCCGG + Intronic
1024519300 7:50290043-50290065 CCATCCCCTGCCCTGCCCACTGG + Intergenic
1025004770 7:55345104-55345126 CCGCGCCCCGCCCTGGCCTCTGG + Intergenic
1026736856 7:72954513-72954535 GCTCCCCCGGCCCTCCTCGCCGG + Intergenic
1026787075 7:73308586-73308608 GCTCCCCCGGCCCTCCTCGCCGG + Intronic
1026850357 7:73719716-73719738 CCGGCCCCGCCCCGGCCCCCGGG + Intergenic
1026903148 7:74048061-74048083 CCTCCCCCTGCTCTGCCCTCGGG - Intronic
1026968202 7:74453643-74453665 GCGCCACCGCCCCTCCCCGCAGG + Intergenic
1027106878 7:75410550-75410572 GCTCCCCCGGCCCTCCTCGCCGG - Intronic
1027421167 7:78019527-78019549 CAGCCCCCGGGCCTTCGCGCCGG + Exonic
1028070076 7:86440651-86440673 CCGCCCCCGGAGCAGCCGGCCGG + Intergenic
1028762443 7:94510315-94510337 CTTCCGCCGGCCCGGCCCGCGGG + Intronic
1028830775 7:95324575-95324597 CCCGCCCCGCCCCTCCCCGCCGG + Exonic
1029123867 7:98284588-98284610 CTGCCCCAGGTCCAGCCCGCCGG + Intronic
1029456949 7:100676233-100676255 CCGCCCCCAACCCTGCCCCACGG + Exonic
1029523176 7:101077444-101077466 CCTCCCCAGGCTCTGCCCACTGG + Intergenic
1029540699 7:101180391-101180413 CGACCCCCGGCCCCGCCAGCAGG - Intergenic
1030033310 7:105388474-105388496 CCGCCGCCGCCCCTCCCCCCGGG + Intronic
1030819286 7:114076968-114076990 CGGTCCCGAGCCCTGCCCGCCGG + Intergenic
1030820175 7:114084968-114084990 CCGGTCCCTCCCCTGCCCGCGGG - Intergenic
1031833920 7:126659032-126659054 CCGCCCCCCGCCCCGCCCCCAGG + Intronic
1032298776 7:130668334-130668356 CCGCCTCCTCCCCTGCGCGCGGG - Intronic
1033372566 7:140724197-140724219 CCGCCCCTGCCCCTGCCCCACGG + Intronic
1033406366 7:141074003-141074025 CCGCCCCCTCCCCGCCCCGCAGG - Intergenic
1034228044 7:149497876-149497898 CCCCGCCCAGCCCCGCCCGCGGG + Intergenic
1034234260 7:149554978-149555000 CAGCCCCCCGCCCGGCCGGCCGG + Intergenic
1034271779 7:149806624-149806646 CCGCCCCATGCCCTGCTTGCAGG + Intergenic
1034415564 7:150962759-150962781 CCGCCCCAGCCCCTGCCATCAGG - Intronic
1034439737 7:151080650-151080672 CCTCCCGCAGCCCTCCCCGCAGG + Intronic
1034455408 7:151167499-151167521 CCGCCCCCGCCGTTGCCCCCAGG + Exonic
1034560600 7:151877252-151877274 GCGCTCGCGGCCCTGCGCGCCGG + Intergenic
1034963000 7:155374055-155374077 CCGCCCTCGGGCCTCCGCGCCGG - Intergenic
1035099938 7:156388374-156388396 CGGCCCCAGGCTCTGCCCCCTGG + Intergenic
1035167410 7:156999980-157000002 CCGGCCCCGGGCCCGCCCCCCGG - Intronic
1035725510 8:1823329-1823351 CCGCAGCTGGCCCTGCCCACAGG - Intergenic
1035747573 8:1973562-1973584 CCTGCCCCGCGCCTGCCCGCCGG - Intergenic
1036967741 8:13319461-13319483 CCCCCCCCCGCCCCGCCAGCAGG - Intronic
1037402317 8:18505325-18505347 CCGCCCACAGGCCTGCCTGCTGG + Intergenic
1037903831 8:22703774-22703796 CCGCCCGCGGCCCGGGCGGCGGG - Intergenic
1038256352 8:25954690-25954712 CCGCCCCCGCCCCTTCCCCCAGG + Intronic
1038450026 8:27633917-27633939 CCGCCGCCCGCGCTTCCCGCTGG - Intronic
1038540199 8:28385440-28385462 GCGCCCCTGGCCCTCCCCGGCGG - Intronic
