ID: 900646511

View in Genome Browser
Species Human (GRCh38)
Location 1:3711231-3711253
Sequence AGCTCTGAGTGCAGTGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 2, 2: 2, 3: 21, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900646509_900646511 1 Left 900646509 1:3711207-3711229 CCTGGGGAGCGCTCCACACACGT 0: 1
1: 0
2: 0
3: 4
4: 64
Right 900646511 1:3711231-3711253 AGCTCTGAGTGCAGTGCTGATGG 0: 1
1: 2
2: 2
3: 21
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900646511 Original CRISPR AGCTCTGAGTGCAGTGCTGA TGG Intronic
900342820 1:2196892-2196914 AGCTCTCTGTGCCGTGCTGGGGG + Intronic
900580496 1:3406229-3406251 AGCTCTGGGTGCAGCGGTGTGGG + Intronic
900646511 1:3711231-3711253 AGCTCTGAGTGCAGTGCTGATGG + Intronic
900767981 1:4518227-4518249 AGCTCTGTGTCCACTGCTAATGG + Intergenic
900938294 1:5780906-5780928 AGCTCTGCTTGCAGTGGGGATGG - Intergenic
901012380 1:6209108-6209130 GGCTCTGCGTGCAGCGCTGCGGG - Exonic
901773152 1:11541259-11541281 ACCTCTGGCTGCAGGGCTGAGGG + Intergenic
902770283 1:18641825-18641847 AGCTCCGAGAGCAGCGCAGATGG - Intronic
903688106 1:25147360-25147382 AGTTCTGAGAGCAGAGGTGATGG + Intergenic
903915982 1:26764699-26764721 ACCTCTGGGTGCTATGCTGAGGG + Intronic
904976555 1:34461225-34461247 TGCTCTGACAGGAGTGCTGACGG - Intergenic
907046530 1:51303256-51303278 AGCTGTGTGGGCAGTGCTGCCGG + Intronic
907600121 1:55760642-55760664 AGCTCAGACTGCTGTGCTGGTGG - Intergenic
909206446 1:72763807-72763829 AACTCTGTGTGCAGTCATGAAGG + Intergenic
909820094 1:80051012-80051034 CGCTGTGAGTGCAGGCCTGAAGG + Intergenic
912169496 1:107081392-107081414 ATCTCTGTGTACAGTGATGAAGG + Intergenic
912366597 1:109138735-109138757 AGCTCTGAGTGTCCTGCTAAAGG + Intronic
913533411 1:119749125-119749147 TGCTGTCAGTGCAGTGCTCATGG - Intronic
914515288 1:148369098-148369120 AGCTAAGAATGCAGTTCTGAAGG - Intergenic
915731010 1:158054442-158054464 AGCTTTGAGTAAAGTGCTGATGG + Intronic
917487356 1:175467170-175467192 AGCTCTGAGTGCAGGACTCTAGG - Intronic
919432727 1:197517048-197517070 AGCTCTGAGTGTAGTGGTGCAGG - Intronic
920329927 1:205199631-205199653 AGCTCTGACTGGAGTGCCGTGGG - Intronic
923300520 1:232636245-232636267 AGGTCTTTCTGCAGTGCTGATGG + Intergenic
1062893296 10:1082795-1082817 GGCTCTGACTGCACTGCTGCTGG - Intronic
1065618261 10:27551154-27551176 TGCTCTGGGTGCACTGCCGATGG + Intergenic
1066217188 10:33299304-33299326 TGCTCAGCCTGCAGTGCTGATGG - Intronic
1067144824 10:43687510-43687532 AGCTCTGAGCAGAGAGCTGAAGG + Intergenic
1067270733 10:44789326-44789348 AGCTGGCAGTGCTGTGCTGAGGG - Intergenic
1067435167 10:46272061-46272083 AGGTCTGGGTGCAGGGCTGGGGG - Intergenic
1067661685 10:48240843-48240865 AGGTGTGAGTGCAGTGATAAGGG - Intronic
