ID: 900638581

View in Genome Browser
Species Human (GRCh38)
Location 1:3677328-3677350
Sequence CCCACTGCTGTGGGCACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 401}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900638575_900638581 4 Left 900638575 1:3677301-3677323 CCCTCGGTGGCTGGTCTTTGTCC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 900638581 1:3677328-3677350 CCCACTGCTGTGGGCACTGTAGG 0: 1
1: 0
2: 2
3: 48
4: 401
900638576_900638581 3 Left 900638576 1:3677302-3677324 CCTCGGTGGCTGGTCTTTGTCCT 0: 1
1: 0
2: 0
3: 11
4: 175
Right 900638581 1:3677328-3677350 CCCACTGCTGTGGGCACTGTAGG 0: 1
1: 0
2: 2
3: 48
4: 401
900638574_900638581 12 Left 900638574 1:3677293-3677315 CCGGAGGGCCCTCGGTGGCTGGT 0: 1
1: 0
2: 1
3: 9
4: 121
Right 900638581 1:3677328-3677350 CCCACTGCTGTGGGCACTGTAGG 0: 1
1: 0
2: 2
3: 48
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900638581 Original CRISPR CCCACTGCTGTGGGCACTGT AGG Intronic
900415351 1:2532143-2532165 CCCACAGCTCTGGGCATTGATGG + Intergenic
900638581 1:3677328-3677350 CCCACTGCTGTGGGCACTGTAGG + Intronic
900822795 1:4902109-4902131 CCCTCTGCTGTGTGCAGTTTAGG - Intergenic
900946470 1:5833962-5833984 CCCTCTGCTGTGGTCAGTGGCGG - Intergenic
901778023 1:11574019-11574041 CCGACTGCTGTGGGGTCAGTTGG - Intergenic
902472511 1:16658485-16658507 CCCAGGGCTGGGGGCGCTGTGGG - Intergenic
902486294 1:16748961-16748983 CCCAGGGCTGGGGGCGCTGTGGG + Intronic
903554859 1:24186162-24186184 AACGCTGCTGTGGGCACTGGGGG + Intronic
904114236 1:28149884-28149906 ACCACCTCTGTGGGCACTGGTGG - Exonic
904993350 1:34611960-34611982 CCCACTGATGTGGACCCTCTAGG + Intergenic
906522719 1:46476938-46476960 GCCCCTGCTGGGGGCACTGAGGG - Intergenic
906655106 1:47542546-47542568 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
907420265 1:54342429-54342451 CCCACTGCTCTGGTCACTGCTGG - Intronic
907480854 1:54744760-54744782 CCCACTGCTGTGGAGGTTGTTGG + Intergenic
907508790 1:54943197-54943219 CCCACTGCTGTGTGCAGTCTAGG + Intergenic
907558471 1:55366555-55366577 CTGACTGCTGTGTGCACTGCTGG + Intergenic
908068642 1:60434391-60434413 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
908442665 1:64170435-64170457 CCCTCTGCTGTGTGCAGTCTAGG - Intronic
909096073 1:71290763-71290785 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
909808842 1:79905923-79905945 CCCCCTGCTGTGGGCAGCCTAGG - Intergenic
910512931 1:88026010-88026032 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
910616798 1:89207038-89207060 CCCAATGCTATGCCCACTGTTGG + Intergenic
910642744 1:89481084-89481106 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
910715511 1:90225443-90225465 CCCACTGCTGTGTGCAGCTTAGG + Intergenic
911407825 1:97464518-97464540 CCCTCTGCTGTGTGCAGTCTAGG + Intronic
911661893 1:100510710-100510732 CTCTCTCCTGTGAGCACTGTTGG + Intronic
912803642 1:112738280-112738302 CCCATAGCTTTGGGCTCTGTGGG + Intergenic
912890403 1:113523950-113523972 CCCTCTGCTGTGTGCAGTCTAGG + Intronic
913565546 1:120069367-120069389 CGCTCTGCTGTGGGCGCTGCTGG - Exonic
913632586 1:120724195-120724217 CGCTCTGCTGTGGGCGCTGCTGG + Intergenic
914286143 1:146228742-146228764 CGCTCTGCTGTGGGCGCTGCTGG - Exonic
914547174 1:148679495-148679517 CGCTCTGCTGTGGGCGCTGCTGG - Intronic
914619333 1:149390867-149390889 CGCTCTGCTGTGGGCGCTGCTGG + Intergenic
914808103 1:151006505-151006527 CCCAGTACTGGGGGCACTGGAGG + Intronic
915366100 1:155317196-155317218 CACAGTGCTGGGGGCAATGTGGG + Intronic
915828601 1:159104297-159104319 GCTGCTGCTGTGGGCAGTGTGGG - Intronic
916682177 1:167114698-167114720 CTCACTGTTCTGGGCACTCTAGG + Intronic
918591945 1:186249871-186249893 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
919040332 1:192379126-192379148 GCCACTGCTGTGAGTTCTGTAGG - Intergenic
919156829 1:193776189-193776211 CCCTCTGCTGTGTGCAATCTGGG - Intergenic
920235620 1:204501867-204501889 CTCACTGCTGTGGAAACAGTGGG + Intergenic
921996613 1:221426161-221426183 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
922555221 1:226527567-226527589 ACCACTCCTGGGGGCACTGCGGG + Intergenic
923089730 1:230730779-230730801 TCAACAGCTGTGGGCACTGTTGG - Intergenic
923147734 1:231209788-231209810 GCCACAGCTGTGGGCACCCTTGG - Intronic
