ID: 900647847

View in Genome Browser
Species Human (GRCh38)
Location 1:3717159-3717181
Sequence TGCCCAAACCTGCCCGTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900647841_900647847 23 Left 900647841 1:3717113-3717135 CCAGGAAAATGACAGACAAGTTA 0: 1
1: 0
2: 4
3: 70
4: 909
Right 900647847 1:3717159-3717181 TGCCCAAACCTGCCCGTGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 135
900647842_900647847 -6 Left 900647842 1:3717142-3717164 CCTCTCCGCTGTCCTCCTGCCCA 0: 1
1: 0
2: 8
3: 64
4: 603
Right 900647847 1:3717159-3717181 TGCCCAAACCTGCCCGTGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 135
900647840_900647847 24 Left 900647840 1:3717112-3717134 CCCAGGAAAATGACAGACAAGTT 0: 1
1: 0
2: 5
3: 39
4: 347
Right 900647847 1:3717159-3717181 TGCCCAAACCTGCCCGTGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900647847 Original CRISPR TGCCCAAACCTGCCCGTGCC GGG Intronic
900647847 1:3717159-3717181 TGCCCAAACCTGCCCGTGCCGGG + Intronic
900710715 1:4111810-4111832 GCCCCTAACCTTCCCGTGCCAGG - Intergenic
902812708 1:18897939-18897961 TCCCCAAACCTTCCCTTTCCTGG - Intronic
904470000 1:30730281-30730303 TGCCCTCACCTGCCCAGGCCTGG + Intergenic
907333008 1:53683656-53683678 TCCACATGCCTGCCCGTGCCAGG - Intronic
911160254 1:94676817-94676839 TGGACAAACCTGCCCATGACAGG + Intergenic
915168771 1:153963434-153963456 TGCCCAGGCCTCCCCGGGCCCGG - Exonic
915540431 1:156562516-156562538 TCCCCAAACCTCCCAGTGCAGGG + Intronic
917974235 1:180229335-180229357 GGCCCAAACCTCCCCGCGGCGGG - Intergenic
922930040 1:229381881-229381903 TGCCCAAGGGTGCCAGTGCCAGG + Intergenic
1064387606 10:14911176-14911198 TGCCCAGAACTCACCGTGCCAGG + Intronic
1066657866 10:37712173-37712195 TCCCCAAACCTCCATGTGCCTGG + Intergenic
1067042344 10:42961803-42961825 TCCCCAAACCTCCACGTGCCTGG + Intergenic
1067088942 10:43256903-43256925 TGCCCAAACCTGGCCTTCCCAGG + Intronic
1070282365 10:75059025-75059047 AGGCCATACCTGCCCGGGCCTGG + Intergenic
1073124053 10:101139170-101139192 CCCCCAACCCTGCCCCTGCCCGG + Intergenic
1074419702 10:113298080-113298102 TGCCAAGACCTGCCCGTACCAGG - Intergenic
1074586707 10:114774886-114774908 TGTCCAAAGATGCCCATGCCAGG + Intergenic
1076723857 10:132404516-132404538 TGCCCAGACCTGCCGGAGCATGG + Intronic
1076837948 10:133030457-133030479 TCTCCCAACCTGCCCGCGCCTGG - Intergenic
1077472425 11:2770273-2770295 TGCCCAGGGCTGCCTGTGCCAGG - Intronic
1078480689 11:11672702-11672724 GGCACATACCAGCCCGTGCCCGG + Intergenic
1078902086 11:15650920-15650942 TGACCAGACCTGCCCCTGCAGGG + Intergenic
1079017262 11:16879663-16879685 TGCCCAGCTCTGCCTGTGCCAGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083602003 11:63954575-63954597 TCCCCAGCCCTGCACGTGCCAGG + Exonic
1089292327 11:117444851-117444873 AGCCCCATCCCGCCCGTGCCAGG - Intronic
1096800532 12:54107411-54107433 TGCGCTAACCTGGCTGTGCCTGG + Intergenic
1101315787 12:103627630-103627652 TTCCAAAAGCTGCCAGTGCCAGG + Intronic
