ID: 900646509

View in Genome Browser
Species Human (GRCh38)
Location 1:3711207-3711229
Sequence ACGTGTGTGGAGCGCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900646509_900646511 1 Left 900646509 1:3711207-3711229 CCTGGGGAGCGCTCCACACACGT 0: 1
1: 0
2: 0
3: 4
4: 64
Right 900646511 1:3711231-3711253 AGCTCTGAGTGCAGTGCTGATGG 0: 1
1: 2
2: 2
3: 21
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900646509 Original CRISPR ACGTGTGTGGAGCGCTCCCC AGG (reversed) Intronic
900610989 1:3544586-3544608 CGGTGTGTGGAGCACTCCCCAGG - Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
901942956 1:12677808-12677830 AAGTGTTTGGACCTCTCCCCTGG - Intergenic
903132503 1:21289418-21289440 ACGGGGGTGGGGCCCTCCCCAGG + Intronic
919740368 1:200977538-200977560 ACTAGAGTGGAGCTCTCCCCTGG - Intronic
919829614 1:201531374-201531396 GAGTGTGTGCAGCGCTCCCACGG + Intergenic
1078527021 11:12109283-12109305 ACGTGTGAAGGGCACTCCCCAGG + Intronic
1079357924 11:19745461-19745483 AGGTGTGTGGAGGGCTACTCTGG - Intronic
1083234740 11:61344170-61344192 ACGGGTGTGCAGCACTCTCCTGG + Exonic
1084447006 11:69209569-69209591 ACGGGTGTGGAGCAGGCCCCGGG - Intergenic
1084978042 11:72814119-72814141 ACGCGGGTGGAGCGCTCCGGAGG - Intergenic
1085705837 11:78786312-78786334 GCCTGTGGGGAGCTCTCCCCAGG + Intronic
1085837278 11:79970628-79970650 ATGTGTGTGGTACGCTCCCTCGG - Intergenic
1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG + Intergenic
1089710484 11:120311037-120311059 ATGTGGGTGGAGCTCTCCCAGGG + Intronic
1090270056 11:125379716-125379738 AGGTGTGTGCAGCTGTCCCCGGG - Intronic
1102812678 12:115837977-115837999 ACATGTGGGGGGCGCTGCCCAGG - Intergenic
1106111479 13:26781458-26781480 ATGTCTGTGGAGTGCTCTCCTGG - Intergenic
1118456287 14:65948044-65948066 AGGTGTGCTGAGCTCTCCCCAGG - Intergenic
1120847595 14:89139608-89139630 ACCTGTGTGGAGAGCTTCTCAGG + Intronic
1128756584 15:70187547-70187569 ACGTGTGTGGGCAGCTCCCTTGG + Intergenic
1130059607 15:80560008-80560030 ATGTGTGGGGAGGGCTCTCCTGG - Intronic
1130979498 15:88803196-88803218 GCGGGAGAGGAGCGCTCCCCGGG - Intergenic
1134634009 16:15778594-15778616 ACATGTGTGGACCGGACCCCTGG - Intronic
1148892905 17:50820640-50820662 ACGAGGGTGGAGCCCTCGCCAGG - Intergenic
1151340823 17:73469624-73469646 ACGTGTGTGGTCCCTTCCCCTGG - Intronic
1151364960 17:73611372-73611394 ACCAGTGTGGAGCACGCCCCAGG + Intronic
1152700139 17:81814571-81814593 GCGTGTGTGTGGCGCACCCCGGG - Intergenic
1154014496 18:10604401-10604423 CCGTGGGTGCAGCTCTCCCCAGG - Intergenic
1154079557 18:11242929-11242951 ACCAGTGTGGAGTGCTCCCAGGG + Intergenic
1158405465 18:57155822-57155844 ATGTGTTTGGAGAGCTCCCTGGG + Intergenic
1162391936 19:10395207-10395229 AGGTGAGTGGAGCTTTCCCCGGG - Exonic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
927905154 2:26849819-26849841 CCGTGTGGGAGGCGCTCCCCCGG + Intronic
929166649 2:38888461-38888483 AGGTGTGTGGATCGCTTGCCAGG + Intronic
931661617 2:64569611-64569633 ACGTGTGTGTAGCTCTTCACGGG + Exonic
934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG + Intronic
935071810 2:99700982-99701004 ATGAGTGTGGAGTGTTCCCCGGG - Intronic
947586228 2:231358538-231358560 ACCTGTGGGGAGCGCTGCCTGGG - Intronic
1172083336 20:32358985-32359007 AGGGGTGGGGAGCGCTCCGCCGG + Intronic
1178350093 21:31866739-31866761 ATTTGTGTTGAGCACTCCCCAGG + Intergenic
954419508 3:50411180-50411202 ACATTTGAGGAGCGGTCCCCTGG - Intronic
961456466 3:127027102-127027124 ACGTGTGCTGGGCGCTCCCCAGG + Intronic
962932852 3:140053540-140053562 ATGTGTGTGGAGGACTGCCCAGG + Intronic
967896068 3:194397047-194397069 ACGTGTTTGGGGCTCTGCCCCGG - Exonic
970233499 4:13934461-13934483 ACCTGTGTGGAGCCCTCACTGGG + Intergenic
970617525 4:17781698-17781720 ACGTGGGTGGCGCGCGGCCCTGG + Intergenic
971585043 4:28394686-28394708 AAGTGTGTGGTACCCTCCCCCGG + Intronic
973240755 4:47953872-47953894 CCGAGTGTGGAGCCCTCGCCGGG - Intronic
985574970 5:669771-669793 ACGGGCGGGGAGCTCTCCCCAGG + Intronic
985684634 5:1275568-1275590 AGGGGTGTGGAGGCCTCCCCTGG - Intronic
985690879 5:1311607-1311629 ACCTGTGGGGAGCCCTGCCCTGG - Intergenic
988772999 5:34450525-34450547 AAGTGTTTGGAGTTCTCCCCTGG - Intergenic
997638587 5:135433991-135434013 AGGACTGTGTAGCGCTCCCCAGG - Intergenic
1017520641 6:155198850-155198872 ACATGTGTGGAGGGCACCCTGGG + Intronic
1023059909 7:36316897-36316919 ACGTGTGAGGACCACTGCCCCGG - Intergenic
1024502783 7:50130708-50130730 AGGTGTGGGGAGGCCTCCCCAGG + Intronic
1026152076 7:67796393-67796415 ACGTGTGTGATACACTCCCCAGG - Intergenic
1029109807 7:98207231-98207253 ACGGGTCTGGAGAGCACCCCAGG - Exonic
1035589485 8:802091-802113 AGGTGTGTGGACCATTCCCCAGG - Intergenic
1046407740 8:113796655-113796677 GTGTGTGTGGTGTGCTCCCCGGG + Intergenic
1047151172 8:122264794-122264816 AAGTGTTTGGAGTTCTCCCCTGG + Intergenic
1056820464 9:89838127-89838149 GCCTGTGTGGTGCCCTCCCCTGG + Intergenic
1057035986 9:91811889-91811911 GAGTGTGTGGGGAGCTCCCCTGG - Intronic
1062303742 9:135890202-135890224 ATGTGTGTGGAGCATTCCACAGG - Intronic
1062550853 9:137085955-137085977 GCGTGTCTGGAGAGCTCCCCCGG - Intergenic
1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG + Intergenic
1186126716 X:6422324-6422346 ATGCGTGTGGAGCCCTCCCAGGG + Intergenic
1186545494 X:10444931-10444953 AAGTGTGTGAAGCACTGCCCTGG - Intergenic