924743130 1:246809367-246809389 CTTACTCCTGTGGGCACTTTGGG + Intergenic
1062829311 10:594833-594855 CCTGCTGCTGTGGACACTGCAGG + Intronic
1063199731 10:3776288-3776310 CCCCCGGCTGTGGGCACAGTAGG - Exonic
1063972750 10:11392937-11392959 CCAAGTGCTGTGGGCAGTGCAGG + Intergenic
1067051753 10:43025447-43025469 CCCACAGCTATGGTCACTGTAGG - Intergenic
1069559150 10:69417363-69417385 CCCACAGCTCTGGGCGCTCTAGG + Intergenic
1071292548 10:84197970-84197992 CCCTCTCCTGTGGGCACTTTGGG - Intronic
1071568609 10:86684416-86684438 CCCCCTGCAGAGGGCAGTGTTGG - Intronic
1072614436 10:97040070-97040092 CGCACTCCTGTGGGCACTGTGGG + Exonic
1073326919 10:102648515-102648537 CCCACTGCTTGGGCCAGTGTGGG + Intronic
1073817593 10:107224509-107224531 CCCTCTGCTGTGTGCACTCTAGG - Intergenic
1075281267 10:121140628-121140650 CCCACTGCCGTGGACAGTGATGG - Intergenic
1075488997 10:122850076-122850098 CCCTCTGTCCTGGGCACTGTAGG - Intronic
1075550321 10:123388115-123388137 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
1075826180 10:125358630-125358652 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
1076140897 10:128077834-128077856 CCCACAGCTGCGGGTACTGGGGG - Intronic
1076197487 10:128529805-128529827 CCCAGTGCAGTGGCCACTCTGGG + Intergenic
1076689719 10:132216671-132216693 CCCTCTGCTGTGTGCAGTCTAGG + Intronic
1076783422 10:132736933-132736955 CCCTCAGCCGTGGGCACAGTGGG + Intronic
1077142390 11:1030329-1030351 CCCACGGCTGTGGGCACACGCGG + Exonic
1077390540 11:2298911-2298933 CCAACTCCAGTGGGCACTGAGGG - Intronic
1077751752 11:4978507-4978529 CCCACTGTGCTGGGCACTGTTGG - Intronic
1078301486 11:10135230-10135252 CCCACTGCTGTGTGCAGTCTAGG - Intronic
1078308959 11:10219370-10219392 CCCCCTGCTGTGTGCAGTCTAGG - Intronic
1078759232 11:14238425-14238447 CCTTCTGCTGTGGGCACAGCTGG + Intronic
1080214310 11:29823589-29823611 CCCACTACTTTAGGCTCTGTGGG - Intergenic
1080449779 11:32369129-32369151 CACACTGCTGTGTGCAGTCTAGG - Intergenic
1081224338 11:40501653-40501675 CCCTCTGCTGTGTGCAGTCTAGG - Intronic
1081238878 11:40679528-40679550 CCCTCTGCTGTGTGCAGTCTAGG + Intronic
1081249707 11:40814399-40814421 CCCCCTACTGTGTGCAGTGTAGG - Intronic
1081767421 11:45621337-45621359 CTGGGTGCTGTGGGCACTGTGGG - Intergenic
1083258610 11:61511069-61511091 CCCACTGCTGTGGGGACCCTGGG + Intergenic
1083899229 11:65635726-65635748 CCCCCAGCTACGGGCACTGTGGG + Exonic
1088419322 11:109625103-109625125 AGCACTGCAGTAGGCACTGTGGG + Intergenic
1089118098 11:116112487-116112509 CCCACTGCTGTGGGTGATGAGGG + Intergenic
1091234702 11:134013324-134013346 CCCATTGTTGTGAGGACTGTGGG - Intergenic
1091783857 12:3230670-3230692 CACACTGCTCTGGGAACTGAGGG + Intronic
1092593639 12:9975837-9975859 CCCTCTGCTGTGTGCAGTCTAGG + Intronic
1092662698 12:10755706-10755728 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
1093241065 12:16675278-16675300 CCCACTGATGTGACTACTGTAGG + Intergenic
1093915431 12:24797102-24797124 CCCGCTGCTGAGGTCACTGCAGG - Intergenic
1094027137 12:25970633-25970655 CTCAATCCTGTGGGCACTGAGGG - Intronic
1094762552 12:33551238-33551260 CCCTCAGCTGTGTGCACTCTAGG + Intergenic
1096110867 12:49028308-49028330 CAAACTGCTGTGGGCACTGACGG + Intronic
1096904893 12:54926497-54926519 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
1097820782 12:64127625-64127647 CCCACTGCTGGCCTCACTGTCGG - Exonic
1098630892 12:72720575-72720597 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
1099735877 12:86565747-86565769 TCCTCTGCTGAGGTCACTGTTGG - Intronic
1100658000 12:96667598-96667620 CCCACTGCTGTGTGCAGCCTAGG - Intronic
1100921142 12:99488680-99488702 CCCACTGCTCTGCCCACTGCTGG + Intronic
1101070544 12:101070723-101070745 CCCATTTCTGTGGGTTCTGTGGG - Intronic
1101517639 12:105451623-105451645 CCTGCTGCTATGGGCACTGTGGG + Intergenic
1101620798 12:106386000-106386022 AACACTGCATTGGGCACTGTGGG - Intronic
1103716254 12:122947146-122947168 CCCACCTCTGTGTGCACTGCAGG - Intronic
1103949279 12:124542420-124542442 CCCATCTCTGTGGGCCCTGTGGG - Intronic
1105070999 12:133234648-133234670 TCCACTGCTCTGGGCTCAGTAGG + Exonic
1106328230 13:28715307-28715329 ACCACTGCTGTGGGCAGTAGGGG + Intronic
1106631564 13:31479574-31479596 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
