ID: 900647268

View in Genome Browser
Species Human (GRCh38)
Location 1:3714604-3714626
Sequence CTGGCCTCTCCTCCGGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 421}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900647268_900647279 27 Left 900647268 1:3714604-3714626 CCAGAGGCCGGAGGAGAGGCCAG 0: 1
1: 0
2: 6
3: 57
4: 421
Right 900647279 1:3714654-3714676 CGCTGTCAAAAAGCAAGTTGCGG 0: 1
1: 0
2: 0
3: 5
4: 83
900647268_900647272 -9 Left 900647268 1:3714604-3714626 CCAGAGGCCGGAGGAGAGGCCAG 0: 1
1: 0
2: 6
3: 57
4: 421
Right 900647272 1:3714618-3714640 AGAGGCCAGGCTACTGGCAACGG 0: 1
1: 0
2: 1
3: 19
4: 238
900647268_900647275 4 Left 900647268 1:3714604-3714626 CCAGAGGCCGGAGGAGAGGCCAG 0: 1
1: 0
2: 6
3: 57
4: 421
Right 900647275 1:3714631-3714653 CTGGCAACGGGCCCTCCAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 117
900647268_900647280 28 Left 900647268 1:3714604-3714626 CCAGAGGCCGGAGGAGAGGCCAG 0: 1
1: 0
2: 6
3: 57
4: 421
Right 900647280 1:3714655-3714677 GCTGTCAAAAAGCAAGTTGCGGG 0: 1
1: 0
2: 2
3: 20
4: 179
900647268_900647273 -8 Left 900647268 1:3714604-3714626 CCAGAGGCCGGAGGAGAGGCCAG 0: 1
1: 0
2: 6
3: 57
4: 421
Right 900647273 1:3714619-3714641 GAGGCCAGGCTACTGGCAACGGG 0: 1
1: 0
2: 0
3: 14
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900647268 Original CRISPR CTGGCCTCTCCTCCGGCCTC TGG (reversed) Intronic
900537601 1:3186560-3186582 CTGGCCGCGCCTCCCGCCTCGGG - Intronic
900647268 1:3714604-3714626 CTGGCCTCTCCTCCGGCCTCTGG - Intronic
900794141 1:4697882-4697904 CTTGCTTCTCCTCCGGCCACTGG - Intronic
900988588 1:6087176-6087198 AAGGCATCTCCTCCGGACTCCGG + Intronic
900988877 1:6088817-6088839 CAGGCCTCTCCCTGGGCCTCTGG + Intronic
901772938 1:11539935-11539957 CTTCCCTCCCCGCCGGCCTCTGG + Intergenic
901811085 1:11767019-11767041 CTGTCCTCTCCTCCTCCCTGTGG - Exonic
902110772 1:14076409-14076431 CTTGCCTCTCCCCCAGCTTCTGG - Intergenic
902539333 1:17141759-17141781 CTCCCCTCTCCTCCAGCCCCAGG - Intergenic
902662639 1:17915841-17915863 CTGGACCCTCCTTCCGCCTCTGG + Intergenic
902870785 1:19312435-19312457 CAGCCCTCTCCTCCGGCCGCTGG + Exonic
903240725 1:21981016-21981038 CTGACCTCACCTCCGCCCGCAGG + Exonic
903353781 1:22734021-22734043 AGGGCCACTCCTGCGGCCTCTGG - Intronic
903659803 1:24970088-24970110 CAGTCCTCACCTCCTGCCTCGGG + Intergenic
904049706 1:27631872-27631894 CCGGCTTCTCCTCCAGGCTCTGG + Intronic
904470788 1:30734806-30734828 CTGGCCTCTTCTCAGGTATCAGG - Intronic
904677655 1:32208174-32208196 CTGGCTTCTGCTCCTGCCCCTGG + Exonic
904770292 1:32877444-32877466 CTGGCCCAGCCTCTGGCCTCAGG + Intergenic
906072721 1:43028924-43028946 CTCGCCTCTCCTCCGGTCCTTGG - Intergenic
907305256 1:53509586-53509608 CTGGCCTCTCCTCAGGGCAGCGG + Intronic
907371943 1:54009495-54009517 CTCTCCTCTGCTCAGGCCTCCGG + Intronic
907491854 1:54813668-54813690 CTGGCCCGGCCTCCGGCCTCCGG + Intronic
908010629 1:59773580-59773602 CCAGCCTCTGCTCTGGCCTCTGG + Intergenic
911981155 1:104568650-104568672 ATGGCCTCTCCTCTGGCCCAGGG - Intergenic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
912723724 1:112041337-112041359 CTAGCCTCATCTCTGGCCTCTGG + Intergenic
915470633 1:156123785-156123807 GTGCCCTGGCCTCCGGCCTCAGG + Intronic
917285287 1:173416424-173416446 CTTCCCTCTCCTCTGCCCTCTGG - Intergenic
917437442 1:175035609-175035631 CGGGCTTCACCTCTGGCCTCTGG - Intergenic
920664903 1:207956130-207956152 CTGGCCTCTGCCAGGGCCTCAGG + Intergenic
921653991 1:217712554-217712576 CTGCCCCCTCCTCCAGCCCCAGG + Intronic
922163342 1:223094542-223094564 CTGGCCTCTCCCTTGGCTTCTGG + Intergenic
922416561 1:225427858-225427880 CCGGCCGCTGCGCCGGCCTCGGG + Intronic
922727258 1:227928244-227928266 CTGCCCTCCCCTCTGGCCCCAGG + Intronic
922739424 1:228007013-228007035 CTGGGCCCTCCTGCGGCCGCGGG - Intergenic
922849938 1:228723836-228723858 ATGGCCTCACCTCCTGCCTTAGG + Intergenic
922877631 1:228952520-228952542 CTCCCCTCTACTCTGGCCTCCGG + Intergenic
923205439 1:231754335-231754357 CTGGCATCTGCTCTGGCTTCTGG + Intronic
923462919 1:234222644-234222666 CTGCCCTCTCCTGCAGCCTGAGG - Intronic
1063664252 10:8051988-8052010 CTGCCCTGTGCTCCGGGCTCCGG + Intergenic
1067296441 10:44977632-44977654 CTGGCCCCTCTGCTGGCCTCTGG - Exonic
1067455842 10:46418746-46418768 ATGGCCAGGCCTCCGGCCTCAGG - Intergenic
1067631358 10:47965893-47965915 ATGGCCAGGCCTCCGGCCTCAGG + Intergenic
1067761846 10:49054391-49054413 TTGGCCTCTCCTCCTCCCTTTGG - Intronic
