ID: 900646685

View in Genome Browser
Species Human (GRCh38)
Location 1:3712177-3712199
Sequence TTATATGTGCGTAAAGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900646682_900646685 0 Left 900646682 1:3712154-3712176 CCTTTTACTGGCACCAGAAGCAA 0: 1
1: 0
2: 0
3: 10
4: 177
Right 900646685 1:3712177-3712199 TTATATGTGCGTAAAGCTGAGGG 0: 1
1: 0
2: 1
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900646685 Original CRISPR TTATATGTGCGTAAAGCTGA GGG Intronic
900646685 1:3712177-3712199 TTATATGTGCGTAAAGCTGAGGG + Intronic
902443607 1:16447519-16447541 ATATAAGTGGGTAAAGCAGATGG + Intronic
904506877 1:30964250-30964272 TTATATGTACATATAGCAGAGGG + Intronic
906816233 1:48882379-48882401 TTATACCTTAGTAAAGCTGAGGG - Intronic
909312351 1:74168748-74168770 TTATATGTCAGGAAAACTGAGGG - Intronic
911949373 1:104153465-104153487 TTATGTGTGAGTAGAACTGAGGG + Intergenic
918622993 1:186625963-186625985 TTAGATATGTGTAAAGATGAAGG + Intergenic
918905084 1:190481345-190481367 TTATATGTGCATAAATGTGTGGG - Intergenic
919220503 1:194622371-194622393 TTATAAGAGCCTAAAGATGATGG - Intergenic
921334637 1:214073991-214074013 TTATATGTGCGTAGGCATGAAGG - Intergenic
1065602167 10:27380153-27380175 TTATATCTCAATAAAGCTGATGG + Intergenic
1066189747 10:33045428-33045450 TTATTTGAGCATAAAGCTTAAGG + Intergenic
1068280881 10:54868102-54868124 TTATATCTTAATAAAGCTGAGGG + Intronic
1068942022 10:62689733-62689755 TAATATGAGTGTAAATCTGATGG - Intergenic
1070274222 10:74989427-74989449 TTATTTGTGATTAAAGCTAAAGG + Intronic
1071037941 10:81269865-81269887 ATATATGTACATAAATCTGATGG - Intergenic
1071826783 10:89333467-89333489 TTGTATGTGTGTAAATGTGAAGG + Intronic
1075137596 10:119799112-119799134 TTATATGTGAGTGAATATGAAGG - Intronic
1079166852 11:18052099-18052121 TCCTAGGTGCTTAAAGCTGAAGG + Intergenic
1085902404 11:80717100-80717122 TTATATGAGCATAAAGCTGAAGG + Intergenic
1091382024 12:67859-67881 TGAGATGTGAGAAAAGCTGAAGG + Intronic
1091676108 12:2491378-2491400 TTATAAGTCAATAAAGCTGATGG + Intronic
1091676138 12:2491577-2491599 TTATAAGTCAATAAAGCTGATGG + Intronic
1104199620 12:126575737-126575759 TTATATTTTTGTAAAGATGAGGG + Intergenic
1105743647 13:23355638-23355660 TTATATGTCCGAGAGGCTGACGG - Exonic
1109346729 13:61124153-61124175 TCATAGGAGCGTAAACCTGATGG + Intergenic
1114802629 14:25795375-25795397 ATATATGTGCTTAAAGATCAAGG - Intergenic
1120308530 14:82801389-82801411 TTATATAGGCCTAAAGGTGATGG + Intergenic
1120532351 14:85647375-85647397 TTATATGTGTTTAAAACTCAAGG + Exonic
1126807771 15:52369536-52369558 TTCCATCTGCGTAAAGCTGTTGG + Intronic
1140804473 16:78520438-78520460 AAATATGTGTGTAAAACTGATGG - Intronic
1145833948 17:27939678-27939700 ATACATTTGCATAAAGCTGATGG + Intergenic
1146070152 17:29673103-29673125 ATATATGTGGGAAAAGCTTAAGG + Intronic
1148771982 17:50072602-50072624 TTATATTTGGGTAATGGTGATGG + Intronic
1159874499 18:73795366-73795388 TTATATTTCAGTAAAGCTGAAGG + Intergenic
1165588264 19:36941474-36941496 TTATATGTGCTTAAAGAACAAGG - Intronic
926749588 2:16188077-16188099 TTATATGTGAGTCAAGTTCAGGG - Intergenic
927573294 2:24178863-24178885 TTAGATGTGGTTAAATCTGAAGG + Intronic
929567109 2:42995568-42995590 TTATATTTCAGTAAACCTGATGG - Intergenic
930147670 2:48023875-48023897 TTATATTTGCATAAACCTTAAGG + Intergenic
931655749 2:64510066-64510088 TCATATGTGTATAATGCTGATGG + Intergenic
934791352 2:97064670-97064692 TTGTAAGTGCATAAAACTGAAGG + Intergenic
934815081 2:97317873-97317895 TTGTAAGTGCATAAAACTGAAGG - Intergenic
934822614 2:97390610-97390632 TTGTAAGTGCATAAAACTGAAGG + Intergenic
935100418 2:99989393-99989415 TTGTATGTCCATAAAGCTGATGG - Intronic
