ID: 900643124

View in Genome Browser
Species Human (GRCh38)
Location 1:3696761-3696783
Sequence CTTGAGCCCCACCGCTGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 133}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900643124_900643138 25 Left 900643124 1:3696761-3696783 CCCGAGCAGCGGTGGGGCTCAAG 0: 1
1: 0
2: 2
3: 11
4: 133
Right 900643138 1:3696809-3696831 GTTGTCCTAACTGGAGATCCAGG 0: 1
1: 0
2: 0
3: 9
4: 84
900643124_900643131 -6 Left 900643124 1:3696761-3696783 CCCGAGCAGCGGTGGGGCTCAAG 0: 1
1: 0
2: 2
3: 11
4: 133
Right 900643131 1:3696778-3696800 CTCAAGCCATGTGGGGCCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 232
900643124_900643132 -3 Left 900643124 1:3696761-3696783 CCCGAGCAGCGGTGGGGCTCAAG 0: 1
1: 0
2: 2
3: 11
4: 133
Right 900643132 1:3696781-3696803 AAGCCATGTGGGGCCAGGGGAGG 0: 1
1: 0
2: 2
3: 85
4: 663
900643124_900643139 26 Left 900643124 1:3696761-3696783 CCCGAGCAGCGGTGGGGCTCAAG 0: 1
1: 0
2: 2
3: 11
4: 133
Right 900643139 1:3696810-3696832 TTGTCCTAACTGGAGATCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 139
900643124_900643129 -8 Left 900643124 1:3696761-3696783 CCCGAGCAGCGGTGGGGCTCAAG 0: 1
1: 0
2: 2
3: 11
4: 133
Right 900643129 1:3696776-3696798 GGCTCAAGCCATGTGGGGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 191
900643124_900643136 16 Left 900643124 1:3696761-3696783 CCCGAGCAGCGGTGGGGCTCAAG 0: 1
1: 0
2: 2
3: 11
4: 133
Right 900643136 1:3696800-3696822 GAGGGACCAGTTGTCCTAACTGG 0: 1
1: 0
2: 0
3: 6
4: 65
900643124_900643133 -2 Left 900643124 1:3696761-3696783 CCCGAGCAGCGGTGGGGCTCAAG 0: 1
1: 0
2: 2
3: 11
4: 133
Right 900643133 1:3696782-3696804 AGCCATGTGGGGCCAGGGGAGGG 0: 1
1: 0
2: 5
3: 60
4: 635
900643124_900643130 -7 Left 900643124 1:3696761-3696783 CCCGAGCAGCGGTGGGGCTCAAG 0: 1
1: 0
2: 2
3: 11
4: 133
Right 900643130 1:3696777-3696799 GCTCAAGCCATGTGGGGCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900643124 Original CRISPR CTTGAGCCCCACCGCTGCTC GGG (reversed) Intronic
900331250 1:2135763-2135785 CTTCAGCCCCATCCCTGCTTGGG + Intronic
900386534 1:2413318-2413340 CCTGAGCCCCGCAGGTGCTCTGG + Intronic
900643124 1:3696761-3696783 CTTGAGCCCCACCGCTGCTCGGG - Intronic
902531154 1:17091508-17091530 CTTGACTCCCAGCCCTGCTCTGG + Intronic
902744991 1:18467804-18467826 CTTGAGCTTCACCTCTTCTCTGG + Intergenic
904330619 1:29755784-29755806 CCTGAGCCCCGCAGCTGGTCTGG + Intergenic
904416055 1:30361811-30361833 CCTGAGCCCCACAGCTGGTCTGG - Intergenic
905282821 1:36859977-36859999 CTGGAGCCCTACCGCTACTCAGG - Exonic
906717630 1:47981955-47981977 CTTGAGGCCCAGCTCTGCCCTGG - Intronic
914313363 1:146486911-146486933 CTTGGGCCCCCTGGCTGCTCGGG - Intergenic
914500987 1:148246470-148246492 CTTGGGCCCCCTGGCTGCTCGGG + Intergenic
923506471 1:234609815-234609837 CTGGAGGCCCGCCGCGGCTCCGG - Intergenic
1065102025 10:22340776-22340798 CTGGAGCCGCACTGCCGCTCGGG - Intergenic
1069722311 10:70557599-70557621 CTGGGGCCCCACCGCTGGGCTGG + Intronic
1070957574 10:80474361-80474383 CTTCAACCCCACCCCTCCTCTGG - Intronic