1067839729 10:49666144-49666166 CAGGGCTCTCTTCTGGCCTCAGG + Intergenic
1069081861 10:64097093-64097115 CATGCCTCTCCTCAGGCCTTTGG - Intergenic
1069555474 10:69394928-69394950 CAGGCCCCTCCTCCTGTCTCAGG + Exonic
1069894979 10:71674895-71674917 CTGGCCTCTCCACCGCCACCAGG - Intronic
1070844350 10:79509707-79509729 CTGGCCTGTCCTCTGCTCTCTGG - Intergenic
1070844886 10:79513632-79513654 CTGCCCCCTCCTCAGGCATCTGG + Exonic
1070928918 10:80246675-80246697 CTGCCCCCTCCTCAGGCATCTGG - Intergenic
1070929447 10:80250601-80250623 CTGGCCTGTCCTCTGCTCTCTGG + Intergenic
1071525113 10:86353988-86354010 CTGGCCTCTGGTCTGGGCTCTGG - Intronic
1071601756 10:86961883-86961905 CTGGCCTCAGCACCTGCCTCTGG - Intronic
1072190791 10:93074757-93074779 CTGTCCCCTCCTCGGGACTCAGG + Exonic
1072710897 10:97714853-97714875 CTGGCCCCTCATCCAGCCTCCGG + Exonic
1073292597 10:102420747-102420769 CCGGCCTCTCCTCTGCCCTCTGG - Exonic
1073484244 10:103806569-103806591 ATAGACTCTCCTCCAGCCTCAGG + Intronic
1073764422 10:106666316-106666338 CTGGCCTCTTTTCCTGCCTTCGG + Intronic
1075198241 10:120379531-120379553 CTCGCCTCTCCTCATGCCACTGG + Intergenic
1075838236 10:125474669-125474691 CTGGCTTTTCCTCCTCCCTCTGG + Intergenic
1076159800 10:128234942-128234964 CTGTCCTCTCCTGCAGCCCCAGG - Intergenic
1076567635 10:131409802-131409824 CTGGCCTCTCTCCCGGCTTCCGG - Intergenic
1076634973 10:131875944-131875966 GTGGGGTCTCCTCCGGCCACCGG - Intergenic
1077065470 11:639293-639315 CTGCCCGGTCCTCTGGCCTCTGG + Intronic
1077137585 11:1008902-1008924 CTGGCCTGTCCTCCTGTCTGTGG + Intronic
1077170991 11:1165630-1165652 CTGGCAGCTCCACCGGCCTCCGG - Exonic
1077364948 11:2157892-2157914 TTGCCCTCTCCTGAGGCCTCAGG + Intronic
1077477572 11:2797667-2797689 CTGGCCCCTCCTCCTCCCCCGGG + Intronic
1077553941 11:3217188-3217210 CCGGCCTCTCCTGCGTCCCCAGG - Intergenic
1078059050 11:8031847-8031869 CTGGCCTCTGCTCGGGCCCTGGG + Intronic
1078249801 11:9607634-9607656 CTGGCTTCACTTCCAGCCTCAGG + Intergenic
1078334084 11:10450589-10450611 CTGGCATCTGCTCCGGGCTGCGG + Intronic
1079128705 11:17735510-17735532 CTGGCCTCTAGTCCGGCCCCGGG + Exonic
1081679355 11:44990787-44990809 CTGGCCTCTCCTCTTCCCTCAGG - Intergenic
1081811984 11:45919270-45919292 TTTGCCTCTCCTCAGGCCCCTGG - Intergenic
1083296197 11:61716956-61716978 CTGGGGGCTCCTCCTGCCTCTGG - Intronic
1083658711 11:64242226-64242248 CCGCCCTCTCCCCCGGGCTCCGG - Intronic
1084013909 11:66367691-66367713 CTGGCCTCTCTCAGGGCCTCAGG + Intronic
1084154796 11:67307527-67307549 CCAGCCTCTCCTCCTGTCTCAGG + Exonic
1084485142 11:69443699-69443721 CTGGCCTCTTCCGCAGCCTCTGG - Intergenic
1085348080 11:75780929-75780951 CTGGCCACTCTTCAGGCCCCCGG - Intronic
1085727359 11:78965710-78965732 CTGGTCTCTCCTCTGGCCTCTGG + Intronic
1086437978 11:86800457-86800479 CCCGCCCCGCCTCCGGCCTCGGG - Exonic
1087791194 11:102407731-102407753 CATGCCTCTCCTCTGGCTTCTGG - Intronic
1088964329 11:114702798-114702820 CTGACCTCTCTTCAGTCCTCTGG + Intronic
1089496182 11:118909725-118909747 CTGGCTGCGCCTCCTGCCTCGGG + Intronic
1090237927 11:125163450-125163472 CTGAGCTCTTCTCAGGCCTCTGG - Intergenic
1090445063 11:126757397-126757419 CTGGCCTCAGCTCAGACCTCTGG + Intronic
1090880831 11:130830365-130830387 CTCGCCTGTGCACCGGCCTCAGG + Intergenic
1091284991 11:134403488-134403510 CTGGCATCTGGTCTGGCCTCTGG - Intronic
1091652447 12:2320061-2320083 CTGGCCTCTTCTCCAGCCCCGGG + Intronic
1091949466 12:4580930-4580952 CTGGACTCTCTGCAGGCCTCAGG - Intronic
1092526203 12:9311732-9311754 CTGGCCTCTCTCCTGGCCACAGG - Intergenic
1094511969 12:31102428-31102450 CTGGCCTCTCTCCTGGCCACAGG - Exonic
1094512114 12:31103120-31103142 CTGGCGTCTCCTGCCCCCTCCGG + Intronic
1095734798 12:45545002-45545024 CTGGCTTCTCCTCTGGGCCCTGG - Intergenic
1096543061 12:52319080-52319102 CTGGATACTCCTCCGGGCTCAGG + Intronic
1096675909 12:53225773-53225795 CTCTCCTCTCCTCCTCCCTCTGG - Intronic
1097009203 12:55940480-55940502 CTGCCTTCTCCACGGGCCTCCGG + Intronic
1097041944 12:56161089-56161111 CTGTCCTCTCCTCCCGCCAGTGG + Intronic
1097109242 12:56645920-56645942 GTGGCCGCTGCTCCGGCCTCCGG - Exonic
1097714797 12:62954835-62954857 CTGGGCTCTCCTCTGGCCAAGGG + Intergenic
1098068968 12:66651344-66651366 GATGCCTCTCCTCCAGCCTCAGG - Intronic
1098166404 12:67702876-67702898 CAGGCCTCTCCTCCAGCATTGGG - Intergenic
1098595953 12:72273103-72273125 CTGGCCACCCCACCCGCCTCGGG - Exonic
1100215911 12:92448314-92448336 CTGGCCTCTCCTCCTACTCCTGG + Intergenic