1039400143 8:37262384-37262406 CCACCCCCTGCCCAGCCTGCAGG + Intergenic
1039554334 8:38466223-38466245 ACGCCCCCGGCCCTGCGCACCGG + Intronic
1040495399 8:47961026-47961048 CCGCGCCACGCCCTCCCCGCCGG - Exonic
1041083241 8:54233578-54233600 CCACCCCCACCCCTGCCCCCCGG + Intergenic
1041743676 8:61183139-61183161 CCCCCCTCCGCCCTGCCCACAGG - Intronic
1042155812 8:65842483-65842505 CCGTCCTCAGCCCTGACCGCGGG + Intergenic
1042611664 8:70607787-70607809 CCGCCGCCGCCCCCTCCCGCAGG - Intronic
1043388154 8:79768013-79768035 CCGCGCCCGCCCCTGCCCGGCGG + Intergenic
1043398953 8:79864925-79864947 CCCCCCCCCGCCCTGCCCCCCGG - Intergenic
1043542584 8:81280431-81280453 CCGGTCCCCGCCCCGCCCGCCGG - Exonic
1045432055 8:102123818-102123840 CCGGCCCCGGCCCCGGCCCCCGG + Intronic
1047024503 8:120811575-120811597 CAGCCCCCGGACTCGCCCGCCGG - Exonic
1047246691 8:123152352-123152374 CCACCCCCGCCTCTGCCAGCGGG + Intergenic
1047393725 8:124475033-124475055 CCGCCCCCGGCCGCGGCCCCGGG + Exonic
1049109604 8:140635138-140635160 CGGCCCCGGCCCCAGCCCGCGGG + Intronic
1049193493 8:141302407-141302429 CCGACCCCACCCCTGCCCCCAGG + Intronic
1049208995 8:141376708-141376730 CCGCCCCCCACCCTGCTCTCAGG + Intergenic
1049254189 8:141605178-141605200 CCGATGCCGGCCCTGCCCTCTGG + Intergenic
1049351290 8:142166208-142166230 CCACCCCTGGCCCCGCCTGCAGG + Intergenic
1049396334 8:142402923-142402945 CCGCCCCCTCCCCTCCCCACCGG + Intronic
1049409124 8:142464666-142464688 CCGGCCCCGGGCCGGGCCGCCGG + Exonic
1049424819 8:142533247-142533269 CCGCCCCCGCCCCTGCCCCCAGG - Intronic
1049608280 8:143540019-143540041 CCACCACAGGCCCTGCCCCCGGG + Intronic
1049687266 8:143944000-143944022 CCGGAGCCTGCCCTGCCCGCAGG + Intronic
1049733181 8:144189576-144189598 CCGCTCCCAGCTCTGCCCTCAGG + Intronic
1049782641 8:144435879-144435901 CAGCCGCCGGCCCCGCCCCCGGG - Exonic
1049786004 8:144451193-144451215 CGGCACCCAGCCCTGCCCGAGGG + Intronic
1049798913 8:144508883-144508905 CCGCGCCCAGCACTGCCGGCCGG - Intergenic
1049884388 9:17690-17712 CACCCCTCGGCCCTGCCCTCTGG + Intergenic
1049887440 9:37295-37317 CCGCCCTTGGCCCTGCCCTCAGG - Intergenic
1050475335 9:6034818-6034840 CCGCCATCTGCCTTGCCCGCAGG + Intergenic
1050874023 9:10613108-10613130 CCGCCCCGGCCCCCGCCCGCCGG - Intergenic
1053054547 9:34986772-34986794 CCACCCCCACCCCTGCCCACGGG + Intergenic
1053489306 9:38487552-38487574 CGGCCCTCAGCCCTGCCCGGTGG - Intergenic
1054274207 9:63052593-63052615 CCGCCCCCCCCCCCGCCCCCGGG + Intergenic
1054434240 9:65196691-65196713 CCGCCCCCCCCCCCGCCCCCGGG - Intergenic
1055030639 9:71768976-71768998 CCCCGCCCGGCCCCTCCCGCCGG + Intronic
1055497169 9:76867204-76867226 CCGCCCCCGCCCCCGCCAGCAGG + Intronic
1055638138 9:78297488-78297510 CTGCCCCTGGCCCTGACTGCTGG + Intronic
1055785205 9:79863731-79863753 CCGGCCCCGGCCCCGGCCCCGGG + Intergenic
1056154149 9:83817834-83817856 CCGCCCCCGCCCCCGCCCCGAGG - Intronic
1056773775 9:89497601-89497623 CCTCCCCAGTCCCTGCGCGCAGG - Intronic