1071483008 10:86079013-86079035 GTTTCTGAGTGCTGTGCTGACGG - Intronic
1072554860 10:96507014-96507036 TGCTCTGGGGGCTGTGCTGAGGG + Intronic
1072574842 10:96690170-96690192 AACTCTGAGTTCAGTGTTGGAGG + Intronic
1073112258 10:101069806-101069828 TTCTCTGAGGGCAGTGATGAGGG + Intergenic
1074180567 10:111059389-111059411 AGATTTGACTGGAGTGCTGAAGG + Intergenic
1074291292 10:112139761-112139783 AGCACTGAGTGCAGTGAACAGGG + Intergenic
1074502688 10:114041406-114041428 AGTTCTGAGTGCTGAGCTGCAGG - Intergenic
1074874507 10:117603384-117603406 GGTCCTGAGTGCAGGGCTGAGGG + Intergenic
1074875691 10:117611474-117611496 ACCTCTGAGTACATTGCAGAGGG - Intergenic
1074910661 10:117905678-117905700 AGCTCTGTCTGCAGTGGAGATGG - Intergenic
1075104188 10:119526870-119526892 ACCTCCGAGAGCAGGGCTGATGG - Intronic
1076521498 10:131084214-131084236 GGCTCTGAGTGCAGTGTGGTGGG + Intergenic
1077208571 11:1356112-1356134 AGCTCCGAGTGCCGTGGTGACGG - Intergenic
1079021351 11:16911729-16911751 AGCTCTGAGTGAATTGAGGATGG - Intronic
1081810874 11:45913574-45913596 GGCACTGAGGGCAGGGCTGAGGG - Intronic
1083059585 11:59855983-59856005 AACTCTGAATACAGTGCTCACGG - Exonic
1083740220 11:64706024-64706046 AGCTGGGAGTGAAGTGCAGAGGG - Intronic
1084543745 11:69803357-69803379 GGCTCAGATTGCAGGGCTGAAGG - Intergenic
1085766879 11:79291084-79291106 GGCTCTGGGTGGAGTGGTGATGG + Intronic
1086846692 11:91758566-91758588 ATCTATGAGTGTAGTGATGAGGG - Intergenic
1088678130 11:112216064-112216086 AGTGCTGAGCCCAGTGCTGAAGG - Intronic
1089110394 11:116051277-116051299 AACTCTAAGTGCAGTGCAGATGG - Intergenic
1089327285 11:117666038-117666060 AGCTCTGACCGCAGTGATGGAGG - Intronic
1090842326 11:130501986-130502008 AGCACTCAGTATAGTGCTGAAGG - Intergenic
1091316276 11:134616140-134616162 AGCTCTGTGATCACTGCTGAGGG + Intergenic
1092082258 12:5726005-5726027 AGCTCTAAGTTGAGTGCAGATGG - Intronic
1092959510 12:13582654-13582676 AGCTCTGGATGCTGTGCTGCTGG + Intronic
1094057710 12:26283641-26283663 AGCTATGACTGCATTGGTGAGGG + Intronic
1094359845 12:29618629-29618651 AGCTGTAAGTGCAGTGCCCAAGG - Intronic
1096493815 12:52027581-52027603 TGCTCTGAGTCCTGTGCTAAGGG + Intronic
1097018542 12:56004249-56004271 AGCCCAGCGTGCAGTGCTGATGG - Exonic
1098571960 12:71997914-71997936 AGTTCTGAGTTCAGTGTTGGAGG + Intronic
1099166883 12:79317797-79317819 AGGACTGAGTGCACTGCTGTGGG + Intronic
1101969920 12:109305831-109305853 ACCTCTGGATCCAGTGCTGATGG + Intronic
1102529399 12:113534981-113535003 AGGCCTGAGTGCAGAGCTGCGGG + Intergenic
1111665916 13:91267554-91267576 TGGCCTGAGTGGAGTGCTGAGGG - Intergenic
1112586308 13:100721743-100721765 AGGTCTGTGTGCACTGCTGCAGG - Intergenic
1115308457 14:31956137-31956159 AGCTCTCTGTGCAGGCCTGAAGG + Intergenic
