ID: 900636366

View in Genome Browser
Species Human (GRCh38)
Location 1:3667937-3667959
Sequence CAGTGGCCATGAGCCCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 299}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900636366_900636374 20 Left 900636366 1:3667937-3667959 CCCCCCAGGGCTCATGGCCACTG 0: 1
1: 0
2: 2
3: 34
4: 299
Right 900636374 1:3667980-3668002 TTCAGACCAGGGAACAGACTTGG 0: 1
1: 0
2: 1
3: 19
4: 189
900636366_900636373 9 Left 900636366 1:3667937-3667959 CCCCCCAGGGCTCATGGCCACTG 0: 1
1: 0
2: 2
3: 34
4: 299
Right 900636373 1:3667969-3667991 GCTAGTTGCTCTTCAGACCAGGG 0: 1
1: 0
2: 0
3: 10
4: 75
900636366_900636376 26 Left 900636366 1:3667937-3667959 CCCCCCAGGGCTCATGGCCACTG 0: 1
1: 0
2: 2
3: 34
4: 299
Right 900636376 1:3667986-3668008 CCAGGGAACAGACTTGGCCATGG 0: 1
1: 0
2: 1
3: 37
4: 314
900636366_900636372 8 Left 900636366 1:3667937-3667959 CCCCCCAGGGCTCATGGCCACTG 0: 1
1: 0
2: 2
3: 34
4: 299
Right 900636372 1:3667968-3667990 TGCTAGTTGCTCTTCAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900636366 Original CRISPR CAGTGGCCATGAGCCCTGGG GGG (reversed) Intronic
900636366 1:3667937-3667959 CAGTGGCCATGAGCCCTGGGGGG - Intronic
901206122 1:7496844-7496866 CAGTGACTAGCAGCCCTGGGAGG - Intronic
901866300 1:12109292-12109314 GAGTGGCCATGAGACCAGGCTGG - Intronic
902043531 1:13509433-13509455 CAGTGGGCATGAGGCTTGGTAGG - Intronic
903944171 1:26951363-26951385 CAGTGGCCATGAGACCATGGTGG - Exonic
904009961 1:27383754-27383776 CAGCGGTCATGGGGCCTGGGTGG - Intergenic
904465506 1:30704998-30705020 CGTTGACCATGAGCCCTGTGAGG + Intergenic
904496889 1:30892142-30892164 CAGGGTCCTTGAGCCCTGGCAGG - Intronic
904592487 1:31622736-31622758 CAGTGCCCATAAGCCTGGGGTGG - Intronic
906759372 1:48360728-48360750 GAGGGGCCAAGGGCCCTGGGAGG + Intronic
907336834 1:53705210-53705232 CAATGACACTGAGCCCTGGGAGG + Intronic
907384352 1:54116459-54116481 CAGTGGAATTGAGCCCTGGCTGG - Intergenic
907462331 1:54612357-54612379 CAGAGGGCATGAGCACTGGCAGG + Intronic
912376250 1:109212248-109212270 CAGTGGTGAGGGGCCCTGGGGGG + Intergenic
915640419 1:157220055-157220077 CAGAGGCCAGGAGTCCTTGGAGG - Intergenic
917442914 1:175082723-175082745 CAGTGGTCAGTAGGCCTGGGTGG + Intronic
917632530 1:176904259-176904281 CACTGCCCTTAAGCCCTGGGAGG - Intronic
919463710 1:197908383-197908405 CACTGCCCATGAGCCCTGAGAGG + Intergenic
919806757 1:201385119-201385141 CACTGCCCATGAGCTCTGTGGGG + Intronic
920370759 1:205477857-205477879 CAGTGGCCATCTGCCGGGGGCGG - Intergenic
922459355 1:225803139-225803161 CAGTCGCCCTGAGCTCTGTGTGG - Intergenic
922472768 1:225887076-225887098 CAGTCGCCCTGAGCTCTGTGTGG + Exonic
922480581 1:225937790-225937812 CAGTCGCCCTGAGCTCTGTGTGG + Exonic
923207656 1:231774431-231774453 CAGAGGCCATCAGCACTGGCTGG + Intronic
924315088 1:242787211-242787233 CAGTGGCAATGAGGCGTGGTTGG - Intergenic
924927215 1:248694917-248694939 CAGTGGCCACTAGCCATGTGTGG + Intergenic
924945593 1:248844693-248844715 CCTTGGGCATGTGCCCTGGGAGG + Intronic
1062996412 10:1870793-1870815 AGGTGGCCCTGGGCCCTGGGGGG + Intergenic