1057129315 9:92642114-92642136 CAGCCCCAGGGCCTGCTCGCTGG + Intronic
1057225298 9:93289671-93289693 CCACCCCCGGGCCTGCGCCCGGG - Intronic
1057355122 9:94325831-94325853 CCGCTCCCGGCCCAGCACACAGG - Exonic
1057596338 9:96418499-96418521 CCGGCCCCGCCCCGGCCGGCTGG - Intergenic
1057801267 9:98192674-98192696 CGCCCTCCGGCCCCGCCCGCCGG - Intergenic
1057828874 9:98392138-98392160 CAGCCCCGGGCTCTGCCCCCAGG - Intronic
1058439091 9:104991224-104991246 CCAGCGCCGGCCCCGCCCGCCGG + Intergenic
1058511790 9:105727218-105727240 CCTCCCCCGACCCTGCCCACTGG + Intronic
1058687122 9:107489050-107489072 CCGCTCCCTGCCTTGCTCGCAGG - Exonic
1058908259 9:109498365-109498387 CCGCCCCCCGCCCGGCGCGCGGG - Intergenic
1058912560 9:109534262-109534284 CCGCCCCCCGCCCTCAGCGCCGG - Intergenic
1059416912 9:114168073-114168095 AGGCACCCGGCGCTGCCCGCAGG - Exonic
1059471218 9:114505690-114505712 CCGCTCCCGGCTCTGCCGGCGGG - Intergenic
1060151199 9:121289424-121289446 CCGCTCCCCTCCCTGCCTGCTGG + Intronic
1060215587 9:121736564-121736586 CCGCCCCAGCCCCAGCCCTCCGG - Intronic
1060468740 9:123930179-123930201 CTGCCGCCGCCGCTGCCCGCTGG + Intergenic
1060481381 9:124018445-124018467 CCGCCCCCTGCCCTTGCCTCTGG + Intronic
1060485893 9:124045857-124045879 CCGCCCCCCGCCCACCGCGCGGG - Intergenic
1060496812 9:124125433-124125455 CCGCCCCCAGCCTTGCCAGGGGG + Intergenic
1060700475 9:125746547-125746569 CCGCCGCCGGCACCGCCCCCGGG - Intergenic
1060700714 9:125747284-125747306 CAGCCGCGGGCCCTGCCGGCCGG + Intergenic
1060945865 9:127569084-127569106 CTGCCCTCGGCCCTGCACCCCGG + Exonic
1060981233 9:127793433-127793455 CCGCACAAGGCCCTGCCCTCTGG - Intergenic
1061042818 9:128149684-128149706 CTTCCCCAGGCCCTGCCTGCAGG - Intronic
1061180250 9:129021289-129021311 CCAGACCCGGCCCTGCCCACAGG + Intronic
1061263142 9:129490898-129490920 CCGCCCCAGGCCCTGGCCTCTGG + Intergenic
1061264457 9:129497216-129497238 CCTCCCCAGGCCCTGCCAGCTGG - Intergenic
1061366023 9:130172778-130172800 CCGCCCCCGCCCCCGCCCCCCGG + Intronic
1061413648 9:130433918-130433940 CTTCCCCGGGCCCTGCCTGCGGG - Exonic
1061415467 9:130444900-130444922 CGGTCACCGGCCCTGCCCCCGGG + Intergenic
1061792596 9:133066508-133066530 CCCTCCCCTGCCCTGCCCCCAGG + Exonic
1062004235 9:134231277-134231299 CCGCCCCCCACCCTGGCAGCTGG + Intergenic
1062362393 9:136193976-136193998 CAGCGCCCGTCCCTGGCCGCGGG + Intergenic
1062363593 9:136198749-136198771 CTGCCCCCAGCGCTGCCGGCCGG + Exonic
1062397134 9:136357042-136357064 CCGGCCCTGGCTCTGCCCTCTGG - Intronic
1062421083 9:136483103-136483125 CCGCCCCTGGCCCCGCCCCTCGG + Intronic
1062463328 9:136670928-136670950 CAGCGCCTGGCTCTGCCCGCAGG + Exonic
1062467289 9:136686931-136686953 CCACCCCCCGCCCTGGCCCCGGG - Intronic
1062478461 9:136740996-136741018 CCGCCCACAGCCCTGACCCCTGG + Intronic
1062582323 9:137234087-137234109 CCTGCCCCTGCCCTGCCCCCAGG + Exonic
1062595040 9:137295653-137295675 CCCGCCCCGGCCCGGTCCGCGGG - Intergenic
1062598071 9:137307943-137307965 CTGCCCCCGCCCCCGCCCGCCGG - Intronic