1115533254 14:34346086-34346108 TGCTCTGAGTGCAGGGCCCATGG + Intronic
1118373196 14:65154966-65154988 AGCTCTGTGTGTAATGATGATGG - Intergenic
1122097403 14:99381747-99381769 AGCTCTGGGTGCTGAGCAGAGGG - Intergenic
1122454178 14:101836981-101837003 ATCAGTGAGTGCAGTGCTGGTGG + Intronic
1124685080 15:31775896-31775918 AGCTTTGAATGCACTGCTGCTGG - Intronic
1126072937 15:44882002-44882024 ATCTCTGAGGGAATTGCTGATGG - Intergenic
1126085315 15:45005646-45005668 ATCTCTGAGGGAATTGCTGATGG + Intergenic
1126559742 15:50030389-50030411 AGATTTGAGTTCAGAGCTGAGGG + Intronic
1127814134 15:62591794-62591816 AGCTCAGAGTTCCGAGCTGATGG + Intronic
1128729045 15:70008148-70008170 ACCTCTGACTGCAGACCTGATGG - Intergenic
1131472617 15:92709920-92709942 ACCACTGAGTGCAGGGCTCACGG + Intronic
1132415172 15:101614222-101614244 CGCTCTGAGTGCACGGGTGACGG + Intergenic
1133972203 16:10576575-10576597 AACTCTGGGTCCAGAGCTGAGGG - Intronic
1135818068 16:25654240-25654262 AGCTCAGAGTTCAGTGGGGAAGG - Intergenic
1138008631 16:53358709-53358731 AGCTCTGAGAGCTGTGTTTAGGG + Intergenic
1138550955 16:57748217-57748239 AGCTCTACCTGCTGTGCTGATGG - Intronic
1138786288 16:59850511-59850533 AGCTCTGAGTTCTGTGCAGATGG - Intergenic
1139951820 16:70676146-70676168 AGCACAGAGTGAAGTGCTGGTGG - Intronic
1140052753 16:71497225-71497247 AGATCTGATTCCAGTGCTGAAGG - Intronic
1141440927 16:84029149-84029171 AGGTCTGACTGCAGTCCTGTGGG + Intronic
1143761027 17:9104515-9104537 AGCTGTGAGGGCAGAGCAGAGGG + Intronic
1144038970 17:11391613-11391635 AGCTCAGACTGCAGAGCTGAAGG + Intronic
1147174679 17:38647338-38647360 AGGTTGGAGTGCAGTGGTGATGG - Intergenic
1150847221 17:68671551-68671573 AGCTCAGGGTACAGTGGTGAGGG - Intergenic
1152259756 17:79260574-79260596 AACTCTGAGGGCAGCACTGATGG + Intronic
1152672205 17:81615581-81615603 AGCTCTGAGTTCTGTGTTGCTGG - Intronic
1153562244 18:6383187-6383209 ACCTCAGACTGCTGTGCTGACGG + Intronic
1153719087 18:7883634-7883656 AGCTGTGAGTTAAGTCCTGATGG + Intronic
1153819205 18:8818661-8818683 AACTCTGAGTGTTGTGCTCATGG - Intronic
1154311028 18:13266289-13266311 AGCTGTGAATGCAGGGCTGGAGG - Intronic
1156641456 18:39105548-39105570 TGCTCTGAGTGAAGCACTGACGG + Intergenic
1157533882 18:48444433-48444455 AGCTCTGAATGCAGTTCTCCAGG - Intergenic
1157534519 18:48448541-48448563 AGCTCTGAGGGAAGTGCTCCCGG - Intergenic
1158124781 18:54088940-54088962 AGGTCTGAGTGCAGTGGGCAGGG + Intergenic
1158288698 18:55914631-55914653 ATCGATGAATGCAGTGCTGAAGG - Intergenic
1159977035 18:74726822-74726844 AGTACTGAGTGCAGTGCTTTGGG + Intronic
1159994904 18:74955121-74955143 AACCCTGAGGGTAGTGCTGAGGG + Intronic
1160731251 19:642617-642639 AGCTCTGAGGGCCGGGCTGGGGG + Intronic
1160731279 19:642699-642721 AGCTCTGAGGGCCGGGCTGGGGG + Intronic