1107176386 13:37404432-37404454 TCTGCTGCTGTGGGCTCTGTTGG + Intergenic
1108063592 13:46554788-46554810 CCCACTGCCCTGGGAAATGTTGG - Intronic
1108270567 13:48755781-48755803 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
1108271074 13:48760080-48760102 GCCACTGGTGGGGGCACTGATGG - Intergenic
1108708328 13:53010136-53010158 CCCCATGTTCTGGGCACTGTGGG - Intergenic
1109130202 13:58575034-58575056 CCCACTGCTGTGTGCAGCCTTGG - Intergenic
1109202320 13:59444603-59444625 CCCACAGGTGTGGGCAGTGCGGG - Intergenic
1109334078 13:60970942-60970964 CCCCCTGCTGTGTGCAGTCTCGG + Intergenic
1109334890 13:60981376-60981398 CCCACTGCTGTGTGCAGCCTAGG - Intergenic
1109337139 13:61007912-61007934 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
1111336872 13:86836699-86836721 CCCTCTGCTGTGTGCATTATAGG - Intergenic
1111549550 13:89788957-89788979 AGCAGAGCTGTGGGCACTGTGGG - Intergenic
1111551402 13:89818089-89818111 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
1111615040 13:90652243-90652265 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
1113891810 13:113739929-113739951 CCCTCTGTTGTGGGCAGTCTTGG + Intergenic
1114650425 14:24281155-24281177 CCCACTGCTGGCAGCCCTGTTGG + Intergenic
1116133600 14:40891749-40891771 CCCTCTGCTGTGTGTAGTGTAGG - Intergenic
1117316604 14:54577077-54577099 GTCACTGCTGTGGGCAGTGGGGG + Intronic
1119150818 14:72357957-72357979 CCCACTGCTGTGTGCAGCCTAGG + Intronic
1119450174 14:74702489-74702511 CCCCCTGCTGTGTGCAGTGTAGG - Intronic
1120152680 14:81055074-81055096 CCCTCTGCTGTGTGCACTCTAGG + Intronic
1120305705 14:82766901-82766923 GCCACAGCTGTGGGGACTGGAGG + Intergenic
1121582882 14:95044314-95044336 CACAGCCCTGTGGGCACTGTGGG + Intergenic
1121768527 14:96508986-96509008 CCATCTCCTGTGGACACTGTAGG + Intronic
1122671207 14:103374061-103374083 CCCACTGCTCAGGCCACTGAAGG - Intergenic
1122767630 14:104082788-104082810 CCCACTGACCTGGGCACTGTGGG + Intergenic
1122803503 14:104244909-104244931 CCCAAGGCAGTGGACACTGTGGG + Intergenic
1122869913 14:104633790-104633812 GCCTCTGCTGTTGGCACTGCAGG - Intergenic
1122997772 14:105274826-105274848 CCCACTTCTGTCTGCACAGTGGG + Intronic
1123147761 14:106150577-106150599 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
1124363510 15:29055246-29055268 CCCACTGCTGCGGCCAGTGTTGG + Intronic
1124962858 15:34411006-34411028 CCCACTGCTGCGGCCAGTGTTGG + Intronic
1124979481 15:34557228-34557250 CCCACTGCTGCGGCCAGTGTTGG + Intronic
1125736870 15:41933111-41933133 CACACTCCTGTGGGCCCTGGAGG - Intronic
1126486486 15:49187385-49187407 CCCAGTGCTGTGTGAACTTTGGG - Intronic
1127791206 15:62400026-62400048 CCCACTGCTGTGGGGATTATGGG - Intronic
1128119806 15:65137243-65137265 CCCGCTGCTGTGTGCAGTCTAGG - Intergenic
1128146517 15:65335029-65335051 CCCTCTGCTGCGGGCTCTGCAGG + Intronic
1129367922 15:75068409-75068431 CCCAGTGCTGCGGACACAGTGGG + Intronic
1129719590 15:77870874-77870896 GCCTCTGCTGTGGGCACACTTGG - Intergenic
1132224024 15:100126780-100126802 CGCTCTGCTGTGGGCACGGAAGG + Intronic
1132656008 16:1042043-1042065 CCCCATGGTGTGGTCACTGTGGG + Intergenic
1132739234 16:1403111-1403133 CCTGCTGCTGTGGGCTCTGCTGG - Intronic
1133102834 16:3489591-3489613 GCCACTGCTGAGCTCACTGTGGG - Intergenic
1133563245 16:6968935-6968957 CCCACTAATCTGGTCACTGTGGG - Intronic
1134542099 16:15075837-15075859 CCCACTGCTGTGAGTACTGGCGG + Intronic
1135507201 16:23049168-23049190 CCCACTGCAGTAGACACTGCTGG - Intergenic
1136547522 16:30964145-30964167 ACCACTGCGGTGGGCACTCCTGG + Exonic
1137409400 16:48214927-48214949 CAGACCGCTGTGGCCACTGTGGG + Exonic
1137572022 16:49572774-49572796 CCCTCTCCAGTGTGCACTGTGGG - Intronic
1137707704 16:50547497-50547519 CCCCCTTCTGGGGACACTGTGGG - Intergenic
1138186088 16:54978675-54978697 CTCACTGCAGTGGGCTCTGCTGG - Intergenic
1138270796 16:55694564-55694586 CCCAGTGCTGTGGGGACTTCAGG + Intronic
1138895412 16:61198587-61198609 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
1139440516 16:66964341-66964363 TCCAGTGCTGGGGGCAGTGTTGG - Exonic
1139464848 16:67149021-67149043 TCCACTGCTCTGGGACCTGTTGG + Exonic
1139820201 16:69715062-69715084 ACCACTGCAGGGGGAACTGTGGG + Exonic