1102199322 12:111046555-111046577 TGGCCAAAGCTGCCCCTCCCAGG + Intronic
1104823853 12:131694540-131694562 TGCACACAGCTGCCTGTGCCTGG + Intergenic
1105889496 13:24672296-24672318 TGCTCAAACGTGCTGGTGCCTGG + Intergenic
1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG + Intergenic
1113898036 13:113778001-113778023 AGCCCACAGCTGCCTGTGCCAGG + Intronic
1117029471 14:51652777-51652799 TGTCCATACCTGACAGTGCCTGG - Intronic
1121272129 14:92644800-92644822 GGCCCAAGCCTGCCCATGCCAGG - Intronic
1121278404 14:92683196-92683218 TGCCCAGCCCTTCCAGTGCCAGG - Intronic
1122481508 14:102050333-102050355 TGTCCAAACCTCTCCTTGCCGGG + Intronic
1123840187 15:24240239-24240261 ATCCCAAACGTGCCCGAGCCAGG - Intergenic
1124154960 15:27217792-27217814 TGCCCACACGTGACCTTGCCAGG - Intronic
1129756243 15:78101003-78101025 TGCCCAAGCCTAGCCGTGCCTGG - Exonic
1132699787 16:1217475-1217497 GGCCCAGCCCTGCCCCTGCCGGG + Intronic
1133933738 16:10252481-10252503 TGCCCGAAGCTGCCCTAGCCGGG + Intergenic
1133976268 16:10601752-10601774 TGCCCCACCCTGCCCCTCCCTGG + Intergenic
1136356674 16:29748621-29748643 TGCCCAAGCGTCCCCCTGCCTGG + Intergenic
1136995181 16:35184194-35184216 TGACCAGACCTGGCAGTGCCTGG + Intergenic
1141826226 16:86482234-86482256 TGCATAAACCTGCCCATGGCAGG - Intergenic
1142396863 16:89837063-89837085 TTTCCAAAGCTGCCCGTGCCTGG + Intronic
1142622204 17:1172250-1172272 TGCCCAATCCCACCCCTGCCTGG - Intronic
1143786307 17:9258439-9258461 TGCCCAGACCTGCCCACTCCAGG + Intronic
1145999006 17:29120475-29120497 AGGCCAACCCTGCCCATGCCTGG + Intronic
1147879059 17:43642301-43642323 TGCCCTGCCCTGCCTGTGCCAGG + Intronic
1149521840 17:57323564-57323586 AGCCCAATCCTGGCCCTGCCAGG - Intronic
1157812016 18:50704036-50704058 TCCCCACACCTGCCCTTTCCAGG + Intronic
1158308062 18:56128106-56128128 TGCCTAAACCAGCCCAGGCCAGG - Intergenic
1158508100 18:58064770-58064792 TGCCTAAAGCTTCCTGTGCCAGG + Intronic
1158621207 18:59034076-59034098 TGGCCAAACCTGGCAGAGCCCGG + Intergenic
1158796807 18:60856232-60856254 TGCTCACACCTGCCTGAGCCAGG - Intergenic
1159947841 18:74457259-74457281 TGGCCAGCCCTGCCCGCGCCCGG + Exonic
1160044707 18:75375910-75375932 TCTCCACACCTGCCTGTGCCAGG - Intergenic
1160735117 19:658841-658863 TGCCCATCCGTGCCAGTGCCAGG + Intronic
1160836251 19:1126084-1126106 CGCCCAAGCCTGCCTGAGCCCGG + Intronic
1162808243 19:13150078-13150100 TACCCAAGCCAGCCAGTGCCCGG - Intronic
1164231340 19:23290692-23290714 TGCCTCAGCCTGCCAGTGCCTGG - Intergenic
1164732866 19:30519292-30519314 TGTCCACACCTGCCCCAGCCAGG - Intronic
1165730101 19:38139784-38139806 GGCCCTATCCTGCCAGTGCCTGG - Intronic
1165906967 19:39200101-39200123 ATCCCAAACCTGGCCGTTCCTGG + Intronic
1166107059 19:40602613-40602635 AGCCCCAACGTGCCTGTGCCAGG + Intronic
1167158900 19:47755244-47755266 TGCACAAACCTGCCTGTCCCCGG - Intronic
1167423587 19:49417752-49417774 TGCCCACAGCTGCCCTCGCCAGG - Exonic