1163323696 19:16589331-16589353 TGCTCTGAGTGCATTTCTGTAGG - Intronic
1165863137 19:38919648-38919670 AGCTCTGAGAGCAGTGACTAGGG + Intronic
1165938342 19:39403027-39403049 AGATCTGAGGGGAGGGCTGAGGG + Intergenic
1166406843 19:42527646-42527668 AGATCTGAGGGCAGTGGGGAGGG - Intronic
1166456710 19:42947756-42947778 AGCTCTTTGTGTATTGCTGATGG + Intronic
1166472800 19:43094706-43094728 AGCTCTTTGTGTATTGCTGATGG + Intronic
1166493576 19:43281682-43281704 AGCTCTTTGTGTATTGCTGATGG + Intergenic
1167155352 19:47735238-47735260 AGCTCTGAGTCCTGAGCTGGAGG + Intronic
925121490 2:1421930-1421952 AGCTCTGACGGCTGTGCTGGGGG + Intronic
925435361 2:3832740-3832762 AGCACTGAGCGCAGGGCTCAAGG + Intronic
925666590 2:6263338-6263360 ATCTCTGTGTGTAGTGTTGATGG + Intergenic
925967877 2:9083314-9083336 TGGTTTGAGTGCAGTGATGAAGG + Intergenic
926156980 2:10461269-10461291 GGCTCTCAGTGCCGTGCTCATGG + Intergenic
926220273 2:10931667-10931689 AGCTCTGAGCGGAGAGCTGGTGG + Intergenic
927477263 2:23423380-23423402 AGCTCTCAGGGCAGGGCGGAAGG - Intronic
927828792 2:26330239-26330261 ATCTCTTAGTGCAGTTCTGCTGG + Intronic
928220902 2:29401999-29402021 AGCTCTGAGGGCCGGGCTGGTGG + Intronic
928378742 2:30800425-30800447 AGCTCAGAGAGCTCTGCTGATGG + Intronic
928590467 2:32809553-32809575 AGCTCTGATGCCAGTGCTGTCGG + Intronic
929671729 2:43881181-43881203 GGCTCTGTATGCCGTGCTGAAGG + Intergenic
931941062 2:67252849-67252871 AGCTCTGGGTGCACTGCTCCAGG - Intergenic
933714927 2:85352844-85352866 AGGTCTGGGGGCAGTGCTGAGGG + Intronic
933719194 2:85386305-85386327 AGGTCTGAGGGAACTGCTGAAGG + Intronic
933939337 2:87232529-87232551 AGCTCTGAGGGGAGGGCAGAAGG - Intergenic
934652282 2:96099490-96099512 AGCCCTGAGTGCTATGCAGAGGG - Intergenic
934724147 2:96604305-96604327 GGCACTGGGTGCAGTGCTGCTGG + Exonic
934884313 2:98011139-98011161 GGCTCTGGGTGTACTGCTGAGGG + Intergenic
934974897 2:98794651-98794673 AGCTCAGTCTGCAGTGATGATGG - Exonic
936353796 2:111733249-111733271 AGCTCTGAGGGGAGGGCAGAAGG + Intergenic
940369333 2:152882719-152882741 AGATCTGGGTGCAATGCTGTTGG + Intergenic
942045816 2:172098980-172099002 AGCTCTCAGTTCAGTCCCGAAGG + Intergenic
942737008 2:179125880-179125902 AGCTCTGAGGGCAGAGCATAGGG - Intronic
943223415 2:185139241-185139263 AACTCTGAGTGGAATGCTGATGG - Intergenic
945599240 2:211837963-211837985 AGCTCTGTGGCCCGTGCTGAGGG + Intronic
945866824 2:215185335-215185357 GGCTCTGAGTTCTGAGCTGAAGG - Intergenic
946332785 2:219019617-219019639 AGCTCCATGGGCAGTGCTGAGGG - Exonic
948487648 2:238291059-238291081 AGCTCTGAGCTCCGTGCTGGAGG - Intergenic
948603292 2:239119617-239119639 AGCTCAGAGCTCAGGGCTGAGGG + Intronic
948870257 2:240794217-240794239 AAATCTGAGTGAAGGGCTGAGGG - Intronic
