ID: 900649218

View in Genome Browser
Species Human (GRCh38)
Location 1:3722834-3722856
Sequence CACCTCTCTGCACCTGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 2, 1: 4, 2: 5, 3: 29, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900649204_900649218 23 Left 900649204 1:3722788-3722810 CCTCTCTGCATGTGACACAGAGG 0: 1
1: 0
2: 0
3: 30
4: 200
Right 900649218 1:3722834-3722856 CACCTCTCTGCACCTGGCATGGG 0: 2
1: 4
2: 5
3: 29
4: 238
900649214_900649218 -6 Left 900649214 1:3722817-3722839 CCTGGCATGGGGCCGGGCACCTC 0: 1
1: 1
2: 56
3: 3192
4: 18562
Right 900649218 1:3722834-3722856 CACCTCTCTGCACCTGGCATGGG 0: 2
1: 4
2: 5
3: 29
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900649218 Original CRISPR CACCTCTCTGCACCTGGCAT GGG Intronic
900647131 1:3714047-3714069 CAGCTCCTTGCACCTGGCGTTGG + Intronic
900649175 1:3722670-3722692 CGCCTCTCTGCACCTGGCACAGG + Intronic
900649183 1:3722699-3722721 CACCTCTCTGCACCTGGCACAGG + Intronic
900649191 1:3722728-3722750 CACCTCTCTTCACCTGGCATGGG + Intronic
900649199 1:3722757-3722779 CACCTTTCTTCACCTGGCATGGG + Intronic
900649218 1:3722834-3722856 CACCTCTCTGCACCTGGCATGGG + Intronic
900649225 1:3722863-3722885 CACCTCTTTGCACCTGGCACAGG + Intronic
900649238 1:3722918-3722940 CACCTCTCTGCACCTGGCATGGG + Intronic
900649244 1:3722947-3722969 CACCTCTCTGTGCCTGGCACAGG + Intronic
900649270 1:3723059-3723081 CACCTCTCTGCACCTGGCACTGG + Intronic
900649290 1:3723140-3723162 CACCTCTCTGTGCCTGGCACGGG + Intronic
900649296 1:3723168-3723190 CACCTCTCTGCACCTGACATGGG + Intronic
900649304 1:3723197-3723219 CACTTCTTTGAACCTGGCACGGG + Intronic
900649310 1:3723226-3723248 TACCTCTCTGCACCTGACATGGG + Intronic
900649325 1:3723283-3723305 CACCTCTCTGCACCTAGCACAGG + Intronic
900933139 1:5749026-5749048 GACGTCTCTGGACCTGGGATGGG + Intergenic
902173958 1:14635439-14635461 GACCTCCCTGCACCTCTCATAGG - Intronic
902330266 1:15727837-15727859 CAAGACTCTGCAGCTGGCATGGG + Intronic
902442151 1:16437691-16437713 CAGTACTCAGCACCTGGCATAGG + Intergenic
902530863 1:17089837-17089859 GACCTCTCTGCCCCAGGCATTGG + Intronic
902803483 1:18846139-18846161 CACCTGTCAGCACCTGGCCTCGG + Intronic
904295234 1:29515999-29516021 CACCTCTCTGCATCTAGCCCAGG - Intergenic
905793410 1:40802278-40802300 CCCCTCTCCGCCCCTGGCCTCGG + Intronic
905797381 1:40823282-40823304 CACATCTCTCCACCCGGCAGAGG + Intronic
905917960 1:41698937-41698959 CACCCCTCTGATCCTGGCATTGG - Intronic
906504761 1:46370517-46370539 CACCTCTGTGCACATTTCATTGG - Intergenic
906949584 1:50323453-50323475 CAGTCCTCTGCAGCTGGCATGGG + Intergenic
907046062 1:51300830-51300852 CACCCCTCTGTTCCAGGCATTGG + Intronic
908774271 1:67625415-67625437 CACTCCTCTGCACTTGGCACAGG - Intergenic
909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG + Intergenic
911521715 1:98937604-98937626 CACCTTACTGCACCTGGGCTAGG - Intronic
912432501 1:109636407-109636429 TACCTATGAGCACCTGGCATTGG + Intergenic
915561726 1:156691893-156691915 CTCCTCTCTGCCTCTGCCATTGG + Intergenic
917337306 1:173938789-173938811 CAGCTCTCTGAACCTGTCAGAGG - Exonic
917648224 1:177049237-177049259 CACCTATGTGCTCCTGGTATGGG + Intronic
920101930 1:203522165-203522187 CCCCACTCTGCACCTGTCCTGGG + Intergenic
920505312 1:206511544-206511566 CACCTGTCTGCTCCTGGAGTCGG + Intronic