925007411 2:454704-454726 TGACCACACCAGCCCTTGCCTGG - Intergenic
925358103 2:3256843-3256865 TGCCCAAGCCCGCCCGTGTCCGG - Intronic
926112285 2:10191168-10191190 TGCTCAACACTGCTCGTGCCTGG + Intronic
926130876 2:10302669-10302691 GGCCCAAACCTGGCCCTGCCGGG - Intergenic
933157773 2:78993647-78993669 TGCTCTAACCTGCCCTTCCCGGG + Intergenic
934763560 2:96868909-96868931 TGCTCCAGCCTTCCCGTGCCAGG + Intronic
943726900 2:191261189-191261211 TTCCCAGACCTGCGTGTGCCCGG + Intronic
946229061 2:218280419-218280441 TGCCCATACCTGCTCCTGCCTGG - Intronic
947040692 2:225916088-225916110 TTCTCAAACCTTCCTGTGCCTGG + Intergenic
1169049260 20:2562236-2562258 TGCCCATGCCTTCCCTTGCCTGG + Intronic
1171458746 20:25286740-25286762 TGCCCAAACCTGCTGTTCCCCGG + Intronic
1172948267 20:38705057-38705079 TGCTCAGACCTGACAGTGCCTGG + Intergenic
1173475328 20:43355129-43355151 TGACCACACCTCCCAGTGCCAGG + Intergenic
1176666274 21:9690243-9690265 TGCCCAATCCTGGCGCTGCCTGG + Intergenic
1178983925 21:37287205-37287227 GGCCCCAACCTGCCAGTGCCAGG + Intergenic
1179729724 21:43360923-43360945 CGCCCACACCTGGCTGTGCCTGG - Intergenic
1180009781 21:45041637-45041659 TGCCGAGACCTGACCGTGCCTGG + Intergenic
1181327473 22:22060940-22060962 TGCCCAAGCGTGCCCCTCCCTGG - Intergenic
1182417765 22:30232552-30232574 TCCCCGAACCTGCCTGTGCACGG + Intergenic
1183404898 22:37625648-37625670 TGGCCACACCAGCCCCTGCCTGG - Intronic
1184089226 22:42283674-42283696 TGCCCAGCCCTGCCCTGGCCCGG + Intronic
1184147356 22:42619367-42619389 AGCCCAAAGCTGCAGGTGCCAGG - Exonic
949933394 3:9098089-9098111 TACCCAAACCTCCCCCTCCCAGG + Intronic
953266326 3:41392602-41392624 TGCCCAAAGCTGAGCGAGCCTGG - Intronic
954805438 3:53217289-53217311 AGCCCAAAGCTGCCTGTCCCAGG - Intergenic
963295081 3:143537398-143537420 TGCACCAACCTGCCCTTGCTGGG + Intronic
965524486 3:169701706-169701728 TGCCCAACCCTGCCAGTAACAGG + Intergenic
968556354 4:1248218-1248240 CGCCCCCACCTGCCCTTGCCTGG - Intronic
968689808 4:1984596-1984618 TGCCCCACCCTGCCCGTCCTGGG - Intronic
968759018 4:2432572-2432594 TCCCCCAACCTGCCCCGGCCTGG + Intronic
968910767 4:3476032-3476054 TGCCCCCACCTGCCCCAGCCTGG + Intronic
969110903 4:4843743-4843765 TGGGCAAGCCTGCCCATGCCCGG + Intergenic
969500401 4:7549100-7549122 TTCCCCAACCTGCCCTTGCTGGG - Intronic
971318930 4:25589620-25589642 TGCACAAATCTCCCTGTGCCAGG - Intergenic
983508968 4:168587480-168587502 TGCCCAAACCAGTCTCTGCCAGG + Intronic
985408747 4:189662093-189662115 TGCCCAATCCTGGCGCTGCCTGG - Intergenic
985517488 5:354406-354428 TGCCCACGCCAGGCCGTGCCCGG + Intronic
985851821 5:2393853-2393875 TGCCAAGACATGCCCGTGGCTGG - Intergenic
991139528 5:63224192-63224214 TCCCCACACTTGCCTGTGCCTGG + Intergenic
991724857 5:69525981-69526003 TGCTCAAACCTGACAGTGCCTGG - Intronic
994655395 5:102586526-102586548 TGCTGAAACCTGCCCTTGTCAGG + Intergenic
997728726 5:136146968-136146990 TGCCCACAACTGCCCGTAACAGG - Intronic