1168829415 20:836818-836840 AGCACTTTGTGCACTGCTGATGG - Intronic
1170916202 20:20628502-20628524 AGCTCTGTTTGCTGTGTTGAAGG + Intronic
1171978915 20:31613075-31613097 AGCTCTGACTGCAGTTCCCAAGG - Intergenic
1172619083 20:36307607-36307629 AGCTTGGAGGGCAGCGCTGATGG + Intronic
1172636309 20:36412262-36412284 AGCTCTGACTGCAGGGCAGGCGG - Intronic
1172714395 20:36951916-36951938 AGAACTGAGGGCAGTGCTGGTGG + Intergenic
1174303758 20:49600694-49600716 AGCTCTGAGAGCAGAGGGGAGGG - Intergenic
1176219161 20:63961894-63961916 AGCTCTGAGTGCAGCGCACCTGG + Intronic
1178615193 21:34126936-34126958 ACCTCTGTGTGCAGTGGTGGGGG + Intronic
1179028842 21:37702598-37702620 ATCTTTGAGTGCAGAGCTCAGGG + Intronic
1180983442 22:19890535-19890557 ATCCCTGAGAGCAGTCCTGATGG + Intronic
1181257607 22:21573957-21573979 GTCACTGAGGGCAGTGCTGATGG + Intronic
1181385461 22:22542132-22542154 AATTCTCAGTCCAGTGCTGAAGG + Intergenic
1181493767 22:23276584-23276606 AGCTCTGAGTGAAGGGGTGCTGG - Intronic
1182051785 22:27317826-27317848 AGGCCTAAGTGGAGTGCTGAGGG - Intergenic
1183360273 22:37379705-37379727 TGCTCTGAGGGCAGAGCTGGTGG + Intronic
1184200934 22:42968860-42968882 AGCTCTCAGTCCAGTGCTGAAGG - Intronic
949793645 3:7822619-7822641 AGATTTGACTGGAGTGCTGAAGG + Intergenic
950006490 3:9694855-9694877 AGCTCTGGGTGCTGTGAAGAGGG + Intronic
950721653 3:14887217-14887239 AGCTCAGAGTTTAGTGATGAAGG - Intronic
953132332 3:40152115-40152137 AGCTAAGAGAGCAGTGCCGAAGG + Intronic
954859212 3:53673618-53673640 ACCTCTCAGTGCTTTGCTGAAGG - Intronic
955181652 3:56677393-56677415 AGCTCTTAGTACAGTATTGAAGG - Intronic
955516347 3:59730128-59730150 AGCTTTGAGTGCAGTGCTACAGG + Intergenic
956586839 3:70874343-70874365 AGCTCTGAGTGCGGTACAGTTGG + Intergenic
957971914 3:87392819-87392841 TGCTGTCAGTGCAGTACTGAAGG - Intergenic
958193828 3:90217642-90217664 AGCTTTGACTGGTGTGCTGATGG - Intergenic
960544069 3:118891812-118891834 AGCTCTGACTGTAGAGCTGAAGG + Intergenic
960585364 3:119316312-119316334 ATCTCCCAGTGCAGTACTGAGGG + Intronic
961318081 3:126054246-126054268 ACCTCTGACTCCAGTGCTGTGGG - Intronic
961410699 3:126718185-126718207 AGCACTTAGAACAGTGCTGATGG + Intronic
961834892 3:129649462-129649484 TGCTCTGGGTGCAGTTTTGAGGG + Exonic
962622815 3:137196689-137196711 AACTCAGAGGGCAGAGCTGAGGG - Intergenic
963572967 3:147020573-147020595 AGCTAGAAGTGCAGTGGTGAGGG - Intergenic
964620354 3:158715053-158715075 TGCTCTGTGTGCAGTGCTCTCGG - Intronic
965503142 3:169480304-169480326 AACTCAGATTGCAGTGTTGAAGG - Intronic
966733338 3:183168646-183168668 ACCTCTTAGGGCAGTGCAGAAGG - Intergenic
969307286 4:6333135-6333157 ACCTCTGCGTGCACTGCTTACGG + Intronic
971238802 4:24868823-24868845 AGCTCTGAGTGGACTGCAGAGGG + Intronic