1139913301 16:70412039-70412061 TCCACTTCTGTGCTCACTGTTGG + Intronic
1140448991 16:75054828-75054850 CCCAGTGATGTGGGCAGTGAAGG - Intronic
1141489506 16:84362625-84362647 CCTGCAGCTGTGGGCACTGCTGG - Intergenic
1143378466 17:6480859-6480881 CCCACTGCTCCAGGCACTGAGGG - Intronic
1143400484 17:6639595-6639617 CCCAGAGCTGTGGGCCCTGAGGG + Intronic
1145753637 17:27373927-27373949 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
1145780155 17:27557432-27557454 CCCACTGTGGTGGGCACTGCAGG + Intronic
1145959950 17:28881459-28881481 CCCTCTGCTCTGGGGGCTGTCGG + Intronic
1146273636 17:31500367-31500389 CCCTCTGTTGTGGTCAGTGTGGG - Intronic
1147673968 17:42192532-42192554 CCCAGGGCTGAGGGCACTGGAGG - Exonic
1147907234 17:43831370-43831392 CCCACGGCTGTGGGGACATTTGG + Intronic
1148861406 17:50606190-50606212 CCCACTTTTTGGGGCACTGTGGG - Intronic
1149308635 17:55373114-55373136 CCCAGTGCTGTGCGCAGTCTAGG + Intergenic
1151335438 17:73436994-73437016 CCCACTCCTGAGGACACTATCGG + Intronic
1152223026 17:79079602-79079624 CCCATGCCTGTGGGCAGTGTTGG - Exonic
1152425911 17:80218578-80218600 CTCACACCTGTGGGTACTGTGGG - Intronic
1152553361 17:81040766-81040788 CCCAGGGCTGTGGGCAGTGCAGG + Intronic
1152557779 17:81063057-81063079 CCCGCTCCTGTGGGCCCTGGAGG - Intronic
1152784835 17:82242195-82242217 GCCACTGCTGTGTGCTCTGGGGG + Intronic
1152825422 17:82461862-82461884 GCCAGTGCTGTGGGGACTGTGGG + Intronic
1155517098 18:26635308-26635330 CCTAGTCCTGTGGGCACAGTGGG - Intronic
1157732959 18:50020590-50020612 CTCACTGTTGTGGTCATTGTAGG - Intronic
1157811070 18:50696403-50696425 CCCACTGAGCTGAGCACTGTTGG + Intronic
1158706543 18:59797446-59797468 CTCACTGCTGAGGCCAGTGTAGG + Intergenic
1159040802 18:63320892-63320914 CCCACTGCTGGGGGCGGTGGGGG - Intergenic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160885396 19:1344442-1344464 CACACTGCTATGGGCGCTGCTGG + Intergenic
1160936745 19:1599684-1599706 CCCAGTGCTGTGAGCCCTGAGGG + Intronic
1161299445 19:3535813-3535835 CCCACGGCTGTTGGCGCTGGTGG - Intronic
1162596472 19:11633452-11633474 CCCCGTGCTGTGTGCAATGTAGG + Intergenic
1162692918 19:12448907-12448929 CCCACTGCTGTGCTCACTTCAGG - Intronic
1164402803 19:27913297-27913319 CCCACTGCTGTAGTCTCTGCTGG + Intergenic
1164537207 19:29094744-29094766 CCCGCTGCTGTGGTAACTGTAGG + Intergenic
1164851190 19:31485520-31485542 CCCCCTGCTGTGTGCAGTCTAGG - Intergenic
1202704902 1_KI270713v1_random:15290-15312 CCCAGGGCTGGGGGCGCTGTGGG - Intergenic
924960001 2:26305-26327 GCCTCTGCTGTGGTCTCTGTGGG + Intergenic
925057526 2:866741-866763 CCCATTGCGGTGGGGACTCTGGG - Intergenic
926791285 2:16574566-16574588 CCCTCTGCTGTGTGCAGTCTAGG + Intronic
926947410 2:18203386-18203408 CCCTGTGCTGTGTGCAGTGTAGG + Intronic
930874193 2:56194872-56194894 CCCATTGCTGTGGGCAGTCTTGG + Intronic
931243585 2:60474779-60474801 CCCATTGCTTTGGGCATTGTAGG - Intronic
933268168 2:80204066-80204088 CCCTCTGCTGTGTGCAGTCTAGG - Intronic
933726853 2:85431883-85431905 CCTTCAGCTGTGGGCACAGTGGG - Intronic
933839623 2:86275977-86275999 TCCTCTGCTGTGGGACCTGTTGG - Intronic
934960455 2:98668277-98668299 CCCTCTGCTGTGTGCAGTCTAGG + Intronic
936795034 2:116194505-116194527 CCAACTGCTTTGTGCAGTGTAGG - Intergenic
936813669 2:116433324-116433346 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
937761033 2:125603946-125603968 CCCACTGCTGTGTGCAGCCTAGG + Intergenic
938108377 2:128548568-128548590 CCCAGTGCTGTGGGGCCTGAGGG - Intergenic
938114721 2:128595316-128595338 CTCCCTGCTGGGGACACTGTAGG - Intergenic
938307333 2:130264882-130264904 CCCTCTGCTGTGGCCACAGATGG + Intergenic
938447998 2:131391962-131391984 CCCTCTGCTGTGGCCACAGACGG - Intergenic
939127466 2:138194214-138194236 CACAGTGCTGTGGGCATAGTAGG + Intergenic
939506372 2:143052508-143052530 CCCTCTGCTGTGTGCAGTCTAGG + Exonic
941057665 2:160807012-160807034 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
942419944 2:175797286-175797308 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
942601310 2:177643792-177643814 CCCCCTGCTGTGTGCAGTCTAGG + Intronic
943313198 2:186353295-186353317 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
944105293 2:196073119-196073141 CCCACTTCTGTGGCCACACTGGG - Intergenic