1101533022 12:105591837-105591859 CTGGCCCTTCCTCCATCCTCAGG + Intergenic
1102140970 12:110614361-110614383 CAGGGCCCTCCTCCGGCCCCAGG + Exonic
1102348733 12:112176462-112176484 ATGGCCTCTGCTCTGGGCTCTGG - Intronic
1102876563 12:116453790-116453812 CTGGCGTCTCTTCTGTCCTCTGG + Intergenic
1102962064 12:117099358-117099380 CTGGCCTCGGGTCCGGCCTCGGG + Exonic
1104044369 12:125151491-125151513 CTGGCCTCTCCTCCTGCCGCAGG - Intergenic
1104591210 12:130085801-130085823 CCGGCCTCTCCCCCTGCTTCCGG - Intergenic
1104901099 12:132189889-132189911 CCGGCGCCTCCCCCGGCCTCGGG + Intergenic
1104947322 12:132421915-132421937 CTGGCTTCTCATCCGGTCACAGG - Intergenic
1108409052 13:50129672-50129694 CTGGCCTCGCCTGGGGTCTCTGG + Intronic
1110067034 13:71121382-71121404 CTGCCCTCACCCCCGCCCTCTGG - Intergenic
1110119435 13:71865234-71865256 CTGGCTTCCCCTCCGGGCTTCGG + Intronic
1110328997 13:74249868-74249890 CTGCCCTGTCCCCCAGCCTCAGG - Intergenic
1110626798 13:77662167-77662189 CTGCCCTCACCTCCGTCTTCGGG + Intergenic
1112216725 13:97438386-97438408 CTGGGCTCTCCTTTGGCCTGTGG + Intronic
1112678906 13:101739604-101739626 CTTGTCTCTCCTCCTGCCCCAGG - Intronic
1113075791 13:106466841-106466863 CTCAGCTCTCCTCCTGCCTCTGG + Intergenic
1113271210 13:108676725-108676747 CACGCCTCTCCTCTGGCTTCTGG - Intronic
1113594092 13:111519275-111519297 CTGGCTTCTCCTCCTGCATCTGG + Intergenic
1113595808 13:111530962-111530984 CTGGCCTCTCCACAGACCTGCGG + Intergenic
1113889603 13:113728915-113728937 CTCTCCTCTCCTCCCACCTCTGG - Intronic
1114519033 14:23321554-23321576 CCGGCCTCCCCACCGGCCCCGGG - Exonic
1117801047 14:59445355-59445377 CAGGCCTCTGCTACGACCTCAGG + Intronic
1119264080 14:73253944-73253966 CTGACCTCTCCCCAGGGCTCCGG - Exonic
1122092671 14:99350455-99350477 CTGGCCTCTCCTGTGACCCCAGG + Intergenic
1122187509 14:100012315-100012337 TTGACCTCTTCTCCCGCCTCGGG + Intronic
1122236288 14:100332380-100332402 CTGGTCTCTCCTCCAGGCTGGGG + Intergenic
1122274041 14:100582052-100582074 CTGGCCTATGCTGCGGCCCCTGG - Intronic
1123054461 14:105562447-105562469 CTGACCTCTCCAGTGGCCTCAGG - Intergenic
1123079045 14:105682866-105682888 CTGACCTCTCCAGTGGCCTCAGG - Intergenic
1123127013 14:105953992-105954014 CTGGCCTCTCCTGGGGCCCCAGG + Intergenic
1123407472 15:20029812-20029834 CTGGCCTCTCCTGGGGCCCCAGG + Intergenic
1123516800 15:21036468-21036490 CTGGCCTCTCCTGGGGCCCCAGG + Intergenic
1123787846 15:23690484-23690506 CTGGCCTCTCCTCCTGTTCCTGG - Intergenic
1124064091 15:26323393-26323415 CTGTCCTCTCCTGCAGTCTCAGG - Intergenic
1124105761 15:26736610-26736632 CTGGCCTCTCCTGCGGGAGCTGG - Intronic
1124126427 15:26941733-26941755 CTGGCCTGTCTCCTGGCCTCTGG + Intronic
1124137178 15:27045223-27045245 CTGACCTCTGCTCAGCCCTCTGG - Intronic
1124841849 15:33249491-33249513 CCGGCCTCTCCTTCTGCCTATGG + Intergenic
1125674581 15:41495324-41495346 CTCGCCTCTTCCTCGGCCTCAGG - Intronic
1125730437 15:41890019-41890041 CTGGCCTCACCTCAGACCCCTGG - Intronic
1127393095 15:58522501-58522523 CCGGGCTCACCTCCAGCCTCAGG + Intronic
1128308200 15:66613818-66613840 CTGGCTTCTCTCCCTGCCTCAGG - Intronic
1128524469 15:68403029-68403051 CTCTCCTCTCCCCCTGCCTCAGG - Exonic
1128769949 15:70274475-70274497 CTGGCCCAGCCTCTGGCCTCTGG + Intergenic
1129681023 15:77658327-77658349 CTGGCCTCTCCTCTCCTCTCTGG - Intronic
1130429302 15:83830772-83830794 CTTGCCTCTCTTCCAGCTTCTGG + Intronic
1132067568 15:98744657-98744679 TTGGCCTGTCCTCAGACCTCTGG - Intronic
1132079294 15:98851265-98851287 CAGCCCTCTCCTCCAGCATCTGG - Intronic
1132349696 15:101132230-101132252 CTGGCCTCCCCTCTGCCCTCAGG + Intergenic
1132479388 16:159591-159613 CAGACCTCTCTTCCGGACTCAGG - Intronic
1132566995 16:628119-628141 CTGTCTGCTCCCCCGGCCTCTGG - Exonic
1132687602 16:1168804-1168826 CTCACCCCTCCTCGGGCCTCAGG - Intronic
1132843685 16:1990388-1990410 CCGGCCCCTCCTCCGCCCGCAGG - Intronic
1133021588 16:2969303-2969325 CTGGCGTCCCCTCCCGCGTCCGG + Exonic
1133167283 16:3957285-3957307 CTGGAGCCTCCTCTGGCCTCAGG - Intronic
1133200021 16:4198369-4198391 CTCTCCTCTCCTCCAGCCTGGGG + Intronic
1133239227 16:4404673-4404695 CAGGCCTCTCCTACTGCCTCAGG + Intronic
1133326413 16:4944911-4944933 CTGGCCTCCCCTCTGGCCCCAGG - Intronic
1133809014 16:9146903-9146925 CTGGGCTCACCTCCAGCCTCTGG + Intergenic
1134772320 16:16820475-16820497 CTGGCCTCTACCCCCACCTCAGG + Intergenic
1135527675 16:23226589-23226611 CTGGGCTCTCCTCTGGCCATTGG - Intergenic