1073624775 10:105085495-105085517 CCTGAGCTCCAGCACTGCTCAGG - Intronic
1075799209 10:125142314-125142336 CATGAGCCCCAGGGGTGCTCTGG - Intronic
1076466709 10:130687741-130687763 CATGAGCAGCACCGCTGCACTGG - Intergenic
1076899288 10:133329203-133329225 CTTGACCCCCACAGCCCCTCTGG + Intronic
1079028367 11:16966791-16966813 AGTCAGCCCCACCCCTGCTCTGG + Intronic
1080909788 11:36584002-36584024 CTTGTGCCCCACTGCTGGTGTGG - Intronic
1084040072 11:66537431-66537453 CCTGAGCCCCTCCGGGGCTCTGG + Intronic
1090174063 11:124632054-124632076 CTTAAGTTCCACTGCTGCTCGGG - Intronic
1091407059 12:215569-215591 CTTGAGCTACCCCGGTGCTCAGG + Intergenic
1097882137 12:64695744-64695766 CGTGAGGCCCACCTCTGCCCAGG - Exonic
1100864785 12:98845347-98845369 CTTGAGCCACACAGCATCTCTGG - Intronic
1101687938 12:107044161-107044183 CATCTGCCCCACAGCTGCTCTGG + Intronic
1101870718 12:108563065-108563087 CTTCAGCCACTCCGCTGCCCTGG + Intronic
1103736983 12:123066794-123066816 CTGGACCCCCTCGGCTGCTCTGG + Intronic
1104019213 12:124980544-124980566 CTGCAGCCCCACCACTGCCCAGG - Exonic
1104864584 12:131945301-131945323 AGTGAGCCCCACTGCTCCTCTGG - Exonic
1104959263 12:132480457-132480479 CTTGAGCGCAAACGCTGCTGCGG - Intergenic
1105542984 13:21330814-21330836 TTTGAGTCCCAACACTGCTCAGG + Intergenic
1109212434 13:59549130-59549152 CTCCAGCCCCACAGATGCTCTGG + Intergenic
1109923759 13:69106447-69106469 ATTGAGCTCCAGTGCTGCTCTGG + Intergenic
1110553039 13:76828573-76828595 ATTGAGCCTCACCGTAGCTCTGG - Intergenic
1113772030 13:112916585-112916607 GTTGAGCTCCACCCCTGCACTGG + Intronic
1115566479 14:34629670-34629692 CTTGTCCCCCGCCGCTGTTCGGG - Intronic
1121556171 14:94839455-94839477 TTTGAGCCTCACCCCTGCTCCGG + Intergenic
1122687531 14:103517062-103517084 CTACAGCCCCACCCCTCCTCTGG - Intergenic
1122719653 14:103715224-103715246 CGGGAGCCCCGCCGCAGCTCGGG - Intronic
1124786287 15:32684082-32684104 CTTGACCCCCACAGTTGCCCTGG + Intronic
1128250051 15:66157536-66157558 CTTTAGCCCCACAGCAGCCCTGG + Intronic
1129254601 15:74326977-74326999 CTTGAGCAGCACAGCTGGTCTGG - Intronic
1129468389 15:75737184-75737206 CTTGATCCCCACGGCCACTCTGG + Intergenic
1133739730 16:8641953-8641975 CTTCAGGCCCACTGCTGCCCGGG - Intronic
1137610486 16:49814180-49814202 CTGGAGTCCCACTGCTGCTGAGG - Intronic
1142232308 16:88905658-88905680 CTTCAGCCCCACCTCCCCTCAGG - Intronic
1145197620 17:20908591-20908613 CCTGAGCCCCAGCGCAGCGCAGG + Intergenic
1146057338 17:29588108-29588130 GTTGAGCCTCACAGATGCTCTGG - Intronic
1149529298 17:57381925-57381947 CTTGAGCACCACCAGTGCTTTGG + Intronic
1151703942 17:75757126-75757148 CTTCACCCCCACCCCTCCTCGGG + Intronic
1152368689 17:79871681-79871703 CTTGAACCCCACTCCTCCTCCGG - Intergenic
1152376144 17:79919936-79919958 CTTGGGCCCCCGTGCTGCTCTGG - Intergenic
1152460292 17:80438868-80438890 CCCAAGCCCCACCCCTGCTCTGG + Intergenic
1152730344 17:81966936-81966958 CTTGAGCGCCAGGGCCGCTCTGG + Intergenic
1153688502 18:7568306-7568328 CCTGGGCCCGGCCGCTGCTCGGG - Intronic
1155517696 18:26639858-26639880 CTTGGGCCACACTGCTGCTTGGG + Intronic
1155647219 18:28093936-28093958 TTTGAGGACCACCTCTGCTCAGG - Intronic