944109769 2:196119848-196119870 ACCATTGCTAAGGGCACTGTAGG - Intergenic
944355913 2:198787690-198787712 CCCACTAATGTGGACACTATTGG + Intergenic
945618663 2:212106746-212106768 CCCTCTGCTGTGTGCAGTCTAGG + Intronic
945713444 2:213329847-213329869 CCCTCTGCTGTGTGCATTCTAGG + Intronic
946464421 2:219898650-219898672 CCCACTGCTGTGGTCTTTGAAGG - Intergenic
946478596 2:220032511-220032533 CCCACCACTGTAGGCTCTGTGGG + Intergenic
946575589 2:221071936-221071958 CCCTCTGCTGTGTGCACCTTTGG - Intergenic
947213742 2:227731173-227731195 GACACTGCGGTGGGCACAGTAGG + Intergenic
947951674 2:234152953-234152975 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
948587353 2:239027793-239027815 GCCACTGCTGGGGGCCCTGTGGG - Intergenic
948593957 2:239067781-239067803 CCCACTCCTGTCGGCACAGGCGG - Intronic
948614971 2:239192570-239192592 CTCCCTGCTGTGGGCACTGGGGG + Intronic
1169038855 20:2476266-2476288 GGCGCTGCTGTGGGCACTGCTGG + Intronic
1169798698 20:9493352-9493374 CCCACTGCAGTAGACACTTTTGG - Intergenic
1171110410 20:22475738-22475760 AACACTGTAGTGGGCACTGTTGG - Intergenic
1172278772 20:33695803-33695825 CCCAGTGCTGTGGGTACCCTGGG + Intergenic
1172624099 20:36337529-36337551 CCCTGTGCTGTGGGCTCTGGAGG + Intronic
1172761727 20:37328057-37328079 CCCACTGCTGGCGGGCCTGTGGG + Intergenic
1173522923 20:43712452-43712474 GCCCCTGCTGAGTGCACTGTTGG + Intronic
1173566396 20:44041362-44041384 CCCGCTGTAGTGGACACTGTCGG - Intronic
1174299591 20:49571747-49571769 CTCTCTTCTGTGGCCACTGTGGG + Intergenic
1175195409 20:57239876-57239898 CCCCCTGCTGTGTGCACCCTAGG - Intronic
1175258522 20:57661303-57661325 CCCATTGCTGGGGGCTCTGCTGG - Intronic
1175307214 20:57984515-57984537 CCCACTGGTGAGGACACTGAAGG + Intergenic
1176172133 20:63700836-63700858 CTCACTGCTGTGGTCTCTGTGGG - Intronic
1176704435 21:10101391-10101413 CCCCATGCTGTGTGCAGTGTAGG - Intergenic
1177261252 21:18733019-18733041 CCCACTGCTGTGTGCAGCCTAGG + Intergenic
1177471319 21:21563992-21564014 CCCCCTGCTGTGTGCACACTAGG + Intergenic
1178004124 21:28197071-28197093 CCCTGTGCTGTGTGCACTCTAGG - Intergenic
1178129426 21:29554874-29554896 CCAGGTGCTGTGGGCACTGCAGG - Intronic
1178420213 21:32437337-32437359 CCCACTGCTGTGGTCTCAGTTGG + Intronic
1179180637 21:39041934-39041956 CCCACTGCTGGGGGTAGTGGTGG - Intergenic
1180921131 22:19522269-19522291 GCCCCTGCTGGGGGCACTCTGGG - Intergenic
1181116412 22:20634911-20634933 CCCACAGCTGTGCTCACTGAGGG - Intergenic
1182093615 22:27612200-27612222 TTCCCTGCTGTGGGCACTGGAGG + Intergenic
1182660209 22:31919759-31919781 ACCCCTGCTGTGGGTCCTGTTGG + Intergenic
1182769600 22:32784912-32784934 CCCAGTGCTTTGTGCACAGTTGG - Intronic
1182940322 22:34270411-34270433 CCCACTGCTGTGTGCAGTCTAGG - Intergenic
1183544538 22:38448591-38448613 CCCAGAGCTGTGGGGTCTGTGGG - Intronic
1183742968 22:39678607-39678629 CCCCTTGCTGGGGGCACTGGGGG - Intronic
1183893835 22:40951651-40951673 CCCACTGTTGGGGGAAGTGTTGG + Intronic
1183924787 22:41197882-41197904 CCCTGTGCTCTGCGCACTGTGGG - Intergenic
1184507211 22:44911456-44911478 CCCTCTGCTGTGTGCAGTCTAGG + Intronic
950554861 3:13689276-13689298 GTCACTGCTGTGGGCAATGAGGG + Intergenic
951127051 3:18996372-18996394 CCCTCTGCTGTGCGCAGTCTAGG - Intergenic
951865107 3:27299197-27299219 CCCTCTGCTGTGCGCAGTCTAGG + Intronic
954050297 3:47970001-47970023 GTCACTGCTGTGGGCAAAGTGGG - Intronic
954138123 3:48591657-48591679 CCCACTGGTGAGGGCTCTGTGGG - Exonic
954582740 3:51711873-51711895 CCCACTCCTGTGGGACCTGAGGG + Intronic
955513743 3:59706763-59706785 CCCAGAGCTGTAGGCACTGGAGG + Intergenic
955869091 3:63417817-63417839 CCCTCTGCTGTGAGCAGTCTAGG - Intronic
957105681 3:75883833-75883855 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
957276068 3:78093132-78093154 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
957438857 3:80216391-80216413 CCAAGTGCTGTGGGGACTGTGGG + Intergenic
958152126 3:89704262-89704284 CCTTCTGCTGTGTGCAGTGTAGG - Intergenic
959439682 3:106360377-106360399 CCCTCTGCTGTGTGCAGTATAGG + Intergenic
959525087 3:107367688-107367710 TCCACTGCTGTAGGCAGTTTAGG + Intergenic
960848315 3:122024962-122024984 CCCACAGCTCTGGGCTCTCTTGG + Intergenic
961461143 3:127051131-127051153 CCCACTGCTCTGTGCCCTGGAGG + Intergenic