973134245 4:46686317-46686339 GGCTGTGAGAGCAGTGATGAAGG - Intergenic
973149340 4:46867606-46867628 TGCTCTGAGTGCACTGCCTATGG + Intronic
974070049 4:57115073-57115095 AGCTCTGGGTGCAGTGTGCAAGG - Intergenic
976367557 4:84247160-84247182 AGGGCTGAATGCAGTCCTGAGGG + Intergenic
977767826 4:100821412-100821434 AGTTTTGAGTGATGTGCTGAAGG - Intronic
977997105 4:103507929-103507951 AGCTCTGATTGCAGGGGTCAGGG + Intergenic
978763954 4:112385138-112385160 AGCTTTGAATGCAGGGCTCAGGG - Intronic
979570599 4:122219424-122219446 AGCTCTGGGTGGACTGCTGTTGG + Exonic
982813166 4:159852334-159852356 AGCTCTTATTGCAGAGGTGAGGG + Intergenic
983842476 4:172474206-172474228 AGGTCTGAGTGGAGTTGTGATGG - Intronic
984919897 4:184754432-184754454 AGCCCTGTGTTCAGTGCTAAGGG + Intergenic
985577227 5:679016-679038 AGCTCTCAGTGCAGTGCTGACGG - Intronic
985585132 5:727635-727657 AGATCTGAGTCTAGTGCTTATGG + Intronic
985592144 5:771066-771088 AGCTCTCAGTGCAGTGCTGACGG - Intergenic
985598635 5:811950-811972 AGATCTGAGTCTAGTGCTTATGG + Intronic
987416850 5:17671019-17671041 AGGGCTGAGTGCAGTCCTGGGGG + Intergenic
987486013 5:18527253-18527275 TGCTCTGAATGTAGTGCTGCTGG - Intergenic
988674167 5:33414317-33414339 AGATCTGAGTCCAGTGCAGAGGG + Intergenic
991206078 5:64051494-64051516 AGCTCTGAGATCACTGCTGGAGG - Intergenic
991980321 5:72223823-72223845 TGTGCTGGGTGCAGTGCTGAAGG - Exonic
997062722 5:130526304-130526326 ACTTCTGAGGGCAGGGCTGAAGG - Intergenic
997251473 5:132391952-132391974 ATCTCTCTGTGCTGTGCTGATGG - Intronic
997855467 5:137368779-137368801 AGTCCTGTGTGCAGTGGTGAAGG - Intronic
998161478 5:139815051-139815073 AGCCCTGTGAGCAGTGCTGCAGG - Intronic
999180334 5:149665651-149665673 AGCTCTAAGTGTAGTTCTGCAGG - Intergenic
999419382 5:151427744-151427766 AGATCTGAGTGCTGTGATTAGGG - Intergenic
999457686 5:151731507-151731529 AGGCCAAAGTGCAGTGCTGAGGG - Intergenic
1001727649 5:173920128-173920150 AGAACTGAGTGCAGTGGTGTAGG - Intronic
1002965927 6:1966556-1966578 AGCCCTGGGCTCAGTGCTGAGGG + Intronic
1003442620 6:6158083-6158105 AGCTATGGGAGCAGGGCTGAAGG + Intronic
1004408822 6:15361318-15361340 AGCACTGACTGCAGTGTTGAGGG - Intronic
1005320373 6:24646919-24646941 AGGTATAAGTGCAGTGCTTAGGG + Intergenic
1006092479 6:31636246-31636268 AACCCAGAGAGCAGTGCTGAGGG - Exonic
1006503802 6:34475228-34475250 AGCTCTGTGGGCAGGGGTGAGGG - Intronic
1007487124 6:42188677-42188699 AGCTCTGAATCTCGTGCTGAGGG - Exonic
1008254052 6:49275517-49275539 TGCTCTGAGTGCAGGGCCCACGG - Intergenic
1010020690 6:71156347-71156369 ATCTCTGAGTCCAGTGATGGTGG - Intergenic
1012856980 6:104513637-104513659 AGCTCTTAGTGGAATGCTCATGG - Intergenic
1016537379 6:145124083-145124105 TGCAATGAGTGCACTGCTGAAGG + Intergenic