920668261 1:207982533-207982555 CACTTCTCAGCATCTGGCCTAGG + Intergenic
920696522 1:208185033-208185055 CCCCTCCCTACTCCTGGCATTGG + Intronic
923470120 1:234282752-234282774 CTCCTCTCTGGGCCTGGCATTGG + Intronic
924953768 1:248908403-248908425 CACCTCTGTGCACCAGCCATAGG + Intronic
1062859977 10:803464-803486 CACCTCTCCACACCTCCCATCGG + Intergenic
1063924476 10:10963763-10963785 CCCCTCTCTTCACCTTACATGGG - Intergenic
1064140755 10:12788276-12788298 CAACTCTGGGCACCTGGCACGGG + Intronic
1064160553 10:12941872-12941894 TTCCTCTCTGCACCAGGAATAGG + Intronic
1072160099 10:92758056-92758078 TGCCTCTCTGTCCCTGGCATGGG + Intergenic
1072588275 10:96802237-96802259 CACCTCTCTGCACCCTGGTTTGG + Intergenic
1076379012 10:130012336-130012358 CACCCCTCGCCACTTGGCATTGG - Intergenic
1076546168 10:131246822-131246844 CACCTCTATGCTCCCGGCAGGGG - Intronic
1077179295 11:1205000-1205022 CATCTCTCTGCACCTGGGCCAGG - Intergenic
1077221882 11:1421588-1421610 CTTCCCTCTGCACCTGGCACTGG + Intronic
1077342996 11:2034341-2034363 CACATGTCAGCACCTGGCCTTGG - Intergenic
1077674148 11:4182412-4182434 CACCCCTCTGCCCCAGCCATAGG + Intergenic
1077890830 11:6417102-6417124 CTCCTCCCTGCCCCTGGCTTTGG + Intronic
1078031575 11:7757259-7757281 AACATTTCTGCACCTGTCATAGG - Intergenic
1078101696 11:8333971-8333993 CAGGTCTCTGCACCTGGGGTGGG + Intergenic
1079083319 11:17428700-17428722 CTCCCCTCTGCCCCTGGCAGGGG - Intronic
1079339569 11:19601083-19601105 CATCTCTGTACACCTGGCACTGG + Intronic
1080283612 11:30585446-30585468 CTCGTCACTGCACCTGGCCTCGG + Intronic
1083144349 11:60747924-60747946 CACCCCTATGCTCCTGCCATTGG + Intergenic
1083596298 11:63919544-63919566 CACCTCTGTGCCCCAGGCCTGGG - Intergenic
1084760014 11:71264643-71264665 CACCTGTCTTCTCCTGGCCTTGG + Intergenic
1084767412 11:71321773-71321795 CACTGCTCTCCACCTGACATGGG + Intergenic
1084771368 11:71344727-71344749 CCCATGTCTGCACCTGGCATTGG + Intergenic
1084966796 11:72749007-72749029 CACCTCTCTGCACAGGGCTGTGG + Intronic
1084975078 11:72792615-72792637 CACCTCGCTTCACCTGGCTGGGG + Intronic
1085409454 11:76282577-76282599 CACCTCCCTGCACCTGCCCCGGG - Intergenic
1086197280 11:84155564-84155586 CACTAATCTGCACCTGGCATTGG - Intronic
1088770961 11:113036012-113036034 CACTTCTCTGCTCCTGTCCTGGG + Intronic
1088813215 11:113405287-113405309 AACCTCACTGCACTGGGCATCGG - Intergenic
1089587695 11:119520644-119520666 CAGCTCCCTGCACCTGGCTCTGG + Intergenic
1090557262 11:127889930-127889952 CACCTCCCAGCACCTGCCTTTGG + Intergenic
1091079764 11:132655310-132655332 CACCTGCCTGCACCTGGGCTTGG - Intronic
1202825982 11_KI270721v1_random:89530-89552 CACATGTCAGCACCTGGCCTTGG - Intergenic
1091642796 12:2250293-2250315 CACCTCCCAGCACCTGGAGTTGG + Intronic
1092501344 12:9050887-9050909 CCTCTCTCTGCTCCTGGCACTGG + Intergenic
1093502322 12:19827311-19827333 CGCCACTCTGGACCTGGCTTTGG - Intergenic
1098518135 12:71402505-71402527 TAGCTCTCTGAACCTGGCAGGGG - Intronic
1099199433 12:79658188-79658210 CAGATCTTTGCACCTGGCATTGG + Intronic
1101081524 12:101190499-101190521 TATATCTCTGCACCTGGGATTGG + Exonic
1101319319 12:103659325-103659347 CTCCTCTCTGCATTTGGCCTTGG - Intronic
1101718663 12:107332622-107332644 CACTTCTCTGCCCCTGACAGGGG - Intronic
1103557101 12:121773340-121773362 CACCTCTCTGCCCCAAGCACAGG - Intronic