961472380 3:127124048-127124070 ACCACTGCTGTGGCCCCTGCTGG - Intergenic
961883791 3:130082169-130082191 CCCACTGCTGTGGTCTCAGTTGG - Intronic
962802963 3:138905876-138905898 CCCACAGATGTGGGGACTGGGGG + Intergenic
962926742 3:140000626-140000648 CCCATTTCTGTGGTCACTATTGG + Intronic
963835935 3:150057800-150057822 CCCTCTGCTGGGAGCAATGTTGG + Intergenic
965649459 3:170918928-170918950 CCCCCTGCTGTGTGCAGTCTGGG + Intergenic
965662099 3:171052748-171052770 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
965809730 3:172579215-172579237 CCCACTGCTGTGTGCAGCTTTGG + Intergenic
966059262 3:175734748-175734770 CCCTCTGCTGTGTGCAGTCTTGG - Intronic
967019172 3:185507487-185507509 CCCATGGCTGTGGCCACTGCAGG - Exonic
968035973 3:195548209-195548231 CCCTCTGCTGTGGCCTCTTTGGG + Intergenic
968227832 3:196986704-196986726 CCCACTGCTCAGGCCACTGAAGG - Intergenic
968403015 4:315049-315071 CCCTCTGCTGTGTGCAGTTTAGG - Intergenic
968504249 4:964604-964626 CCCCCTCTTCTGGGCACTGTGGG + Intronic
968779883 4:2572441-2572463 CCCACTGCAGCGAGCACTGTGGG - Intronic
969551097 4:7867788-7867810 CTCACTGCAGTGGGCACAGAGGG - Intronic
969820983 4:9720134-9720156 CCCACTGCTGTGGTCTCAGGTGG + Intergenic
970229753 4:13897713-13897735 CCCTGTGCTGTGGGCTTTGTAGG - Intergenic
970357380 4:15269406-15269428 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
970367446 4:15374120-15374142 GCCAGTGCTGTGTCCACTGTAGG - Intronic
970882346 4:20946839-20946861 GCCACTGCTGTTGGCAATGGGGG - Intronic
971753289 4:30678200-30678222 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
972484792 4:39530858-39530880 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
972756977 4:42057532-42057554 CCCTCTGCTGTGTGCAGTCTGGG - Intronic
973015764 4:45135104-45135126 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
973027659 4:45293159-45293181 TTCACTCCTGTGGGCAGTGTTGG + Intergenic
973107744 4:46361277-46361299 CCCCCTGCTGTGTGCAGTATAGG + Intronic
974206082 4:58705101-58705123 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
974897582 4:67957863-67957885 CCCTCTGCTGTGTGCAGTCTAGG + Intronic
974965797 4:68759674-68759696 CTCACTGCTGTGGTCACTTGGGG + Intergenic
976127842 4:81853227-81853249 CCCCCTGCTGTGGGTAGGGTAGG - Intronic
976303289 4:83535717-83535739 CCCACAGCTGTAGGCCATGTGGG + Intergenic
976635645 4:87284384-87284406 CCCTCTGCTGTGTGCAGTTTAGG + Intergenic
976976413 4:91169947-91169969 CCCACTGTTGTAGTCACTATGGG + Intronic
977383535 4:96308370-96308392 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
978774372 4:112490970-112490992 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
978920318 4:114175578-114175600 CCCACTGCTGTGTGCAGCCTAGG - Intergenic
978939040 4:114415375-114415397 CCCTCTGCTGTGGGCACTCTAGG + Intergenic
979564525 4:122139174-122139196 CCCACAGCTGTGGGAATTTTGGG - Intergenic
980376642 4:131957722-131957744 CCCCATGCTGTGTGCAGTGTAGG - Intergenic
980391753 4:132156106-132156128 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
980850444 4:138374450-138374472 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
981795351 4:148589403-148589425 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
981872894 4:149507918-149507940 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
982019623 4:151190487-151190509 CCCTCTGCTGTGTGCACTCTAGG + Intronic
982436306 4:155385356-155385378 AGCAGTGCTGTGTGCACTGTAGG - Intergenic
985488117 5:163153-163175 CCCAGGGCTGTGTGCTCTGTGGG + Exonic
986793928 5:11191131-11191153 ACCTCTGCTGTGTGCACTGCAGG - Intronic
988886380 5:35563059-35563081 CCCTTTCCTGTGTGCACTGTAGG + Intergenic
989651636 5:43696862-43696884 CCCTCTGCTGTGTGCAGTGTAGG - Intronic
991009990 5:61872345-61872367 CCCTCTGCTGTGTGCATTCTAGG - Intergenic
991119458 5:62994348-62994370 CCCTCTGCTGTGGGCAGTCTAGG - Intergenic
991409354 5:66331362-66331384 CCCACTGCTGTGTGCAGCCTAGG + Intergenic
992188012 5:74262582-74262604 CACAATGCTTTGTGCACTGTAGG - Intergenic
992309662 5:75482580-75482602 CCCAGTGCTGTGGTGGCTGTGGG + Intronic
993075941 5:83231404-83231426 CCCAGTGCTGTGCACACAGTAGG + Intronic
993154249 5:84202208-84202230 CCCACTGCTTTAGTGACTGTGGG + Intronic