1063803893 10:9615292-9615314 CAGTATCCCTGAGCCCTAGGGGG + Intergenic
1064081827 10:12314253-12314275 TGGTGGCCAGGAGGCCTGGGTGG - Intergenic
1066351673 10:34642148-34642170 TGGGGGCCATGAGCCTTGGGTGG - Intronic
1067037713 10:42932278-42932300 CGGAGGCCATGAGCTGTGGGAGG + Intergenic
1067980910 10:51083258-51083280 AAGTGGCCAGGAACCCTGGCTGG - Intronic
1068677651 10:59784361-59784383 AAGTGGCCTTCATCCCTGGGAGG - Intergenic
1069601712 10:69712265-69712287 GTGTGACCAAGAGCCCTGGGAGG + Intergenic
1070643065 10:78182819-78182841 GAATGGCCAGGAGGCCTGGGTGG - Intergenic
1070896025 10:79983394-79983416 CAGTCGCCATGACGACTGGGAGG - Intergenic
1071522822 10:86341507-86341529 CCGTGGCCGGGAGCCCTGTGGGG - Intronic
1072151195 10:92685853-92685875 CAGAGGCCATGATTCATGGGAGG + Intergenic
1073300588 10:102468976-102468998 CTGTGGCCATGAGCCCTCCCCGG + Exonic
1073998712 10:109345625-109345647 CAGTGGCCATATGCCCTGGAGGG + Intergenic
1075676439 10:124299127-124299149 CAGAGGCCATGTGCCCTGTGAGG - Intergenic
1076198774 10:128541032-128541054 CAGTGGCCATCAGCCCGCTGCGG + Intergenic
1076567545 10:131409220-131409242 CAGTGGCCTTGAGTCCTGTGTGG - Intergenic
1076723572 10:132403250-132403272 CAGTGGCCTTGGGGCCTGTGAGG - Intronic
1076725538 10:132411249-132411271 CAGCGGCCTTGAGCCCATGGAGG - Intronic
1076881901 10:133243709-133243731 CAGTGGACAGGAACCCTCGGGGG + Intergenic
1077055656 11:591608-591630 TTGTGGCCATGAGCCCTGTCTGG + Intronic
1077197437 11:1288464-1288486 CAGAGGGCAGGGGCCCTGGGTGG - Intronic
1077210391 11:1368449-1368471 AAGTGGCCTTGGGCCCTGGCGGG + Intergenic
1077979607 11:7286441-7286463 CACAGGCCTTGAGGCCTGGGAGG - Intronic
1079193431 11:18302128-18302150 CAGTGTCCAGGAGCCCCAGGAGG - Intronic
1080433204 11:32217242-32217264 CAGTGGCCCTCACCCCTGTGGGG - Intergenic
1081550548 11:44107811-44107833 CAGTGGCAATGAGGCCCAGGAGG - Exonic
1084488456 11:69464543-69464565 CACAGGGCATGAGCCCTGTGGGG - Intergenic
1084607214 11:70179379-70179401 CAGTGGCCATGAGAACTAGCAGG - Intronic
1084725780 11:70940867-70940889 AAGTGCCCATGACCCCTGTGTGG - Intronic
1085534793 11:77211414-77211436 CACTGGCCAGCAGCCCAGGGAGG + Intronic
1089493280 11:118896572-118896594 CCCTGGCCATGGACCCTGGGAGG + Exonic
1089845417 11:121454303-121454325 CAGGGGACCTGAGCACTGGGAGG - Intronic
1091282160 11:134387911-134387933 CAGGGGTCAGGAACCCTGGGGGG + Exonic
1091370173 11:135051012-135051034 CAGGGGCCATGTGTCCTGGCAGG - Intergenic
1091806077 12:3356939-3356961 CAAAGGCCATGACCCCGGGGGGG - Intergenic
1091835731 12:3584219-3584241 CTGTGCTCATGAGCCCTTGGTGG + Intronic
1091921641 12:4309409-4309431 CAGTGCCCAGGAGCCCTGTGTGG - Intergenic
1093084410 12:14851081-14851103 CAAAAGCCATGTGCCCTGGGGGG + Intronic
1094480842 12:30880334-30880356 CAGAGGCCATGAGGTCTGGAAGG - Intergenic
1094719854 12:33052631-33052653 CAGAGGCCAAGACCCCGGGGTGG + Intergenic
1097316788 12:58180262-58180284 CAGGGTCCTTGAGGCCTGGGAGG + Intergenic
1098115346 12:67170336-67170358 CATTTGCAATGAGCCCTGTGTGG - Intergenic
1098387451 12:69934302-69934324 GACTGGCCATGAGCCCTGCATGG - Intronic
1101744927 12:107532237-107532259 CAGTGGCAGTGGGCCCTGGTTGG - Intronic