1135732579 16:24907122-24907144 CTGGAATCACCTCCGGCCTCGGG + Exonic
1136114560 16:28086672-28086694 CATGCCTCTCCTCCAGACTCAGG - Intergenic
1136318630 16:29468197-29468219 CAGGCCCCTCCTCCCTCCTCTGG - Intergenic
1136433202 16:30207543-30207565 CAGGCCCCTCCTCCCTCCTCTGG - Intronic
1137253625 16:46757925-46757947 CCGGCCTCTCCTCTGTCCTCAGG - Intronic
1137506193 16:49055997-49056019 CATGCCTCTCCTCCAGCCCCAGG - Intergenic
1137636699 16:49993042-49993064 CCGGCCTCCCCTGCGGCCTGCGG - Intergenic
1139506297 16:67399667-67399689 CTTACCCCTCCTGCGGCCTCTGG - Intronic
1139747097 16:69083399-69083421 CTGCCCTCTCCTCCTGCCTGAGG - Intronic
1140455810 16:75104981-75105003 ATGACCTCTCCCCCGACCTCTGG + Intronic
1140479586 16:75255318-75255340 CAGTGCTCACCTCCGGCCTCAGG - Intronic
1140820494 16:78658567-78658589 CGTGCCTCTCCTCCAGCCTCTGG + Intronic
1142311495 16:89316832-89316854 GTGGCCTGTTCTCCGCCCTCCGG - Intronic
1142321454 16:89385821-89385843 CTGGCCTAATCCCCGGCCTCTGG - Intronic
1142395409 16:89828782-89828804 CCGGCCTCACCCGCGGCCTCGGG - Exonic
1142434362 16:90047435-90047457 CTGGGCTCTCCTCCGCGCCCCGG + Intergenic
1142627928 17:1203874-1203896 CTGGTTTCTCCTCCCGCGTCAGG - Intronic
1142941057 17:3380066-3380088 CAGGCCACTCCTCCTGCCTTTGG + Intergenic
1142967670 17:3591386-3591408 CTGGCCTCCCCTCGGCCCTGAGG + Intronic
1143495876 17:7312334-7312356 CTGCCCCCTCCTCAGGCATCTGG + Exonic
1143622421 17:8088105-8088127 CTGGCCTGTCCTTCTGCCCCAGG + Intergenic
1144295782 17:13873670-13873692 CTGGTCTCTCTTCTGGCTTCTGG - Intergenic
1144958628 17:19032614-19032636 CTGGCCCTCCCTCCGCCCTCCGG - Intronic
1144976531 17:19141910-19141932 CTGGCCCTCCCTCCGCCCTCCGG + Intronic
1146920321 17:36705671-36705693 GTGGCCTCTCCTACTGGCTCTGG + Intergenic
1147863962 17:43541017-43541039 CTTGCCTTTCTTCCTGCCTCGGG + Intronic
1148156851 17:45429628-45429650 CTGCGCTCTCCTCCGGCGGCGGG + Intronic
1148215247 17:45830619-45830641 CTGCCCTCTCCTCCAGACTCAGG + Intronic
1148663992 17:49361599-49361621 CCAGCCTCCCCTCAGGCCTCAGG + Intronic
1148688062 17:49511870-49511892 CTGGCCTGTCCTCTGGCTCCAGG + Exonic
1149468196 17:56895765-56895787 TTGTCCTCCCCTCCAGCCTCAGG + Intronic
1149540072 17:57462081-57462103 CAGGCCTCTCCCCTTGCCTCTGG + Intronic
1149604651 17:57916283-57916305 CTGGCCTGCCCTCATGCCTCAGG - Intronic
1150108750 17:62479516-62479538 CCCGTCTCTCCTCCGGCCGCCGG - Intronic
1150294407 17:64000140-64000162 CCGGCCTCACCCCCGGCCCCTGG - Intronic
1150840422 17:68601158-68601180 CTGGCGTCTCCGCCGCCCGCAGG - Exonic
1151154605 17:72115994-72116016 CTGGCCTGAGCTCCGGACTCCGG - Intergenic
1151485041 17:74393758-74393780 CTCTCCTCTCCTCCGACCACTGG - Intergenic
1151572001 17:74931086-74931108 CTGGCGTCTCCACTGGCTTCTGG - Exonic
1151679407 17:75615671-75615693 CTGGCTGCTCCTCCTGCTTCAGG + Intergenic
1151954930 17:77375411-77375433 CTGGCCTCCCCTCCCGCCACAGG - Intronic
1152075831 17:78159015-78159037 CTGCCCCCTCCTCAGGCATCTGG + Intronic
1152724115 17:81936914-81936936 CTGGCCGCTCCTCCCGCAGCCGG + Intronic
1152795791 17:82305517-82305539 CTGCCGTCTCCTCTGGCATCAGG + Intergenic
1152820678 17:82436172-82436194 CTGGCTGCTCCTCCAGCCCCTGG + Intronic
1152836294 17:82534521-82534543 CTGGCCCCTCCTCTAGCCTGAGG - Intronic
1153073942 18:1141424-1141446 CTGGCTTCTCCTCCAGTCTTTGG + Intergenic
1153778833 18:8476869-8476891 CTGGCTTCTCCTCTGGACCCAGG + Intergenic
1156060009 18:33063120-33063142 CAGGCCTGTCCTCAGGCCCCAGG - Intronic
1156149085 18:34222738-34222760 CTGGCCTCCCTCCCCGCCTCGGG - Intronic
1157234889 18:45955073-45955095 CTGGCCTCTCCCCCTTCCTTTGG + Exonic
1157471588 18:47992984-47993006 CTGGCCTCTCCTCTGCACACAGG + Intergenic
1158557503 18:58487351-58487373 CATGCCTCTCCTCTGGCTTCCGG - Intronic
1158629018 18:59096001-59096023 CTTGCCTCTCCCCTGGCTTCTGG - Intergenic
1158841659 18:61394529-61394551 CAGGCCTCTCCTTTGGCTTCTGG - Intronic
1158926117 18:62262921-62262943 CTGGGCTCTCCCCTGGCTTCTGG + Intronic
1160006907 18:75074819-75074841 CTGGCCTCCCTTCTGGCCTGGGG - Intergenic
1160114868 18:76068468-76068490 CCCGCCCCTCCTCCAGCCTCTGG + Intergenic
1160223775 18:76996991-76997013 TTGGCCTCTCCTTCCGCCTCGGG + Intronic
1160680720 19:410746-410768 CAGGACCCTCCTCCCGCCTCAGG - Intergenic
1160861035 19:1237353-1237375 CTGCCATCTTCCCCGGCCTCCGG - Intronic
1160909238 19:1467255-1467277 CCGGCCCCTCCTCCCGCCGCCGG - Exonic
1162131746 19:8530273-8530295 CGGGCCGCTCCTCCAGCCCCAGG + Exonic
1162393293 19:10402646-10402668 CCAGCCTCTCCTTTGGCCTCCGG - Intronic