993430977 5:87831686-87831708 CCCCATGCTGTGTGCAGTGTAGG - Intergenic
993451250 5:88074259-88074281 CCCCCTGCTGCGTGCAGTGTAGG + Intergenic
993754466 5:91710912-91710934 GCCACTACTCTGGGCACTGGTGG + Intergenic
993888173 5:93441458-93441480 CCCTCAGCTGTTTGCACTGTTGG - Intergenic
993945883 5:94116563-94116585 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
994253925 5:97570383-97570405 CCCACTGCTGTGTGCAGCCTTGG - Intergenic
994878112 5:105451082-105451104 CCCTCTGCTGTGTGCAGTGTAGG + Intergenic
996098093 5:119420429-119420451 CCCTCTGCTGTAGGCAGTCTAGG + Intergenic
998551067 5:143078448-143078470 CCCTCGGCTGTGGACACTGATGG + Intronic
999758115 5:154680319-154680341 CCCAGAGCTGTGGACACTGCTGG - Intergenic
1001684949 5:173586302-173586324 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
1002099403 5:176849987-176850009 CCACCTGCTGTGTGCACTGGAGG + Intronic
1002405639 5:179027955-179027977 CCCTCTGCCCTGGGCACTCTGGG + Intronic
1003280270 6:4685197-4685219 CCCCCTGCAGTAGTCACTGTAGG - Intergenic
1004425501 6:15504307-15504329 CCCACTCCTCTTGGCACTGCGGG + Intronic
1005841719 6:29748374-29748396 CCTGCTGCTGTGGGGACTGTGGG - Intergenic
1005871161 6:29975237-29975259 CCTATTGCTGTGGGGACTATGGG - Intergenic
1006058751 6:31404211-31404233 CCTGCTGCTGTGGGGACTGTGGG + Intronic
1006071236 6:31499096-31499118 CTTGCTGCTGTGGGGACTGTGGG + Intronic
1006643355 6:35499732-35499754 CCCACTGCTCTGGCCAATGCTGG + Intronic
1006654048 6:35575310-35575332 CCCTCTACTGTGGGTTCTGTTGG + Exonic
1007142074 6:39586115-39586137 CCCACAGCTGTGAACTCTGTAGG + Intronic
1007853777 6:44832804-44832826 CCTACTGCACTGGGCACTGTGGG + Intronic
1009546054 6:65020971-65020993 CCCACTGCTGTGTGCAGCCTTGG - Intronic
1009715866 6:67394482-67394504 CCCAGTGCTGTGTGCAGTATAGG + Intergenic
1011877097 6:91974946-91974968 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
1012771159 6:103436765-103436787 CCCACTGCTGTGTGCAGTTGTGG - Intergenic
1014327626 6:120018559-120018581 CCCACTGCTATGTGCAGTCTAGG - Intergenic
1014371441 6:120613693-120613715 CCCACAGCTGCTGGCAGTGTTGG + Intergenic
1016473706 6:144402921-144402943 CCCTCTGTTGTAGGCAGTGTTGG + Intronic
1017457560 6:154615741-154615763 CCCACTGCTGTGGTGAGTGGCGG + Intergenic
1018685352 6:166299780-166299802 CCCAGTGCTGTGGGGCCAGTGGG - Intergenic
1019073084 6:169365999-169366021 CCCACGGCTGTGATGACTGTGGG - Intergenic
1019406598 7:887292-887314 TCCACTTCTGTGGGGAATGTGGG + Intronic
1020317770 7:6918705-6918727 CCCACTGCTGTGGTCTCAGCTGG - Intergenic
1021133910 7:16943270-16943292 CCCACTGCTGTGGGCTCCTGTGG + Intergenic
1022417505 7:30190737-30190759 CCCCCTGCTGTGGGCCCTCTGGG - Intergenic
1022596014 7:31713860-31713882 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
1023185783 7:37531465-37531487 CCCACTGCTGTGGGAGATGGCGG + Intergenic
1023264701 7:38392878-38392900 CACACTGCTGTGGCCGCTGGAGG + Intronic
1026149160 7:67773462-67773484 CTCACTTCTGTGGTCACTATAGG + Intergenic
1026382310 7:69811896-69811918 CCTACTGCACTAGGCACTGTGGG - Intronic
1026899342 7:74028302-74028324 CCCACAGCTGCGGGCCCTTTGGG + Intronic
1028950481 7:96630077-96630099 CCCAATGCTGTGGTGACTTTGGG - Intronic
1030112826 7:106041114-106041136 CGCACTGCTTTGGGCAATGCAGG + Intergenic
1030657131 7:112180719-112180741 CAAAGTGCTGTTGGCACTGTGGG - Intronic
1032661278 7:133986689-133986711 CCCAGTGCTTTGTACACTGTAGG - Intronic
1034991215 7:155549139-155549161 CCCTGTGCTGTGGTCACTGTGGG + Intergenic
1035370824 7:158377859-158377881 CCCTGTGCTGTGTGGACTGTGGG - Intronic
1035751291 8:1998293-1998315 CTCGCTGTTGGGGGCACTGTGGG + Intronic
1035938931 8:3874718-3874740 CCCACTGCTCTTGGCAATGGAGG + Intronic
1036727331 8:11231578-11231600 CCCACTGCTGGGGACATTTTAGG - Intergenic
1038500837 8:28042292-28042314 CTGACTGCTGCAGGCACTGTGGG - Intronic
1038703262 8:29871060-29871082 CCCATTGCAGTGGGCCCTGGAGG - Intergenic
1039398395 8:37247090-37247112 CCCACTAAGGTGGGCATTGTAGG + Intergenic
1039642763 8:39241675-39241697 CCCTCTGCTGTGTGCAGTTTAGG - Intronic
1040275422 8:46011366-46011388 CCCCCTGCAGTGGGCACAGGGGG - Intergenic
1041437979 8:57863010-57863032 CCCCCTGCTGTGTGCAGCGTAGG + Intergenic
1042361343 8:67886783-67886805 CTCACTGGTGTGGCCATTGTGGG + Intergenic