1017228662 6:152048614-152048636 GGCACTGAGTTCAGTGCTGAAGG - Intronic
1017767077 6:157615715-157615737 AGCTCTGAGTGAAGTTCCTAGGG - Intronic
1018295969 6:162344533-162344555 AGCTGTGAGGGCAGTGATGGGGG - Intronic
1018919892 6:168164858-168164880 AGCTGGGAGTGCAGTGCTGAAGG - Intergenic
1019005336 6:168792052-168792074 AGCTCCGCGTCCAGTGCTGATGG + Intergenic
1019015229 6:168875412-168875434 AGCTCTGTGAACAGTGGTGACGG + Intergenic
1019015251 6:168875523-168875545 AGCTCTGTGAACAGTGGTGATGG + Intergenic
1019015272 6:168875636-168875658 AGCTCTGTGAACAGTGGTGACGG + Intergenic
1019015311 6:168875858-168875880 AGCTCTGTGAACAGTGGTGACGG + Intergenic
1019015324 6:168875915-168875937 AGCTCTGTGAACAGTGGTGACGG + Intergenic
1019935041 7:4249316-4249338 AGCTCTGAGAGCAGGACTGGTGG - Intronic
1020749829 7:12126382-12126404 AGCTCTGTGAGCAGGGCAGATGG - Intergenic
1021413872 7:20359448-20359470 AGGTGTCAGTGCAGTGCTGAGGG + Intronic
1022505132 7:30905043-30905065 AGCCCTGAGTGCAGTGAAGAAGG + Intergenic
1023541498 7:41271303-41271325 AGCCCTCAGTACAGTGCTCAGGG + Intergenic
1024233185 7:47378240-47378262 CCCTCTGGGTGCAGAGCTGAGGG + Intronic
1024822157 7:53344405-53344427 AGCTCCAAGTCTAGTGCTGAAGG - Intergenic
1024920640 7:54550321-54550343 AGCTCTGAGTGAATTGGTGCAGG - Intronic
1026469387 7:70681910-70681932 AGATATGAGTGCTTTGCTGACGG - Intronic
1028789177 7:94834249-94834271 AGCTCTGGGTGCAGTCCTCCTGG + Intergenic
1030280234 7:107766802-107766824 AGATCTTAGTGCAGTCCTGTTGG + Intronic
1030899923 7:115110593-115110615 ATCTCTGGGGGCAGTGATGAAGG + Intergenic
1031949847 7:127881053-127881075 AGTTCTGAGGGCAGCTCTGAGGG + Intronic
1033260869 7:139842981-139843003 GGGTCTGTGTGCAGTGCTCAGGG - Intronic
1034867041 7:154650576-154650598 TCCTCTGAGTGCTGTGCTGTTGG - Intronic
1035365811 7:158348938-158348960 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365826 7:158348988-158349010 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365841 7:158349038-158349060 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365856 7:158349088-158349110 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365871 7:158349138-158349160 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365900 7:158349239-158349261 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365915 7:158349289-158349311 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365945 7:158349389-158349411 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365960 7:158349439-158349461 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365975 7:158349489-158349511 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365990 7:158349539-158349561 