999238494 5:150114117-150114139 TTCCCAACCCTCCCCGTGCGGGG + Exonic
1002168658 5:177363111-177363133 TGCACCTACCTGCCCGCGCCCGG - Intronic
1002173973 5:177391105-177391127 TGCCCATCCCTGCCTGGGCCTGG - Intronic
1006303201 6:33204854-33204876 TGCCCTCTCCTCCCCGTGCCCGG + Intronic
1006444771 6:34074068-34074090 TGCCCATCCCTTCCCCTGCCAGG + Intronic
1006515558 6:34543892-34543914 TCCCCAAAGCTGCCCGAGGCTGG + Intronic
1006981560 6:38152009-38152031 TGCTCAAGCCTGTCCCTGCCTGG - Intronic
1016863867 6:148747392-148747414 TCCCACAGCCTGCCCGTGCCAGG - Exonic
1017885633 6:158597367-158597389 ACACCAAACCTGCCAGTGCCTGG - Intronic
1019522565 7:1467397-1467419 TGCTCACACCGGCCCCTGCCAGG + Intergenic
1019603172 7:1895426-1895448 TGCCCAGAGCTCCCCATGCCAGG + Intronic
1019802629 7:3099566-3099588 TACCCCAACCTTCCCTTGCCTGG - Intergenic
1022539559 7:31123364-31123386 TCCCCAAAGCTGCTAGTGCCAGG + Intergenic
1024879960 7:54073997-54074019 TGTGCAAACCAGCCAGTGCCGGG - Intergenic
1030089320 7:105843462-105843484 TGCCCAGACCTGCCATTGGCTGG - Intronic
1034976637 7:155453169-155453191 CTCCCAAACCTGCCCCTCCCAGG + Intergenic
1035428554 7:158799491-158799513 GGCCCAAACCTGCAAGTCCCAGG + Intronic
1039432471 8:37535675-37535697 TGCCCAGACCTGCCTGAACCAGG + Intergenic
1041254955 8:55972055-55972077 TACCAAATCCAGCCCGTGCCAGG + Intronic
1041496512 8:58491528-58491550 TGCCCAAGCCTGCCCGGGACTGG + Exonic
1042912695 8:73844260-73844282 TGCCTCAGCCTGCCAGTGCCTGG + Intronic
1044900026 8:96934395-96934417 TGCTCAATCATGCCCCTGCCTGG - Intronic
1048979390 8:139694901-139694923 AGCCCAACCATGCCCTTGCCTGG - Intronic
1049611036 8:143555456-143555478 TGCCCAACTCTGCCCCAGCCAGG + Intronic
1049662394 8:143825364-143825386 AGGCCAACCCAGCCCGTGCCTGG + Intronic
1058991007 9:110255720-110255742 TGGACAGACCTGCACGTGCCAGG + Intronic
1059307961 9:113369553-113369575 TGCCCTAACCTGGTCCTGCCAGG - Intronic
1060819880 9:126655168-126655190 TGCCCAAAGATGCCCTGGCCTGG + Intronic
1060869708 9:127029789-127029811 GGCCCAACCCTGACCGTGTCTGG - Intronic
1061081627 9:128374327-128374349 TGGCCAAACCTGGTGGTGCCAGG - Intronic
1061476829 9:130873195-130873217 TGCCCAAAGCTGGCTTTGCCAGG - Intronic
1061791828 9:133063142-133063164 TGCCCAAACCTCCCGGTCCCAGG - Intronic
1061795503 9:133083708-133083730 TGCCCAAACCTCCCGGTCCCAGG - Intronic
1062048955 9:134437488-134437510 TGCCCCACCCTGCCCGAGCCAGG - Intronic
1203659825 Un_KI270753v1:31518-31540 TGCCCAATCCTGGCGCTGCCTGG - Intergenic
1187190267 X:17027969-17027991 TGGCCAAGCCTGCCTGTGACTGG - Intronic
1188110532 X:26192611-26192633 TGCCCCAACCTGCCCCGACCTGG + Intronic
1190278505 X:48914265-48914287 TGCCCTAATCCGCCGGTGCCTGG - Exonic
1196231883 X:113233591-113233613 TGCCCATCCCTGCCCCTACCTGG - Intergenic
1196390003 X:115196847-115196869 TGCCCAAACATGAGCCTGCCTGG + Intronic
1200114882 X:153765615-153765637 TGCCCTACCCTGCCCCTCCCAGG - Intronic