1162534342 19:11254028-11254050 CTGGCCTCTGCTCCCTCATCTGG + Intronic
1165471877 19:36008781-36008803 TGGGCCTCTCCTGCAGCCTCAGG - Exonic
1166694472 19:44844864-44844886 CTGGGCTCCAGTCCGGCCTCCGG - Intergenic
1166747936 19:45150861-45150883 CTGTCCCCTCCACCAGCCTCAGG + Exonic
1166970397 19:46563276-46563298 CTGGGCTCTCCTGGGGCTTCCGG + Intronic
1166981664 19:46635157-46635179 CTGCCCTCTCCGCCACCCTCAGG + Intergenic
1167924141 19:52809910-52809932 CCGGCCTCCCCACCGGCCCCGGG - Intronic
1167967376 19:53158444-53158466 CTGACCCCTCCTCCCGCCCCGGG - Intronic
1167998667 19:53426947-53426969 CTGGCCTCTCCTCTTCCTTCCGG + Intronic
1168008792 19:53513058-53513080 CTGGCCTCTCCTCTTCCTTCTGG + Intergenic
1168095649 19:54113378-54113400 CAGGCCTCTCCCCTGGCTTCTGG - Intronic
1168107546 19:54173791-54173813 CTGGCCCCTGCTCCAGCTTCTGG - Exonic
1168328762 19:55553842-55553864 CTGGCCTCCCCTCTCGCCTCTGG + Intergenic
1168351202 19:55677062-55677084 CTGGCCTCTGCTTCCACCTCAGG - Exonic
1168404325 19:56102988-56103010 CTGGCCTCCCCTCCCGCCCTGGG - Intronic
925177726 2:1797000-1797022 CTTGTCTCTGCTCCGGGCTCTGG + Intronic
925284238 2:2705514-2705536 CTGGCCTCTCCTCTGAGCTCAGG - Intergenic
925377806 2:3400658-3400680 CTGGACTCTCCCTCGGCCTGCGG + Intronic
925503706 2:4536189-4536211 CCAGGCTCTCCTCCAGCCTCTGG - Intergenic
925585017 2:5456743-5456765 CAGCCCTCTCCTCCAGTCTCCGG + Intergenic
926062855 2:9814798-9814820 ATGTCCTGTCCCCCGGCCTCAGG + Intergenic
926308551 2:11657902-11657924 CTGGCGTCCCCTCCTGCCTCTGG - Intergenic
927433333 2:23045722-23045744 CTCCCCTCTCCCCCAGCCTCTGG - Intergenic
927794258 2:26034324-26034346 ATGGCCTCCCCTCCCCCCTCAGG - Exonic
927882754 2:26700214-26700236 CTGACCCCTCCGCCAGCCTCTGG + Intronic
928483607 2:31707795-31707817 ATGGGCTCTCCTCCCACCTCTGG - Intergenic
931671615 2:64653498-64653520 CCGGCCCCTCCTCCGCCCTCCGG + Intronic
933919299 2:87028445-87028467 CTGTCTGCTCCTCCTGCCTCTGG - Intergenic
934003695 2:87741462-87741484 CTGTCTGCTCCTCCTGCCTCTGG + Intergenic
934696165 2:96402124-96402146 CTCCCCTTTCCTCCAGCCTCTGG - Intergenic
936064064 2:109317361-109317383 CTGGACTCTCCTCCACCCCCTGG - Intronic
937132502 2:119524084-119524106 CTCGCCCTTTCTCCGGCCTCGGG - Intronic
941548885 2:166889471-166889493 CTGGCCTCTCCTCCTGCAGGTGG + Intronic
942068474 2:172294047-172294069 CTGGCCCCTGCTCAGGACTCAGG - Intergenic
942314134 2:174682708-174682730 CCGGCGTCTCCCCCGGCCCCCGG + Intronic
944124043 2:196273419-196273441 CTGTCCACTCCACCTGCCTCAGG + Intronic
945116203 2:206410360-206410382 TGGGCCTCTTCTCGGGCCTCTGG - Intergenic
945892774 2:215447770-215447792 CATGCCTCTCCTCCAGCTTCTGG - Intergenic
946187844 2:217991180-217991202 CTGGGCCCTCCTCCCTCCTCTGG - Intronic
946394969 2:219439036-219439058 CTGGCCTCTCCTCCGCTCACTGG - Intronic
946496681 2:220202520-220202542 CTGGCATCTCCTCTGGCCTCAGG + Intergenic
947200327 2:227609107-227609129 CTGGCCTGGCCTCCGTCCTGTGG + Intergenic
947715351 2:232336360-232336382 CTGGCCCCTCCTTCGGCCTCTGG - Intronic
947752469 2:232540137-232540159 CTGACCCCTCCTCCGTCCTGCGG - Intronic
948385087 2:237576051-237576073 CAGGCCCCTCCCCTGGCCTCCGG + Intronic
948390003 2:237605141-237605163 CTGGCCTCTTCTCGGGCTTCTGG - Intergenic
948673056 2:239580940-239580962 CTGGGCTCTTCTGGGGCCTCAGG - Intronic
948809419 2:240467123-240467145 CTGGCTGCTCCTCAGCCCTCGGG - Exonic
948887886 2:240893045-240893067 GCGGCCTCTCCTCCGGTCCCTGG - Intronic
948918721 2:241051652-241051674 CTGGCATCTCCTCAGTCCTCTGG - Intronic
949070161 2:242019594-242019616 CTGCCCTCTACTCTGGCCTAAGG - Intergenic
1168965125 20:1894336-1894358 CTCCCCTCGCCTCCGGACTCCGG - Exonic
1170649195 20:18224490-18224512 CAGGCCTCTCTCCCGGCTTCTGG + Intergenic
1171197427 20:23211083-23211105 CAGACCTCTCCTCCACCCTCAGG + Intergenic
1171308496 20:24126333-24126355 CTGGCCTCCTCTCCCTCCTCAGG + Intergenic
1172286897 20:33747002-33747024 TTGTCCTCTGCTCTGGCCTCCGG - Intronic
1172553551 20:35821014-35821036 CTGGGCTCACCTCCTACCTCTGG - Intronic
1173561739 20:44010970-44010992 CTCGCTTCTCCTCCGGCTCCTGG + Intronic
1174061120 20:47833789-47833811 CTGGCCCCTCCCCAGGTCTCAGG + Intergenic
1174070654 20:47896910-47896932 CTGGCCTCTCCCCAGGTCTCAGG - Intergenic
1174100277 20:48121900-48121922 CTGGCCCCTCCCCGGGTCTCAGG + Intergenic
1174100445 20:48122819-48122841 CTGGCCCCTCCCCAGGTCTCAGG + Intergenic
1174153395 20:48501692-48501714 CTGGCCCCTCCCCAGGTCTCAGG + Intergenic