1062653437 9:137590144-137590166 CCGCCCCCGGCCCCGCGCGGAGG + Intronic
1185628948 X:1502327-1502349 CCACCCCCACCCCTGCCCCCCGG - Intronic
1186426011 X:9464948-9464970 CCGGCCCCGCCCCTGCGCCCCGG - Intronic
1187281426 X:17860911-17860933 CCCCGCCCGGCCCTCCCAGCCGG + Intronic
1187507269 X:19887760-19887782 CCGGCCCCGCCCCCGCCCGGCGG - Intergenic
1187670127 X:21658515-21658537 CCGCCCCGTGCCCTGACTGCTGG + Intergenic
1189324180 X:40103072-40103094 CAGCCCCCGGCCCTGAGTGCGGG + Intronic
1190243573 X:48676446-48676468 CCGCCTCCGTCCCTGCGCGCCGG - Intergenic
1192436552 X:71147010-71147032 CCGCCCTCTGCCCTGCCTGAGGG + Intronic
1196442482 X:115728923-115728945 CCAGCCCCGGCCCTGCCCCCCGG + Intergenic
1196443075 X:115731981-115732003 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196443735 X:115734950-115734972 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196445396 X:115843896-115843918 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196446067 X:115846877-115846899 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196446738 X:115849858-115849880 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196447406 X:115852841-115852863 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196448077 X:115855820-115855842 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196448746 X:115858811-115858833 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196449417 X:115861802-115861824 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196450086 X:115864785-115864807 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196450756 X:115867770-115867792 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196451427 X:115870749-115870771 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196452098 X:115873736-115873758 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196452768 X:115876705-115876727 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196453438 X:115879698-115879720 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196454108 X:115882707-115882729 CCAGCCCCAGCCCTGCCCCCCGG - Intergenic
1196454774 X:115885696-115885718 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196455188 X:115887778-115887800 CCAGCCCCGGCCCTGCCCCCCGG - Intergenic
1196463327 X:115950561-115950583 CCAGCCCTGGCCCTGCCCCCCGG + Intergenic
1197761028 X:130028386-130028408 CAGCTCCCAGCCCTGCCAGCAGG - Intronic
1199881107 X:151974759-151974781 CCGCCCCAGGCCCGCCCCGATGG + Intergenic
1200119915 X:153785314-153785336 ACGCCCGCTGGCCTGCCCGCAGG + Exonic
1200154900 X:153970216-153970238 CAGCCCCAGCCCCAGCCCGCTGG + Intronic
1200164503 X:154026850-154026872 CCCCTCCCGGCCCTGCCTGCTGG - Intronic
1200247105 X:154532134-154532156 CTCACCCCGCCCCTGCCCGCTGG + Intronic
1201575243 Y:15455842-15455864 CCACCATCGGCCCAGCCCGCTGG + Intergenic
1202604538 Y:26627370-26627392 CCGCCCTCGTCCCGTCCCGCAGG + Intergenic