1102568859 12:113815256-113815278 CAGTGGCCAGGAGAGCAGGGAGG - Intergenic
1103559094 12:121783043-121783065 CATTAGCCATGAGCCCCGGGCGG - Intronic
1103927341 12:124430236-124430258 CAGTGGCTGTGAGGACTGGGTGG - Intronic
1104904538 12:132206164-132206186 CAGGCGTCAGGAGCCCTGGGGGG - Intronic
1105268829 13:18850468-18850490 CAGTGATCATGAGCCCTTGATGG - Intergenic
1105460281 13:20579237-20579259 CAGTTCCCCTGGGCCCTGGGTGG + Intronic
1105891037 13:24682437-24682459 CAGAGGCCCTGACCTCTGGGTGG - Intronic
1106080355 13:26495659-26495681 TAGTAGCCATGGGCCCTGGTAGG + Intergenic
1106100752 13:26693964-26693986 ATGTGGCCAGGTGCCCTGGGAGG - Intergenic
1106106337 13:26736679-26736701 CAGTGGCCATCAGACCTGCTTGG + Intergenic
1106355951 13:28983344-28983366 CAGTGGCCAGAAGCCATGTGTGG + Intronic
1107805927 13:44153896-44153918 CACAGGCCCTGAGGCCTGGGAGG - Intronic
1113673717 13:112194275-112194297 CAGTGGCCAAGTCCCCCGGGGGG + Intergenic
1113843470 13:113373164-113373186 CACTGGACATGAACCCTAGGAGG - Intergenic
1114672359 14:24418053-24418075 CACTGCCCTTGAGGCCTGGGAGG - Exonic
1114930963 14:27466613-27466635 CAGTCCCCATGACACCTGGGAGG + Intergenic
1116426274 14:44795794-44795816 CAGTGGCCATTAGGTTTGGGAGG + Intergenic
1117244549 14:53871057-53871079 GATTGGGCATGAGCTCTGGGTGG + Intergenic
1117563589 14:56970309-56970331 CAGGGGCCATGAATTCTGGGAGG + Intergenic
1119199037 14:72739586-72739608 CCATGGGCATGAGCCCAGGGAGG + Intronic
1119679859 14:76584343-76584365 CAGTGGCCAGGGCCCCAGGGAGG - Intergenic
1119718361 14:76874511-76874533 CAGGGGCCAGCAGCACTGGGGGG + Intergenic
1121042523 14:90760658-90760680 CACTAGCCCAGAGCCCTGGGGGG + Intronic
1121091941 14:91188980-91189002 CAGTGGTGATGAGCACTGAGCGG - Exonic
1121403209 14:93701066-93701088 AGGTAGCCAGGAGCCCTGGGAGG - Intronic
1122093103 14:99352916-99352938 CAGTGGGGAGGAGGCCTGGGAGG + Intergenic
1122835589 14:104429330-104429352 CAGTGGTGAGGTGCCCTGGGCGG + Intergenic
1123020895 14:105397485-105397507 CAGTGGCCACCAGGCCTGAGGGG - Exonic
1123048084 14:105528081-105528103 CAGTGGCCACGCGCCCAGGATGG + Intronic
1123062766 14:105601765-105601787 CAGCGCCCATCAGGCCTGGGGGG + Intergenic
1123107653 14:105850179-105850201 CAGTGGCTGTGAGACCAGGGTGG - Intergenic
1202830476 14_GL000009v2_random:23493-23515 CAGTGATCATGAGCCCTTGATGG + Intergenic
1124441588 15:29689567-29689589 CTGGGGCCATGAGCCCTGAAGGG - Intergenic
1125361582 15:38870445-38870467 CAGTGGACATGCACCCTGAGTGG - Intergenic
1125754533 15:42054084-42054106 CAGTGGCCAGGTGCCCTTGAGGG - Intergenic
1128730155 15:70015445-70015467 CACATGCCATGAGGCCTGGGTGG + Intergenic
1131261795 15:90891492-90891514 GAGGGGGCGTGAGCCCTGGGAGG - Intronic
1132822195 16:1879831-1879853 CTGTGGCCATGAGCCCTCTGGGG - Intronic
1133059396 16:3164639-3164661 CAGGGACCATTAGCCATGGGTGG - Intergenic
1134014415 16:10878574-10878596 CAGGGGCCATGTGCCCTCGGAGG + Intronic
1134386772 16:13780861-13780883 CAGTCCCCATGTGTCCTGGGGGG + Intergenic
1137915422 16:52424673-52424695 CAGTGGCCATGGGGCCTCCGGGG - Intergenic
1138118765 16:54381341-54381363 CAGTGGGCATGGGCACTGAGAGG + Intergenic