941801976 2:169670068-169670090 TTTTTTGTGTGTGAAGCTGATGG + Intronic
944553743 2:200868090-200868112 TTAAATGTGTGTAAAGCTTCTGG - Intergenic
1169696567 20:8394074-8394096 TAATATGTGGGCAATGCTGATGG - Intronic
1175399202 20:58691309-58691331 TTTTATGTCGGGAAAGCTGAGGG + Intronic
1176283177 20:64326974-64326996 TGAGATGTGAGAAAAGCTGAAGG - Intergenic
1176361081 21:5997131-5997153 TTTTATGTGGCTAAGGCTGATGG - Intergenic
1179762437 21:43541419-43541441 TTTTATGTGGCTAAGGCTGATGG + Intronic
1185021153 22:48376987-48377009 TTATCTGTGCGTCAAGCTGTAGG - Intergenic
949618052 3:5777073-5777095 AAATATGTGGGTAAATCTGAAGG - Intergenic
951373494 3:21883733-21883755 TTATATGTGCAGCAATCTGATGG - Intronic
952294957 3:32053316-32053338 TTATATTAGGATAAAGCTGAAGG + Intronic
953496556 3:43392609-43392631 ATATATGTGAGTAAATCTAAGGG + Intronic
958272982 3:91530861-91530883 TGATATGTGCGTTCAACTGATGG - Intergenic
962848061 3:139288271-139288293 GTATATGTGTGTGAACCTGAGGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964700616 3:159561948-159561970 TTATATTTGTGAAAAGCAGAAGG + Intronic
966903566 3:184505643-184505665 TTAGCTGTGGGTAAAGCTAAGGG - Intronic
971581463 4:28346760-28346782 TTTCATGAGCATAAAGCTGATGG + Intergenic
972352872 4:38253151-38253173 TTATATGTGCAAATAGCTCAGGG + Intergenic
973233486 4:47869616-47869638 ATAGATGTGCTTAAAGCTTATGG - Intronic
975447888 4:74488184-74488206 TTATATTTGCAGAAGGCTGAGGG - Intergenic
976405012 4:84653376-84653398 TTATATCTCAGTAAAGCTGTTGG - Intergenic
978100459 4:104833598-104833620 TTATATGGGCCTGAAGCTTAGGG + Intergenic
993334355 5:86638876-86638898 ATGTATGTGTGTAAACCTGAAGG + Intergenic
1006724185 6:36184653-36184675 TTATATCTCAGTAAAGCTGGGGG + Intergenic
1009502591 6:64434405-64434427 TTATGTGTGTGTAAAGCATATGG + Intronic
1013860297 6:114627572-114627594 TAACATTTGCATAAAGCTGAGGG + Intergenic
1015961830 6:138658143-138658165 TTATACCTCAGTAAAGCTGAGGG - Intronic
1016121119 6:140341911-140341933 TTCTATGTTGGTAAAGCAGAAGG + Intergenic
1018404749 6:163467295-163467317 TTATATCTCAGTAAAGCTGGAGG + Intronic
1023145058 7:37142867-37142889 CTATATGTTAGTGAAGCTGATGG + Intronic
1024798828 7:53052022-53052044 TCATATGTGAGTATAGCTGTAGG + Intergenic
1024957464 7:54938745-54938767 TTATTTGTAAGTAAAGATGAAGG - Intergenic
1027378059 7:77574109-77574131 TTATATGTTAGTCAAGGTGATGG + Intronic
1027943046 7:84709096-84709118 TTAGATTTGCATAAAGCTAAAGG - Intergenic
1028311727 7:89346524-89346546 TTATATTTGCAAAAAGCTGGGGG - Intergenic
1030830788 7:114218360-114218382 TTTTCTGGGGGTAAAGCTGAGGG - Intronic
1031299378 7:120044348-120044370 TTATATGTGAGTAATTTTGAAGG - Intergenic
1037441069 8:18916860-18916882 TTATATCTTAATAAAGCTGAAGG + Intronic
1038253784 8:25931285-25931307 TTATATGTGCTTAAAGATTGAGG - Intronic
1047695313 8:127397544-127397566 TTACAAGTGAGTAAAACTGAGGG + Intergenic
1048394345 8:133999776-133999798 TTATGTCTCAGTAAAGCTGAGGG + Intergenic
1050762517 9:9089814-9089836 TAATATGTGGGGAAAGCAGAAGG + Intronic
1052036685 9:23689770-23689792 TTATCTGTGCAAAAAGCTGAAGG + Intergenic
1056548545 9:87633340-87633362 GTATATGTGCGTATGGGTGAGGG + Intronic
1057315203 9:93963914-93963936 TTATACTTCAGTAAAGCTGAGGG + Intergenic
1057773861 9:97989522-97989544 TCATTTGTGCTTAAATCTGAGGG - Intronic
1059887703 9:118765190-118765212 TGAAATGTGCAGAAAGCTGAAGG - Intergenic
1060393173 9:123296259-123296281 TTATAAGAGGGTAAGGCTGAAGG - Intergenic
1062402485 9:136378635-136378657 TCCTATGTGCGTCAGGCTGAGGG + Exonic
1189092144 X:38095104-38095126 TTATATATGCATAAAGCCTAAGG + Intronic
1194730670 X:97450178-97450200 TTATATGTGCTCACAGCTGGTGG - Intronic
1198095287 X:133374115-133374137 TTATATATCAGTAAAGCTGGGGG + Intronic