1174282456 20:49449081-49449103 CTGGCCTCACCTCTGGCTCCAGG + Intronic
1175050261 20:56148942-56148964 CTGGTGTCTCCTCCAGTCTCTGG - Intergenic
1175193135 20:57224645-57224667 CTGGCCTGGCCTCAGGCCTGGGG + Intronic
1175225267 20:57440798-57440820 CTGGCCTCTCCTCAGGCCACAGG + Intergenic
1175252748 20:57619314-57619336 GTGACCTCCCCTCCGGCTTCAGG + Intronic
1175607658 20:60324022-60324044 TTGGCCTCTCTTCTGGCTTCTGG + Intergenic
1175834629 20:61985718-61985740 CTCACTTCTCCTCAGGCCTCAGG - Intronic
1178376394 21:32071022-32071044 CTGCCCTCACCTCCTGCCTCTGG + Intergenic
1178440833 21:32596939-32596961 CAGGCCTCACCTGCTGCCTCAGG - Intronic
1178777854 21:35569253-35569275 CAGGCCTCTCCCCCAGCTTCTGG - Intronic
1178941569 21:36911256-36911278 CTGCCCCCTCCCCTGGCCTCTGG + Intronic
1179085756 21:38216172-38216194 CTGGCCTCTTTTCTGGCTTCTGG + Intronic
1179542540 21:42093010-42093032 ATGGGCTCTCCCCCGCCCTCGGG + Intronic
1179911474 21:44451283-44451305 CTGTCCTCTCTTCCAGCCTCAGG - Intergenic
1180114051 21:45684665-45684687 TTGGCCTCTGCTGAGGCCTCAGG - Intronic
1180167456 21:46037394-46037416 CAGGCTTCTCCTCTGTCCTCGGG + Intergenic
1180875952 22:19175347-19175369 CTGGCCTTCCCTGTGGCCTCTGG - Intergenic
1181546567 22:23605671-23605693 CTGGCCTCCCCCCAGTCCTCTGG - Intergenic
1182469951 22:30542382-30542404 CTCCCCTCGCCTCCGGACTCCGG - Intronic
1183062469 22:35344626-35344648 CTGGGCTCTGCTCCTGCCTGGGG + Intronic
1184279542 22:43429151-43429173 CTGGCCTTTCCTGCTGTCTCAGG + Intronic
1184408348 22:44312815-44312837 CTGGCCTCTTCCCCGGCTCCTGG + Exonic
1184688477 22:46106921-46106943 CTGACCTCTCCTCTGGCCTCAGG - Intronic
1184915421 22:47565584-47565606 CTGGCCTCTCTTCCCTTCTCTGG - Intergenic
1185281071 22:49970135-49970157 CTGGCCCCTCCGCCTGCCTCAGG - Intergenic
950040754 3:9917711-9917733 AGGGCCTCTCCTGCCGCCTCTGG + Exonic
950472057 3:13192586-13192608 CTGGCCTCTCTCCCAGCCTCTGG - Intergenic
951691865 3:25405137-25405159 TAGGCCTCTGCTCCGGTCTCTGG - Intronic
952955411 3:38554215-38554237 CAGGCCTCTCCTCCAGCCCCTGG - Intronic
954152261 3:48663427-48663449 TTGGCCTCTGCTCCCGCCTCGGG - Intergenic
954413670 3:50382396-50382418 CTAGCCTCTGCTCCGGCCCTGGG + Intronic
954796127 3:53161995-53162017 CGGGCCTCGCCTCCCGCCCCTGG + Intronic
956663364 3:71620168-71620190 CCATCCTCTCCTCCGTCCTCGGG + Intergenic
956690533 3:71874220-71874242 CTTCCCTCTCCTCCAGCCCCTGG - Intergenic
956781443 3:72606341-72606363 CAGGGATCTGCTCCGGCCTCAGG + Intergenic
959984858 3:112561529-112561551 CCGGCCGCTACTCCGGCCCCAGG - Exonic
961328784 3:126127001-126127023 CTGACCTCTCTTCTGGCATCTGG - Intronic
961657543 3:128451678-128451700 CTGGCCTCTCCTCCTCTCTCTGG + Intergenic
961821857 3:129579247-129579269 CAGCCCTGTCCTCCGCCCTCAGG - Intronic
963970342 3:151422400-151422422 CATGCCTCTCCTCCAGCTTCTGG + Intronic
964210463 3:154221020-154221042 CAGGCCTCTCCCCCAGCTTCTGG - Intronic
964476849 3:157105346-157105368 CTGGCCTCTCTGCTGGCCCCTGG - Intergenic
966782930 3:183600708-183600730 CTGACTTTTCCTCCAGCCTCTGG - Intergenic
966931937 3:184681014-184681036 CTGGGGTCTCCTCCAGTCTCAGG + Intronic
967876872 3:194273491-194273513 CTTTCCTCCCCTCCTGCCTCGGG - Intergenic
967892776 3:194374977-194374999 CTGGGCTCTCCTCCACCCTTTGG + Intergenic
967928463 3:194672142-194672164 CGGGGCTCTCCTCCGGCCCATGG + Exonic
968106546 3:196005656-196005678 CTGCCCTCTGCTCTGGCCTAAGG + Intergenic
968484432 4:852144-852166 CTGGCCTGTGCTCCAGCCCCTGG - Intronic
968628851 4:1639988-1640010 CTGGCTGCGCCTCAGGCCTCTGG - Exonic
969432918 4:7166485-7166507 CAGGCCTCTCCCCTGGCTTCAGG - Intergenic
969480938 4:7446548-7446570 CTGGCCTTTCCTGAGCCCTCGGG + Intronic
973923869 4:55717246-55717268 CAGGCCTCTCCCCTGGCTTCTGG + Intergenic
979158674 4:117430077-117430099 CTGCCCTCACCACAGGCCTCTGG - Intergenic
979290831 4:118977311-118977333 CTGGCCAGCCCTGCGGCCTCGGG - Intronic
979359986 4:119750617-119750639 CTCTCCTTTCCTCCTGCCTCAGG + Intergenic
980191782 4:129533723-129533745 CTGGCACCTCCTCCGGCAACCGG + Intergenic
980775327 4:137429729-137429751 CAGGCCTCACCTCCAGCATCGGG - Intergenic
982122557 4:152156905-152156927 GTGCCCTCTCCTTCAGCCTCAGG + Intergenic
983449010 4:167887915-167887937 CTGGCCTGTGCTCTGGCCTGTGG - Intergenic
984824910 4:183915767-183915789 CAGGCCTCTCTCCCGGCCTCCGG - Intronic
985505922 5:280324-280346 CTGCCCTCTGCTCTGGCCTAAGG - Intronic
985878546 5:2619504-2619526 GTGTCCTCTCCTCCTGCTTCAGG - Intergenic