1138417799 16:56881159-56881181 GGGTGCCCATGAGCCCAGGGAGG - Intronic
1138857481 16:60712028-60712050 CAGTGTGGATGAGCCCAGGGTGG + Intergenic
1140199909 16:72886779-72886801 CAGAGGCCACAATCCCTGGGTGG + Intronic
1141476766 16:84279313-84279335 CAGTGGCCATGCACCCTCCGTGG + Intergenic
1141670317 16:85488176-85488198 CAGGGCCCATGTCCCCTGGGAGG - Intergenic
1142113265 16:88343207-88343229 CCGTGGCCCTGAGCTCTGGACGG - Intergenic
1142182672 16:88678858-88678880 CAGTGGCCAAGGGCCCCGGGAGG - Intronic
1142231946 16:88904077-88904099 TGGTGGCCATGAGCCCTTGTTGG - Intronic
1142434084 16:90046341-90046363 CAGGGGCCATGAGGCCTGGGTGG + Intergenic
1143627875 17:8121560-8121582 CCTTGGCCCTGAGCCTTGGGGGG - Exonic
1145766529 17:27461678-27461700 CAGTGGCTGTGAGCCTGGGGAGG + Intronic
1147400446 17:40177673-40177695 CAGTGGCCAGTAGCCGGGGGAGG - Intronic
1148220485 17:45858390-45858412 CAGTTCCCATGAGCCCTGACTGG - Intergenic
1148845684 17:50528572-50528594 CAATAGCCTTGAGCCCTGGTAGG - Intronic
1149758975 17:59211731-59211753 CAATGGCCATCAGCTCTGTGAGG + Exonic
1151275427 17:73030505-73030527 CAGTGGTCATGTACCCCGGGAGG - Intronic
1151356179 17:73559953-73559975 CAGTGGCAGTCACCCCTGGGAGG + Intronic
1151929943 17:77225974-77225996 CAGTGGACATGAGGGCTGGAGGG - Intergenic
1151937826 17:77274132-77274154 CAGAGGCCATGAGTACCGGGAGG + Intergenic
1152143946 17:78556293-78556315 CAATGGCCATGAGCCCAGGAAGG + Intronic
1152608066 17:81302940-81302962 GTGTGGCCATGAGACATGGGCGG - Intergenic
1152611377 17:81316456-81316478 CCCTGGCCCTGAGCCCTGGAGGG + Intronic
1152738455 17:82008746-82008768 CAGGGGCCATGTGCCCTGCTGGG + Intronic
1154336692 18:13471608-13471630 CAGTGGCCTGGAGCACTGGAGGG + Intronic
1154419195 18:14209529-14209551 CAGTGATCATGAGCCCTTGATGG + Intergenic
1156382115 18:36572713-36572735 CAGAGGCCCTGAGCTCTTGGGGG + Intronic
1158130780 18:54150330-54150352 CAGGGGCCCCAAGCCCTGGGCGG + Intergenic
1158474431 18:57767377-57767399 CAGTGGCCACGAGCCATGTGTGG + Intronic
1159958809 18:74539668-74539690 CGGTGGCCATGAGCTCAGGTTGG + Intronic
1160415199 18:78705194-78705216 CAGTGGCCATCAGGCGTGGGCGG + Intergenic
1161007013 19:1941875-1941897 CGGTGGGCTTGAGCACTGGGTGG - Intronic
1161010456 19:1957254-1957276 CAGTGGCCCTGTGCCCAGGAGGG + Intronic
1161635933 19:5388829-5388851 CAGAGGCCATGAGACCAGGGAGG + Intergenic
1161680553 19:5677805-5677827 CATCAGGCATGAGCCCTGGGAGG - Intronic
1162575982 19:11499100-11499122 CAATTGCCATCAGCCCTGGGAGG + Intronic
1163660555 19:18574653-18574675 CACTGACCACGAGCCCTGGGGGG - Intronic
1166670411 19:44706524-44706546 AAGTGGCCATCAGCCCCCGGGGG + Intronic
1166703573 19:44896036-44896058 CACTGGCCATGTGCCCTTAGTGG - Intronic
1167019672 19:46863746-46863768 CTGTGGCCATAACCCCTGGTGGG - Intergenic
1167264593 19:48477444-48477466 CAAGGGCCATGAGCCCCGGGTGG - Intronic
1167503455 19:49859801-49859823 CGGTGGCCAAGAGCAATGGGTGG - Intronic
1202642217 1_KI270706v1_random:104286-104308 CAGTGATCATGAGCCCTTGATGG - Intergenic
925390406 2:3490360-3490382 CAGAGGCCGGGAGCCCTGGGGGG - Intergenic
926144131 2:10386521-10386543 AAGTGGCCCAGGGCCCTGGGAGG + Intronic