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035366005 7:158349589-158349611 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035366020 7:158349639-158349661 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035366049 7:158349740-158349762 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035366064 7:158349790-158349812 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1036421986 8:8605241-8605263 AGCTTTGGGAGCAGTGCTGTGGG + Intergenic
1036687982 8:10924478-10924500 GGCCCCCAGTGCAGTGCTGACGG - Intronic
1036922273 8:12868957-12868979 ATCTCTGAGAGCAGTCCTCATGG + Intergenic
1039825783 8:41173085-41173107 AGCTCTGAGCTCCGTGTTGATGG + Intergenic
1040019910 8:42731653-42731675 TGCTTTGATTGCAGTGCTGACGG + Exonic
1040982011 8:53253542-53253564 AGCAATGAGTGCAGAGCTGGAGG + Intergenic
1041332844 8:56747164-56747186 AGCTCAGATTGAAGTGTTGAAGG + Intergenic
1042794056 8:72640540-72640562 AGCACTCAGTCCAGTGCTGCTGG + Intronic
1045040104 8:98215509-98215531 AGCTCTGAGAACAGTGCACAGGG - Intronic
1047789422 8:128187423-128187445 AGCTTTTATTGCAGAGCTGATGG + Intergenic
1048335695 8:133500527-133500549 GGGTCTGAGGGCAGTGATGAGGG + Intronic
1050808461 9:9714711-9714733 AGCTGTGAGTTCTCTGCTGATGG + Intronic
1051248545 9:15136272-15136294 AGCTCTGAGTGCTGGGAGGAGGG - Intergenic
1053350449 9:37410484-37410506 AGGTCTGAGTGCTGGGCAGAGGG + Intergenic
1053442495 9:38127784-38127806 GGCTCTGAGAACAGTGCTGAGGG + Intergenic
1055776523 9:79771922-79771944 AGCTCAGAGTGAAGGGGTGAGGG + Intergenic
1056780062 9:89542648-89542670 TGCTCTGAAAGCAGAGCTGATGG + Intergenic
1059639437 9:116202422-116202444 AGCCATGAGTGCAGTTCTGGAGG - Intronic
1061090142 9:128421522-128421544 AGCCCGGAGCCCAGTGCTGATGG - Intronic
1062092046 9:134683409-134683431 ATCTCTGGGTGCAGTGGTGTGGG - Intronic
1062093213 9:134689388-134689410 ATCTCTGGGTGCAGTGGTGTGGG - Intronic
1062350354 9:136135698-136135720 AGCTCTCAGTCAAGTGCTAAGGG + Intergenic
1062712118 9:137981420-137981442 ATCTCTGAGCCAAGTGCTGAAGG - Intronic
1186726790 X:12366435-12366457 AACTCTGATGGCAGTGCAGAGGG + Intronic
1189294844 X:39910841-39910863 AGCGCTGTGTGCAGAGCTGCAGG + Intergenic
1191993752 X:67067993-67068015 AGCTCTGAGTGTCAGGCTGAAGG - Intergenic
1195676715 X:107512318-107512340 AGCCCTGAGGGCAGAGCTGGTGG + Intergenic
1195866679 X:109439923-109439945 TGCTGTGAGTGGAGTGCTAAGGG - Intronic
1197874607 X:131089937-131089959 AGCTCTGACTAGAGAGCTGAAGG + Intergenic
1199882661 X:151987090-151987112 GGCTCTGAGTGAAATCCTGAGGG + Intergenic
1200166842 X:154041823-154041845 AGCTCTTTGTGCTGTGCCGAGGG - Intronic
1200179155 X:154139982-154140004 AGCTCTGAGTGCAATCCTACGGG - Intergenic
1201748040 Y:17402239-17402261 GGCTGTGAGTGAAGTGCTGCAGG + Intergenic