1158523107 18:58188293-58188315 CTTGAGCACCACTGGTGCTAGGG - Intronic
1166100946 19:40570965-40570987 GTTGAGCCCCACCCCTCATCTGG - Intronic
1166555881 19:43699679-43699701 CTAGAGTCCCACTGCCGCTCGGG + Intergenic
1167745963 19:51352042-51352064 CTCGGGCACCACCTCTGCTCAGG - Intronic
930274524 2:49296076-49296098 CTTGGGCTCCTCCGCTGCACAGG - Intergenic
932616210 2:73233228-73233250 CTTCAGCCTGACAGCTGCTCCGG + Exonic
935351611 2:102155689-102155711 CTTCTGCCCCAGAGCTGCTCTGG - Intronic
937905269 2:127049980-127050002 CATGAGCCCAACCAGTGCTCCGG + Intronic
946980464 2:225208443-225208465 CTTGAGCACCACCGGAGCCCAGG + Intergenic
947927906 2:233937776-233937798 CTTGAGCCCTACTGCTACTGAGG + Intronic
948685787 2:239669117-239669139 CTTGAGCCTCACTGCAACTCAGG + Intergenic
1168827197 20:821878-821900 CCTGGGCCCCACAGCTGCCCAGG + Intergenic
1169252429 20:4070984-4071006 CATCAGCCCCTCCTCTGCTCTGG - Intronic
1173503760 20:43571508-43571530 CTAGAGACCCACCCCAGCTCAGG - Intronic
1173712808 20:45175485-45175507 CTTGAGCCCCATCCTGGCTCTGG - Intronic
1176183775 20:63766969-63766991 CCTGAGCCCACCTGCTGCTCTGG + Intronic
1176306444 21:5125958-5125980 CTTCAGCCCCTCCACGGCTCAGG + Exonic
1176340990 21:5695848-5695870 CTTGAGCCCAATTGCTGTTCTGG - Intergenic
1176473244 21:7128001-7128023 CTTGAGCCCAATTGCTGTTCTGG - Intergenic
1176503837 21:7628608-7628630 CTTGAGCCCAATTGCTGTTCTGG + Intergenic
1178760311 21:35396063-35396085 CTTAAGCCCCATGGCTGCTCAGG + Intronic
1179850615 21:44136072-44136094 CTTCAGCCCCTCCACGGCTCAGG - Exonic
1180079085 21:45478088-45478110 CCTTAGGCCCACCGTTGCTCGGG + Intronic
1181421329 22:22801060-22801082 CCTGAGCCCCAGCTCTGCTGTGG + Intronic
1184418096 22:44363773-44363795 CTTGAGCCAGACGGCCGCTCTGG + Intergenic
1184653151 22:45928378-45928400 CTTGTGCCCCACAGGTGCACAGG + Intronic
1184659934 22:45961076-45961098 CCTGACCCCCACAGCAGCTCTGG + Intronic
1203240256 22_KI270733v1_random:10306-10328 CTTGAGCCCAATTGCTGTTCTGG - Intergenic
950497642 3:13343508-13343530 CATGAGCCCCACTGCTGGCCAGG + Intronic
951739640 3:25906230-25906252 CTCTAGCCCCATCTCTGCTCTGG - Intergenic
952316788 3:32238738-32238760 CTAGGGCCCCAGCGCAGCTCGGG + Exonic
952942326 3:38454153-38454175 TTGGAGCCCGAACGCTGCTCGGG + Exonic
954690782 3:52394648-52394670 CTTGAGCCCCACCGGTTAGCTGG + Exonic
955863496 3:63357203-63357225 GGTGAGCTCCACAGCTGCTCTGG + Intronic
957964203 3:87301619-87301641 CTGGAGCCCCACCGATACCCTGG + Intergenic
961625708 3:128262252-128262274 CTTTAGCCCCAGCGCTGCTCAGG + Intronic
968616930 4:1581264-1581286 TCAGAGCCCCACCTCTGCTCAGG + Intergenic
968764987 4:2463441-2463463 CTTGAGCGCCAACGTTGCACTGG + Intronic
972410215 4:38786196-38786218 CCTGACCACCACGGCTGCTCTGG - Intergenic
981573197 4:146175811-146175833 GGTGAGCCGCACCGCTGCGCGGG + Exonic
984832394 4:183987685-183987707 GGTGAGCTCCACCGCTGCCCGGG + Intronic
985938102 5:3112003-3112025 CCTGAGTCCCACCTCTGCTCTGG + Intergenic
986041643 5:3999668-3999690 CTTGAGCCCCTCTGGTGCTTGGG - Intergenic
997629220 5:135354080-135354102 CTTGAGCACCAGCTCTGCTAGGG - Intronic