926838861 2:17056357-17056379 CAATGGGCCTGAGCACTGGGAGG + Intergenic
927038452 2:19204421-19204443 CAGTGGCCCTGAGCACAGTGTGG - Intergenic
927276514 2:21266882-21266904 CAGTGGCTATGAGCCTAGGCTGG + Intergenic
927640199 2:24841158-24841180 CGCTGGCCATGGCCCCTGGGTGG - Intronic
927641739 2:24849809-24849831 CAGAGGCCCTGAGGCTTGGGGGG - Intronic
928021761 2:27710912-27710934 CAGTGGGAAGGAGCTCTGGGTGG + Intronic
928063191 2:28135844-28135866 CAGTTGCCATGGGTCCTGAGGGG + Intronic
930404816 2:50941953-50941975 CAGAGGCCTTGAGGCCTGGGAGG + Intronic
932192249 2:69750864-69750886 CAATGGCCATGGGCACTGAGGGG + Intronic
932417023 2:71579701-71579723 CAGTAGCCACTAGCCGTGGGTGG + Intronic
932445648 2:71779415-71779437 GAGAGGCCCTGAACCCTGGGTGG + Intergenic
932588202 2:73045336-73045358 CAGAGGCCATCAGTTCTGGGGGG - Intronic
932598249 2:73107536-73107558 CCCTGGCCCTGAGCCCTGGCTGG - Intronic
935796981 2:106652384-106652406 CAGTGAAAATGACCCCTGGGAGG - Intergenic
937434557 2:121869752-121869774 CAGTGAGCATGAGCCCTTGAGGG + Intergenic
938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG + Exonic
942089064 2:172471166-172471188 CAGGGGCCATAGGCCCTGCGAGG - Intronic
947500529 2:230667907-230667929 CTGTGGCCATGAGCTCAGGCTGG + Intergenic
948664804 2:239528247-239528269 CAGGGGCCAGGACCCCTGGGAGG - Intergenic
948715299 2:239857169-239857191 CAGTGGACATCACCTCTGGGGGG + Intergenic
948888997 2:240897736-240897758 CAGGGGCTCTGAGCCATGGGAGG + Intergenic
1171889324 20:30694464-30694486 CAGTGATCATGAGCCCTTGACGG - Intergenic
1173597981 20:44272099-44272121 CAGAGGGCATGAGCCCCGGGGGG + Intronic
1174295531 20:49542584-49542606 CAGGAGCCAGGAGACCTGGGAGG + Intronic
1175179408 20:57134899-57134921 CACTGGCCTTGAACCCTGGATGG + Intergenic
1175966844 20:62664205-62664227 CATGGGCCTGGAGCCCTGGGGGG - Intronic
1176122198 20:63458921-63458943 ATGTGGCCAGGTGCCCTGGGTGG - Intronic
1176609662 21:8868331-8868353 CAGTGATCATGAGCCCTTGATGG + Intergenic
1178180123 21:30150444-30150466 CAATGGCTATGGGCCCAGGGAGG + Intergenic
1179575288 21:42304782-42304804 GAGTGGCCAGGAGCCCTGCCTGG - Intergenic
1179654009 21:42834043-42834065 CAGTGGCCATGACACCTCTGAGG - Intergenic
1179894771 21:44355255-44355277 CAGTGGCCATGTTGCCTGGGCGG - Intronic
1179936644 21:44610292-44610314 CAGAGGCCTGGAGGCCTGGGAGG + Intronic
1180079998 21:45482312-45482334 CAGTGGCCATGAGCCTCTGTCGG + Intronic
1180144607 21:45912325-45912347 CAGGGGCCATCATCCCAGGGAGG + Intronic
1180912118 22:19458027-19458049 CAGTGAGCCTGGGCCCTGGGAGG - Intronic
1181035894 22:20169592-20169614 TAGTGGCCCACAGCCCTGGGGGG + Intergenic
1181120414 22:20664230-20664252 CAGTGGCCCTGATCCCAGGCAGG - Intergenic
1181671469 22:24427420-24427442 CAGAGCCCAGGAGTCCTGGGCGG - Intronic
1182670727 22:31993526-31993548 CAGTAGCCATGAGCCCTATGTGG + Intergenic
1183120274 22:35725030-35725052 CTCTGGCCTGGAGCCCTGGGTGG - Intronic
1183261431 22:36798251-36798273 CAGGGGCCCTGAGCCCTTGCAGG + Intergenic
1183332471 22:37228897-37228919 CACTGCCCATGATCCCTGGTGGG - Intronic
1183676316 22:39300721-39300743 GTGTGGCCATGAGGCCTGGGAGG + Intergenic