986492745 5:8308671-8308693 GTGGGCTCCCCTCCGGCCTAGGG - Intergenic
988065938 5:26228982-26229004 CTGCCCTCTGCTCTGGCCTATGG + Intergenic
988065958 5:26229071-26229093 CTGCCCTCTGCTCTGGCCTAAGG + Intergenic
988795418 5:34648927-34648949 ATGGCCTCTCTTCCTGCTTCTGG + Intergenic
990161888 5:52950180-52950202 CTGGCATCTCCCCCGGCATGTGG - Intronic
990684551 5:58286673-58286695 TTGGCCTCTCCTCCCTCTTCAGG + Intergenic
990786476 5:59426144-59426166 CTGGCTTCTCCTTAGGACTCTGG - Intronic
990982892 5:61617408-61617430 CTGGCCTTTCCTCCTGGCTTTGG + Intergenic
991690122 5:69217697-69217719 CTGGGCTCTCCTCCGCCGTGGGG - Intergenic
995835620 5:116396923-116396945 CTGGCCTGGCCCCAGGCCTCTGG - Intronic
997634521 5:135395146-135395168 GTGACCTCTCCTCCTGCCTCTGG + Intronic
998148485 5:139744063-139744085 CTGCCTTCTCCTCCTGGCTCTGG + Intergenic
998168238 5:139856581-139856603 CTGGCCCCTCCTCCCAGCTCAGG + Intronic
999273625 5:150313710-150313732 CGGGCCTCTCCCCCAGCCTCTGG - Intronic
999367979 5:151035212-151035234 CTGGGCTGTGCTCCGCCCTCAGG - Intronic
1000161018 5:158597835-158597857 TTGTCCTCTCCTCCAGCCCCTGG - Intergenic
1001095051 5:168769524-168769546 CTGGCCTCTCCTCCTTCCTAAGG + Intronic
1001537438 5:172508191-172508213 CAGGCCTCTCTCCCAGCCTCTGG - Intergenic
1001999787 5:176191259-176191281 CTGGCATGTCCTCCAGGCTCTGG - Intergenic
1002352188 5:178590637-178590659 CCGGGCTCCCCTCCGACCTCTGG - Intergenic
1002385118 5:178860467-178860489 ACGGCCACTCCTCCTGCCTCGGG + Intronic
1002420800 5:179148119-179148141 CTGGCCTCTACTTACGCCTCAGG + Intronic
1002787469 6:414516-414538 CAGGCCTCTCCTCTGGCATTGGG - Intergenic
1003239203 6:4328053-4328075 CTGGCCTTTCCTCTTGCATCTGG + Intergenic
1003856208 6:10278966-10278988 CTGGCCTCTCTCCCAGCTTCTGG + Intergenic
1004012453 6:11702686-11702708 CTGGCCTCACCTCCTTTCTCTGG - Intergenic
1004140507 6:13013668-13013690 CTACCCCCTCCTCCGGCTTCGGG + Intronic
1004442017 6:15662884-15662906 GTCTCCTCTCCTCAGGCCTCGGG + Exonic
1004906050 6:20238338-20238360 TTGGCCTCTTCTCAGGACTCAGG + Intergenic
1005183625 6:23137163-23137185 TGGGCCTGTCCTCAGGCCTCGGG + Intergenic
1005589650 6:27310897-27310919 CTGGCCTCTCCACAGTCCACGGG - Exonic
1007132110 6:39484930-39484952 CTGCCCTCTCCTCTGGATTCTGG + Intronic
1007400444 6:41599731-41599753 CAGGCCCCGCCTCTGGCCTCAGG - Exonic
1008601811 6:53103640-53103662 CTGGACTCTACTCCTGGCTCTGG - Intergenic
1011273213 6:85601126-85601148 CTGGTCTCAACTCCCGCCTCAGG - Intronic
1011295987 6:85827011-85827033 TAGGCCTGTCCTCAGGCCTCTGG - Intergenic
1012952530 6:105533928-105533950 CTGGCCCCTCCCCCTGCCCCCGG - Intergenic
1014724185 6:124955672-124955694 CTGGCCTGTCCTCAGGCCCTTGG - Intergenic
1014724265 6:124956153-124956175 CAGGCCTGTCCTCAGGCCTCTGG - Intergenic
1015325415 6:131918489-131918511 CTGCTCTCTCCACGGGCCTCTGG + Intergenic
1017206406 6:151808139-151808161 CCGGCCTCCCCTACGGCCCCGGG + Exonic
1017334887 6:153244598-153244620 CAGGCCTCTCCTCCAGCATGTGG - Intergenic
1017878515 6:158543569-158543591 CAGGCCTTTTCTCCGGCTTCTGG + Intronic
1018127472 6:160695622-160695644 CTGCCTGCTCCTCCCGCCTCTGG + Intergenic
1018435344 6:163753946-163753968 CAGGCCTCTCCTCTGGCTTCTGG + Intergenic
1019533267 7:1514226-1514248 CTGCCTCCGCCTCCGGCCTCCGG - Intergenic
1019701345 7:2476252-2476274 CTGGCCTCTCATCAGATCTCAGG - Intronic
1019765184 7:2844445-2844467 CGGGCATCCCTTCCGGCCTCGGG + Intergenic
1022976923 7:35567251-35567273 CTGGCCTCTATTCTGGCTTCAGG - Intergenic
1023965887 7:44962895-44962917 CTGACCCCTCCTCCTGCCGCAGG - Exonic
1024410683 7:49037840-49037862 CTTGGCTCTCCTCCTTCCTCAGG - Intergenic
1024668037 7:51565243-51565265 CAGGCCACTACTGCGGCCTCTGG + Intergenic
1025216684 7:57061569-57061591 CCGGCCTCACTCCCGGCCTCAGG - Intergenic
1025233630 7:57219203-57219225 CTGGCCCCTCCCCAGGTCTCAGG - Intergenic
1026037127 7:66837753-66837775 CGGGCCTCTCCTCAGGCCGTGGG + Intergenic
1026808369 7:73442218-73442240 CTGGACTGTCCAACGGCCTCTGG + Exonic
1027348725 7:77288579-77288601 CTGGCCACTCACCTGGCCTCTGG + Intronic
1029732857 7:102449113-102449135 CGGGGCTCTTCTCCGGCCCCCGG - Exonic
1031974431 7:128084895-128084917 CAGGGCTGTCCTCAGGCCTCAGG + Intronic
1032037765 7:128532026-128532048 CCAGTCTCTCCTCCGGCCGCCGG - Intergenic
1033047600 7:137976846-137976868 CTGGCCTCTCCCACTGTCTCTGG - Intronic
1034469366 7:151247368-151247390 GTGGCCTGTCCTCCAGCCCCAGG - Intronic
1034940842 7:155229156-155229178 CTGGCCTTTCCTCTGCCCACAGG + Intergenic
