ID: 900646511

View in Genome Browser
Species Human (GRCh38)
Location 1:3711231-3711253
Sequence AGCTCTGAGTGCAGTGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 2, 2: 2, 3: 21, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900646509_900646511 1 Left 900646509 1:3711207-3711229 CCTGGGGAGCGCTCCACACACGT 0: 1
1: 0
2: 0
3: 4
4: 64
Right 900646511 1:3711231-3711253 AGCTCTGAGTGCAGTGCTGATGG 0: 1
1: 2
2: 2
3: 21
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900646511 Original CRISPR AGCTCTGAGTGCAGTGCTGA TGG Intronic