1184107530 22:42376876-42376898 CAGGGGCCATGAGCCCTGTTAGG - Intergenic
1184178165 22:42801600-42801622 CACTGGCCATGGGACATGGGAGG + Intronic
1184407986 22:44311082-44311104 CTTGGGCCATCAGCCCTGGGTGG + Intronic
1184483964 22:44765267-44765289 CTGTGTCCCTGTGCCCTGGGAGG + Intronic
1184704186 22:46199037-46199059 CAGTGCCCCTGGGCCCTGGAAGG + Intronic
1184900930 22:47446006-47446028 CAGTGGCCATGGGGCCTGTGTGG - Intergenic
1185030404 22:48439981-48440003 CGGTGGCCATCAGCACTGAGGGG - Intergenic
1185294276 22:50045687-50045709 CAGAGGCCAGGGGCCCCGGGAGG - Intronic
952964228 3:38611105-38611127 GAGTGCCTCTGAGCCCTGGGTGG - Intronic
953075489 3:39566108-39566130 CAGTGACCATGAGCCATATGTGG + Intergenic
954306091 3:49726229-49726251 CACAGCCCTTGAGCCCTGGGAGG + Exonic
954423546 3:50431398-50431420 CACTGCCCAGGAGCGCTGGGAGG + Intronic
954502840 3:51036761-51036783 CAGTTGCCATGTGTCATGGGAGG + Intronic
954670747 3:52290216-52290238 CACTGGCCCTGAGCCCTCAGAGG + Intronic
954766878 3:52926001-52926023 TAGTGGCCATGAGGCCGTGGGGG + Intronic
954795244 3:53158080-53158102 CAAAGGCCATCAACCCTGGGAGG - Intronic
958986719 3:100788507-100788529 CACTGGCCATGTGCCCTGTGAGG - Intronic
959258681 3:104048097-104048119 CACTCACCATGACCCCTGGGTGG - Intergenic
960365381 3:116764914-116764936 CAGTTGCCATGCATCCTGGGTGG - Intronic
960583846 3:119302980-119303002 CAGTGGGCAAGGGACCTGGGAGG - Intronic
961360256 3:126362558-126362580 CAGTGTCCATGTGCCCTGCTGGG + Intergenic
963042790 3:141081629-141081651 CAGGGGCCAGGAGCTCTGCGGGG + Intronic
966060602 3:175749620-175749642 CAGAGGCCATTAGGCCTTGGGGG - Intronic
966228849 3:177628415-177628437 CAATTCCCATGTGCCCTGGGAGG - Intergenic
967971334 3:195001802-195001824 CATTGGCCAAGTGCTCTGGGAGG - Intergenic
967986515 3:195099329-195099351 CTGTGGTCATGATGCCTGGGTGG - Intronic
1202736344 3_GL000221v1_random:3100-3122 CAGTGATCATGAGCCCTTGATGG + Intergenic
968595281 4:1479132-1479154 CTGTGGACAAGAGCCCTGGAAGG - Intergenic
968905077 4:3447221-3447243 CACTGGTCACAAGCCCTGGGGGG - Intronic
969439310 4:7208038-7208060 CAGTGTCCCTTGGCCCTGGGTGG + Intronic
969952613 4:10853812-10853834 CAGTGGCCAGAAACCCTGGCTGG + Intergenic
971099490 4:23447598-23447620 CAGTGGTGATGAGCACTTGGGGG + Intergenic
972045493 4:34660650-34660672 CAGTGCCTACCAGCCCTGGGTGG + Intergenic
973131582 4:46654249-46654271 CATTGGCCCTGAGGCCTAGGAGG - Intergenic
974374619 4:61060758-61060780 CAGTTTCCATGGGCTCTGGGAGG - Intergenic
974374849 4:61062614-61062636 CAGTTTCCATGGGCTCTGGGAGG - Intergenic
976956233 4:90903584-90903606 CAGTAGCCATGTGCCTTGAGTGG - Intronic
980406424 4:132358261-132358283 CTGAGGCAATGAGCCTTGGGCGG + Intergenic
981248774 4:142573267-142573289 CACTGGACATGAGACTTGGGTGG + Intronic
982474845 4:155837497-155837519 CAGTGAGAATGAGCACTGGGAGG - Intronic
984758479 4:183344657-183344679 AAGGGGCGATGGGCCCTGGGCGG - Intergenic
985304273 4:188521817-188521839 CACTGGCCAGGAGGCCTAGGAGG + Intergenic
1202769589 4_GL000008v2_random:190166-190188 CAGTGATCATGAGCCCTTGATGG - Intergenic
985525798 5:401103-401125 CGGGGGCCATGTGGCCTGGGGGG - Intronic
985718302 5:1475379-1475401 CAGGGACCAGGAGCCCTGGCTGG + Intronic