1034950440 7:155293055-155293077 CTTTCCTCTGCTCCAGCCTCAGG + Intergenic
1036399690 8:8396748-8396770 CTCACCTCTCCTCCAGCCTCTGG - Intergenic
1036645243 8:10608447-10608469 TGGGCCTCTCCTTCTGCCTCTGG + Exonic
1036810784 8:11866918-11866940 CTATCCTCTCCTCCGGCAGCAGG + Intronic
1037916713 8:22777468-22777490 CCTGCCTCTCCTCAGGTCTCAGG - Intronic
1037922698 8:22818698-22818720 CTGGCCTCCTCTCTGGCCTTTGG - Intronic
1038038390 8:23705000-23705022 CCGGCCTCGGGTCCGGCCTCGGG + Intronic
1038452537 8:27649219-27649241 CTGTCATCTCCTCCTCCCTCTGG + Intronic
1038494072 8:27989638-27989660 CGGGCCTCTCCTCCAGCCTATGG + Intronic
1038741157 8:30218316-30218338 CATGCCTCTCTTCCGGCTTCTGG - Intergenic
1040096202 8:43445557-43445579 CTTGTCTCTACTCCGGGCTCTGG - Intergenic
1041017875 8:53609466-53609488 TTGGGCTCTCCCCAGGCCTCTGG - Intergenic
1041086260 8:54259252-54259274 TTGCCCTCTCCTCCTCCCTCGGG - Intergenic
1043206979 8:77456860-77456882 CTGGCCTTTTTTCCTGCCTCTGG - Intergenic
1043848611 8:85190168-85190190 ATGCCCTCTCCTCCTGCCTCAGG + Intronic
1046112457 8:109741818-109741840 CTCACCTCTCCTCTGGCCACTGG + Intergenic
1047697397 8:127416791-127416813 GTGTCCTTTCCTCCGGCCCCAGG + Exonic
1048357677 8:133666990-133667012 CTGGTCTCTCCTCCTTCCTAGGG + Intergenic
1049320912 8:141995787-141995809 CAGGCCTCTCTTCCAGCCTCTGG + Intergenic
1049322125 8:142002124-142002146 CTGGGCTCTCTTGCAGCCTCTGG + Intergenic
1049426355 8:142539612-142539634 ATGGACCCTCCTTCGGCCTCAGG - Intronic
1049428922 8:142550276-142550298 CAGGCCTCTGATCCGGCCGCCGG - Intergenic
1049726366 8:144148275-144148297 CCGGCCTCTCTTCCGGGCTGTGG - Intronic
1050258584 9:3817759-3817781 ATGGCCACTCCTCAAGCCTCAGG + Intergenic
1050512712 9:6412557-6412579 CAGGCCTATCCTCAGGCCGCGGG - Intergenic
1051337542 9:16079586-16079608 CAGGCCTCTCTCCCGGCTTCTGG - Intergenic
1051663446 9:19446307-19446329 TGGGCCTCTTCTCGGGCCTCTGG + Exonic
1053290453 9:36876202-36876224 CCCACCTCTCCTCTGGCCTCAGG + Intronic
1055810758 9:80145197-80145219 CTGGACTCTCCCCAGGACTCAGG + Intergenic
1057034707 9:91803388-91803410 CTGTCCCCTCCTCCAGCCTCTGG - Intronic
1057401435 9:94726782-94726804 CCTTCCTCTCCTCCGGCGTCGGG + Intronic
1058110542 9:101027848-101027870 CTGCCATCTCCCCTGGCCTCAGG + Intergenic
1058651220 9:107177135-107177157 CTGGCCTCTACTCCGGGCTGTGG + Intergenic
1059191688 9:112333347-112333369 GGGGCCGCTCCTCCGGCCGCCGG + Intronic
1059325894 9:113503814-113503836 CTGGCGTCTTCCCTGGCCTCAGG + Intronic
1059438522 9:114290089-114290111 CTGGACCCCCCTCCGGCCTGGGG - Exonic
1059669570 9:116479427-116479449 CTGGCCTGTCCACCACCCTCAGG - Intronic
1059921660 9:119167232-119167254 CTGGCCCCTCCTGTGGCCCCGGG - Exonic
1059929450 9:119246643-119246665 CTGGCTTCTAGTCCTGCCTCCGG - Intronic
1060222235 9:121770645-121770667 CTGGCCTCCACACCGGGCTCTGG + Exonic
1060700002 9:125742427-125742449 CTGGGCAATCCTCCTGCCTCAGG - Intergenic
1061374378 9:130215420-130215442 CTGGCCTCTGCTCAGCCCTGAGG - Intronic
1062130921 9:134892600-134892622 CTGGCCTCTGCTCTGACCCCAGG - Intergenic
1062378257 9:136274688-136274710 CTGGCCTGTCCTCGGGACCCTGG + Intergenic
1062445123 9:136590404-136590426 CTGACCTCTCCTCTGGCCATGGG + Intergenic
1062527237 9:136982901-136982923 ATGGCATCTCCTCCGGACACGGG - Intronic
1062620209 9:137417156-137417178 CTGACTTCTCCCCCGGCGTCTGG - Intronic
1185672640 X:1824869-1824891 CTGGCCTCACCTCCAACTTCAGG + Intergenic
1185672736 X:1825333-1825355 CTGGCCTCACCTCCAACTTCAGG + Intergenic
1185673173 X:1827369-1827391 CTGGCCTCACCTCCAACATCAGG + Intergenic
1187344043 X:18446890-18446912 TTGCCCTCTCCTCCTGTCTCAGG + Intronic
1188154375 X:26722892-26722914 CTGGCCTGTCCTCTGGCCCCTGG - Intergenic
1190102098 X:47529650-47529672 CAGGCCTCTCCTCCAGCTGCTGG + Intergenic
1190335662 X:49260239-49260261 CAGGCCTCTCCCCCAGCTTCTGG - Intronic
1191846212 X:65549976-65549998 CTGCCCTCTCCTCCTGTGTCTGG - Intergenic
1192473715 X:71420893-71420915 CCGGCCTCCCCACCGGCCCCAGG + Intronic
1193463471 X:81817995-81818017 GTGGGCTCTCCTCTGGCCTGGGG + Intergenic
1193743313 X:85244326-85244348 CTGAGCTTTCCTCCCGCCTCGGG + Intronic
1195382569 X:104284734-104284756 CTGGCCTCTCCTCCCACATAAGG + Intergenic
1197620756 X:128744886-128744908 CTGGTCTTTCCTCCTTCCTCTGG - Intergenic
1199134317 X:144232962-144232984 CTTGCCTGTCTTCAGGCCTCAGG + Intergenic
1200042419 X:153379770-153379792 CTGGGCTCTCCTCCTCCCCCAGG - Intergenic
1201344210 Y:12965314-12965336 CTGGCCTATCCTCAGGCCCCTGG + Intergenic