1044604594 8:94037498-94037520 CCCACTGCTGTGGGCTAGGCTGG + Intergenic
1045053635 8:98349826-98349848 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
1045567900 8:103339876-103339898 CCCACTGCTGGGGGCACTTGAGG - Intergenic
1045648806 8:104324348-104324370 CCCCCTTCTGTGGACACTGTGGG - Intergenic
1046492176 8:114967618-114967640 CCCTCTGCTGTGAGCAGTCTAGG + Intergenic
1047490446 8:125369986-125370008 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
1048443488 8:134476933-134476955 CCCCCTGGGGTGGGCAGTGTGGG - Intergenic
1049003684 8:139841693-139841715 CTCCCTACTGTGAGCACTGTGGG - Intronic
1049473183 8:142785266-142785288 CCCCAGGCTGAGGGCACTGTGGG + Exonic
1049479735 8:142816186-142816208 CCTACAGCTGGGGGCACTGGAGG + Intergenic
1049614674 8:143570909-143570931 GCAACTGCTGTGGGCGCTGAAGG - Exonic
1049681424 8:143920260-143920282 CCCTGTGCTGGGGTCACTGTAGG + Exonic
1050031042 9:1385984-1386006 GCCACTGCTGTGGGAAGTGATGG + Intergenic
1050086529 9:1972087-1972109 CCCCCTGCTGTGTGCAGTTTAGG + Intergenic
1052511219 9:29423233-29423255 CCTACTGCTATGGGCTATGTTGG + Intergenic
1053641693 9:40088404-40088426 CCCCATGCTGTGTGCAGTGTAGG - Intergenic
1053764443 9:41377060-41377082 CCCCATGCTGTGTGCAGTGTAGG + Intergenic
1054322583 9:63685793-63685815 CCCCATGCTGTGTGCAGTGTAGG - Intergenic
1055167867 9:73219111-73219133 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
1055728560 9:79257725-79257747 TTCCCTGGTGTGGGCACTGTTGG + Intergenic
1057732462 9:97622176-97622198 CCCCCTGCTGTGGGCAGTCTAGG + Intronic
1057835992 9:98445743-98445765 CCCAATCCTGTAGGGACTGTAGG + Intronic
1057974034 9:99584560-99584582 CCTCCTGCTGTGGGGACTGGGGG + Intergenic
1060494088 9:124105282-124105304 ACCACTCCTGTGGGCATTCTAGG + Intergenic
1061569424 9:131467616-131467638 GCCACTGCTGGGGACACTGTGGG - Exonic
1061711842 9:132493309-132493331 GCCACTGCTATGGGCATTCTTGG + Intronic
1061857247 9:133449032-133449054 CCCACTGGTGAGGACACTGAGGG - Intronic
1062493636 9:136821577-136821599 CCCACAGCTCTGGGCTCAGTCGG - Intronic
1062630560 9:137461348-137461370 CCCACTGCTGTGGGAACACGTGG + Intronic
1202789471 9_KI270719v1_random:71490-71512 CCCCATGCTGTGTGCAGTGTAGG - Intergenic
1185798363 X:2986270-2986292 CCCACTGGTGAGATCACTGTGGG + Intergenic
1187311567 X:18149222-18149244 CCCACTGCAGAGGACACTATTGG + Intergenic
1188196367 X:27240266-27240288 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
1188274027 X:28178320-28178342 ACCACTGCTGTGGGCTCTTGTGG - Intergenic
1188997577 X:36904763-36904785 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
1189241612 X:39529020-39529042 CCCACTTCTGTGGCTGCTGTGGG - Intergenic
1189659916 X:43286026-43286048 GCAACTGCTGTGGGAACTGAAGG + Intergenic
1189896123 X:45658596-45658618 CCCCCTGCTGTGTGCACCCTAGG + Intergenic
1190227769 X:48559422-48559444 CACACTGCTGTGGGCAAGGGTGG + Intronic
1190344512 X:49324966-49324988 CACACTGCTGTTGGTACTCTAGG + Intronic
1190345604 X:49334512-49334534 CACACTGCTGTTGGTACTCTAGG + Intronic
1190346706 X:49344062-49344084 CACACTGCTGTTGGTACTCTAGG + Intronic
1190347955 X:49535089-49535111 CACACTGCTGTTGGTACTCTAGG + Intronic
1190349056 X:49544645-49544667 CACACTGCTGTTGGTACTCTAGG + Intronic
1190350160 X:49554201-49554223 CACACTGCTGTTGGTACTCTAGG + Intronic
1190351262 X:49563760-49563782 CACACTGCTGTTGGTACTCTAGG + Intronic
1190352362 X:49573313-49573335 CACACTGCTGTTGGTACTCTAGG + Intronic
1190353463 X:49582861-49582883 CACACTGCTGTTGGTACTCTAGG + Intronic
1190354565 X:49592383-49592405 CACACTGCTGTTGGTACTCTAGG + Intronic
1190355669 X:49601939-49601961 CACACTGCTGTTGGTACTCTAGG + Intronic
1191711018 X:64149974-64149996 CCCACTGCTCTGTGCACCCTTGG - Intergenic
1193642532 X:84028855-84028877 GCCACTGCAGTGGGCAGGGTTGG - Intergenic
1193744907 X:85265761-85265783 CACATGGCAGTGGGCACTGTTGG + Intronic
1194397566 X:93404266-93404288 CCCCCTGCTGTGGGCAGGCTAGG - Intergenic
1199240816 X:145545457-145545479 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic
1199458288 X:148054070-148054092 CCTACTGCTTTGGCCACTGTTGG - Intergenic
1200381573 X:155842865-155842887 CCCTCTGCTGTGTGCAGTCTAGG + Intergenic
1202015529 Y:20402269-20402291 CCCTCTGCTGTGTGCAGTCTAGG - Intergenic