986483462 5:8212357-8212379 CAGTGAGCATGGACCCTGGGTGG - Intergenic
990502216 5:56407906-56407928 CAGTGGCCAGGGGACCAGGGTGG + Intergenic
993431795 5:87841382-87841404 CAGTGGCTGTGACCCCTGGAAGG + Intergenic
994870647 5:105345805-105345827 CAATTCCCATGTGCCCTGGGAGG - Intergenic
995610983 5:113910046-113910068 CTGTGTCCCTGAGCCCTGGGAGG + Intergenic
996642315 5:125770798-125770820 CAGTGGCAATGAGAACTGGTGGG + Intergenic
997372211 5:133369348-133369370 CAGGAGCAATGAGCCCAGGGAGG - Intronic
999319576 5:150605218-150605240 CAGAGGCCCTGAGCCCCAGGTGG + Intronic
1001110951 5:168895891-168895913 CAAGGGACATGAGCACTGGGAGG + Intronic
1001141092 5:169144671-169144693 CAGTGGCCCAGGGCCTTGGGTGG - Intronic
1001679977 5:173549335-173549357 CTGTGGCCATGAACAGTGGGTGG + Intergenic
1002783916 6:386897-386919 CAATGGCCAGGAGGCCGGGGAGG - Intergenic
1003435369 6:6083147-6083169 GAGTGCCCATGGGCCCTGTGTGG + Intergenic
1004199229 6:13532541-13532563 AAGTGGGAATCAGCCCTGGGAGG - Intergenic
1005682274 6:28218753-28218775 GAGTGGCCCTGAGCGCGGGGCGG + Intergenic
1006119347 6:31794961-31794983 CTGTGGCCAGCAGGCCTGGGGGG - Exonic
1006132513 6:31877908-31877930 CATTGTCCATGAGCCATGGAGGG - Intronic
1006738371 6:36291257-36291279 CAGTGGCCAGGGGCCAAGGGAGG - Intronic
1007786198 6:44280849-44280871 CATTGGCCATGAGACTGGGGTGG + Intronic
1007969179 6:46033483-46033505 CAGTGGGCATGAGCCCACGGAGG - Intronic
1008064145 6:47029727-47029749 CAGTAGCCATTAGCCATGTGTGG + Intronic
1010114179 6:72282158-72282180 CAGTTGCCTTGAGCACTGTGGGG + Intronic
1011240409 6:85266262-85266284 CAGTGGCCATAAGTCATGGGTGG + Intergenic
1014893964 6:126877363-126877385 CAGTGGCCTTGGGCCATTGGTGG + Intergenic
1016049719 6:139518282-139518304 AAGTGCACATGTGCCCTGGGGGG - Intergenic
1016831306 6:148436157-148436179 AGGTGGCCGTGAACCCTGGGAGG + Intronic
1016957825 6:149643520-149643542 CAGTGGTCATGAATCCAGGGAGG - Intronic
1017490734 6:154942715-154942737 AAGTGGCCATGTGCACTCGGGGG + Intronic
1017649340 6:156566584-156566606 CATTGGATGTGAGCCCTGGGAGG - Intergenic
1017882750 6:158573092-158573114 CTGTGGCAGTGACCCCTGGGGGG + Intronic
1018738735 6:166711068-166711090 CAGTGGACACCACCCCTGGGGGG - Intronic
1018764872 6:166925369-166925391 CAGTGTAGATGAGGCCTGGGTGG - Intronic
1019335387 7:480307-480329 CCGAGGGCAAGAGCCCTGGGGGG + Intergenic
1019380225 7:717830-717852 CACAAGCCATGAGCACTGGGAGG - Intronic
1019513271 7:1429035-1429057 AGGTGGACATGAGCTCTGGGTGG - Intronic
1019788660 7:2996201-2996223 CAGTGGCCCTGAGCCCTAAGGGG - Intronic
1020257390 7:6509687-6509709 CAGAAGGCAGGAGCCCTGGGAGG - Intronic
1021554436 7:21904920-21904942 GAGGGGCAATGAGCCTTGGGTGG + Intronic
1022957227 7:35392169-35392191 AAGAGCCCGTGAGCCCTGGGTGG - Intergenic
1023713524 7:43019947-43019969 CAGGGGCCATGAGTCATAGGTGG + Intergenic
1023878623 7:44306431-44306453 CAATGGCCATGACCCCAGTGGGG + Intronic
1024627163 7:51217874-51217896 CACTGTGCATGAACCCTGGGGGG + Intronic
1025721533 7:64020291-64020313 CACAGGCCAGGAGCCCTAGGAGG + Intergenic
1025997562 7:66537642-66537664 CAGTGGCCACGATTCCTGGCGGG + Intergenic