998171271 5:139873233-139873255 CCGGAGCCCCACCCCTGCTGAGG + Intronic
999923763 5:156352358-156352380 CTTGAGCACCCCAGCTGCTCTGG + Intronic
1002706539 5:181164476-181164498 CTTGGGCCCCACGCATGCTCGGG - Intergenic
1002707186 5:181169931-181169953 CTTGGGCCCCACGCTTGCTCGGG - Intergenic
1003653754 6:7986632-7986654 CTTGAGCCCCACGGCATCTGAGG + Intronic
1004262156 6:14117838-14117860 CGCGAGCCCTACCGCAGCTCAGG - Exonic
1006022408 6:31125210-31125232 CTGGAGCCCCAGAGCAGCTCTGG - Intronic
1006444856 6:34074424-34074446 GTTGAGCCTCACAGCTGCCCTGG - Intronic
1014432951 6:121390709-121390731 CTGGAGCCTCACCTCTTCTCTGG + Intergenic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1019484752 7:1284410-1284432 CCTGAGCCCCTGCCCTGCTCAGG + Intergenic
1025607304 7:63048497-63048519 CTTGCTTCCCTCCGCTGCTCAGG + Intergenic
1025613212 7:63096257-63096279 CTGGAGCCCCACCGCTTTCCTGG - Intergenic
1026342411 7:69445795-69445817 CTTATGCCCCACTGCTGCGCAGG - Intergenic
1026738521 7:72964209-72964231 CCTGAGCCCCACCGCTGTCCTGG + Intronic
1026789539 7:73322852-73322874 CCTGAGCCCCACCGCTGTCCTGG + Intronic
1027105213 7:75400860-75400882 CCTGAGCCCCACCGCTGTCCTGG - Intronic
1032512967 7:132486661-132486683 CACCAGCCCCACCACTGCTCTGG + Intronic
1033244461 7:139706625-139706647 TTTCAGCCCCTCCCCTGCTCTGG + Intronic
1033324878 7:140369078-140369100 TCTGAGCCCCACCGCATCTCTGG + Intronic
1034236102 7:149570910-149570932 CTTGACCCCCTCCCCTGCACAGG - Intergenic
1034457487 7:151178916-151178938 GTTGATCCCCACCTCTGCACTGG + Intronic
1034746188 7:153525732-153525754 CATGACCCTCACCCCTGCTCTGG - Intergenic
1038180710 8:25224805-25224827 CATTGGCCCCACCTCTGCTCTGG + Intronic
1039231051 8:35448567-35448589 CCTGAGCCCCACCTCTGCTGGGG - Intronic
1042530167 8:69806560-69806582 CTTGAGCCACTCAGCTGTTCTGG - Intronic
1047097526 8:121640523-121640545 CTGGAGCCCCTCTGCTGCTCCGG + Intronic
1049544960 8:143226240-143226262 CTCCAGCCCCACCTCTGCCCTGG + Intergenic
1049545241 8:143227778-143227800 CCTGGGCCCCACCCCTGCCCTGG + Intergenic
1049574508 8:143384089-143384111 CTGGACCCCCACCCCGGCTCAGG - Exonic
1049661632 8:143822132-143822154 CCTGGGCCCCACAACTGCTCGGG - Intronic
1050278619 9:4026921-4026943 CTTCAGCCCCACCTCCTCTCAGG - Intronic
1053014592 9:34654671-34654693 CCTGAGGCCCACCCCTGCCCTGG - Intronic
1053140573 9:35680190-35680212 ATTCAGCCCCAGGGCTGCTCAGG + Intronic
1056970289 9:91195699-91195721 CTTGAGCTCCTCCCCTGATCTGG + Intergenic
1057897130 9:98918066-98918088 CTTGAGACCCAGGGCTGTTCTGG + Intergenic
1057969156 9:99536741-99536763 CTTGATACCCACTGCTGTTCTGG - Intergenic
1062357538 9:136171916-136171938 CATGGGCCCCACCCCTGCCCTGG + Intergenic
1203422077 Un_GL000195v1:2145-2167 CTTGAGCCCAATTGCTGTTCTGG + Intergenic
1185446343 X:259801-259823 CTTCTGACCAACCGCTGCTCTGG + Intergenic
1186523190 X:10223614-10223636 CCTGAGCTCCACCGCTGGCCTGG + Intronic
1187276068 X:17817584-17817606 CTGGAGCCCCACAGCTGCTCAGG + Intronic
1187445827 X:19360013-19360035 CTGCAGCACCAGCGCTGCTCGGG - Exonic
1198515857 X:137405970-137405992 CTGGGGCGCCACCGCGGCTCTGG + Intergenic