1027219842 7:76206824-76206846 CAGTGGGCAGGAGGCCAGGGCGG - Intronic
1027592505 7:80134619-80134641 CTGTGGCCTTCTGCCCTGGGCGG - Intronic
1029598116 7:101548453-101548475 CAGTGGCCATGGGCGGTGGCTGG + Intronic
1031820366 7:126493368-126493390 CAGTGACCATGAGGCTTAGGCGG + Intronic
1032432026 7:131870238-131870260 GAGTGGGCATGCTCCCTGGGAGG + Intergenic
1034750728 7:153566644-153566666 AAGTGGCCATGATGCCTGTGGGG + Intergenic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1035765274 8:2100328-2100350 CTGTGGCCTTGAGCCTTGAGAGG - Intronic
1035812350 8:2503355-2503377 CGGGGGCCATGGGCACTGGGAGG + Intergenic
1037285892 8:17299963-17299985 CAGTGACCAAGAGTCCGGGGTGG - Exonic
1038688390 8:29739290-29739312 GAATGGCCATGCACCCTGGGAGG - Intergenic
1038963435 8:32547837-32547859 CCGTGGTCAGGAACCCTGGGAGG - Intronic
1038974347 8:32676306-32676328 AGGTGGCCATGACCCCAGGGGGG + Intronic
1040382432 8:46885789-46885811 CAGTGGGCAGGATCCCAGGGAGG + Intergenic
1040886298 8:52267160-52267182 CAGTGGGGATGAACCCTGAGGGG + Intronic
1043807658 8:84692915-84692937 AAGAGGCCATGAGCCAAGGGTGG + Intronic
1044373750 8:91445438-91445460 CCATGGCCATGAGCCTTAGGAGG - Intergenic
1045498822 8:102729693-102729715 CAGAGCCCATAAGCCCTGGGAGG - Intergenic
1049847375 8:144809577-144809599 GACTGGCCGAGAGCCCTGGGAGG - Intronic
1050162565 9:2733627-2733649 CAGTAGCCATCAGCCATGTGTGG + Intronic
1052425190 9:28295247-28295269 CAGTGGCCAAGAGCTTTGTGTGG - Exonic
1054360132 9:64105494-64105516 CAGTGATCATGAGCCCTTGATGG + Intergenic
1055474044 9:76643711-76643733 CAGTGGTCAGGTTCCCTGGGTGG + Intronic
1056800228 9:89685891-89685913 CAGGGTCCGTGAGCACTGGGAGG + Intergenic
1057199438 9:93132514-93132536 CATTGGCTCTGAGCCCTGGAGGG - Intronic
1057503763 9:95616187-95616209 CAGGCACCATGGGCCCTGGGAGG + Intergenic
1060888852 9:127175618-127175640 CAGTGGCCTAGAACCCAGGGTGG - Intronic
1061623202 9:131824931-131824953 CAGCGGCCATCAGGCCTGGGTGG - Intergenic
1061679536 9:132236149-132236171 CGGGGGCCATGAGACCTCGGAGG + Intronic
1062033214 9:134371397-134371419 CCGTGGCTATGAGCCCAGGTGGG + Intronic
1062402445 9:136378493-136378515 GAGTGGCCAGCAGCCCTGCGGGG + Exonic
1062519465 9:136951733-136951755 CTGTGGCCATGAGGCCGGGGTGG - Intronic
1203694482 Un_GL000214v1:83893-83915 CAGTGATCATGAGCCCTTGATGG - Intergenic
1203705073 Un_KI270742v1:33539-33561 CAGTGATCATGAGCCCTTGATGG + Intergenic
1203558936 Un_KI270744v1:32272-32294 CAGTGATCATGAGCCCTTGATGG - Intergenic
1203641791 Un_KI270751v1:20170-20192 CAGTGATCATGAGCCCTTGATGG + Intergenic
1195322249 X:103729308-103729330 TAGTGGCCCTCAGCCCTGGATGG + Intergenic
1195751398 X:108164402-108164424 CAGTGGTCTTCAGTCCTGGGAGG + Intronic
1196168953 X:112565929-112565951 CAGAGGCCCTGAGGCCTAGGAGG - Intergenic
1199523713 X:148767987-148768009 CTATGGCCATCCGCCCTGGGAGG + Intronic
1199783522 X:151083856-151083878 GAGTGGCCATGAAACCTGTGGGG - Intergenic
1200397338 X:155998987-155999009 CAGTGGCCATGGGCCAGGGCTGG - Intronic
1202369494 Y:24187343-24187365 CAGTGGTGATGTGGCCTGGGAGG - Intergenic
1202501291 Y:25482774-25482796 CAGTGGTGATGTGGCCTGGGAGG + Intergenic