1103564349 12:121808043-121808065 CACCCCTCTGCACCTCGCTCAGG - Intronic
1104633203 12:130422151-130422173 CACCTCCCTCATCCTGGCATGGG - Intronic
1105247581 13:18666829-18666851 CACCCCTCTGCACATGGCTGTGG + Intergenic
1105284865 13:18995517-18995539 CACCTCTGTCCATCTGGCTTGGG - Intergenic
1106132429 13:26951479-26951501 GGCCTCTCTGCACCTGGCCACGG - Intergenic
1106146602 13:27054867-27054889 CACCCATGTGCACCTGTCATTGG - Intergenic
1107670636 13:42743264-42743286 CACCCCACTTTACCTGGCATGGG + Intergenic
1113091092 13:106618240-106618262 CACCTTTGTGCACCAGTCATTGG + Intergenic
1113794088 13:113046720-113046742 CACCTCTCTGCCCCTCGCCGCGG + Intronic
1114046669 14:18881724-18881746 CACCACCCTGCACATTGCATAGG + Intergenic
1114117542 14:19637723-19637745 CACCACCCTGCACATTGCATAGG - Intergenic
1114646749 14:24260292-24260314 CACCTTTCTGCACCAGGCCTCGG + Intronic
1115192171 14:30757515-30757537 CACATCTTTTCACCTGGCAATGG - Intergenic
1115548960 14:34488109-34488131 AACCTCTTAGCACCTGGCACCGG - Intergenic
1115587245 14:34826973-34826995 CACCTCTCTTCTCCTGCCTTTGG + Intronic
1116255450 14:42548641-42548663 CAGCCCTCTGAACCTGGGATGGG + Intergenic
1117991922 14:61442321-61442343 CACCTCTGTTAACCTGGAATAGG - Intronic
1118737377 14:68711691-68711713 CACCTCTCAGCAGCTGGGCTGGG - Intronic
1120656584 14:87197520-87197542 TACTTCTCTGCACCTTGCAATGG + Intergenic
1121002802 14:90464363-90464385 CTCCTCTGTGCTCCTGGGATTGG + Intergenic
1121312724 14:92943900-92943922 CACCTCTCAGCTCCAGCCATGGG - Intronic
1121789872 14:96690936-96690958 CACGTCCCAGCACTTGGCATAGG - Intergenic
1123181739 14:106477754-106477776 CACCCCTCTGCACCTGCCCTGGG + Intergenic
1202903326 14_GL000194v1_random:55371-55393 CCCCTCTCATCACCTGGCCTGGG - Intergenic
1202945165 14_KI270726v1_random:18974-18996 CACCCCTCTGCACCTGCCCTGGG - Intergenic
1123999194 15:25740697-25740719 CACCTCTGTCTACCTGGCTTTGG + Intronic
1124034530 15:26042577-26042599 CACGTCTCTGACCCAGGCATTGG - Intergenic
1124636357 15:31367278-31367300 CACCTCTCTGCAGCAGGCTGAGG + Intronic
1124658669 15:31527863-31527885 ATCCTCTCAGCACCTGGCACAGG - Intronic
1125519976 15:40343141-40343163 AGCCTCTCTGAACCTGGCAAAGG + Intergenic
1127863227 15:63011704-63011726 CTCCTCTCTGGATCAGGCATAGG + Intergenic
1127914929 15:63447576-63447598 CACCACTTTGCACCAGGCCTAGG + Intergenic
1128078853 15:64844339-64844361 CACCTGTGTGCTCCTGGCCTCGG + Intronic
1128219722 15:65959933-65959955 CACCTCTCACCACAGGGCATTGG + Intronic
1129257234 15:74340535-74340557 CACCTCCCTCCTCCTGGCAGGGG + Intronic
1129532519 15:76280045-76280067 CACACCACTGCACCTGGCCTGGG + Intronic
1130124781 15:81084311-81084333 CTCCTCACTCCACCTGGCTTAGG + Intronic
1130204094 15:81859943-81859965 CACCTGTCTGCTTCTGTCATGGG - Intergenic
1130742477 15:86615650-86615672 CACCTCTGGACAGCTGGCATGGG + Intronic
1131841822 15:96445604-96445626 CACCTACCTGCACCTTGCACGGG - Intergenic
1132658601 16:1051723-1051745 CACCTCTCTGCACCAGAGATCGG + Intergenic
1133374705 16:5274727-5274749 CACCTCTCAGTCCCTTGCATAGG + Intergenic
1133976244 16:10601633-10601655 CAACTCTCTGCACCCAGCCTGGG + Intergenic
1137561253 16:49503622-49503644 CATCGCTCTGCACCTTGCAGAGG + Intronic
1137598959 16:49743452-49743474 CACCTCTCAGCACCCAGCATAGG + Intronic
1138565078 16:57827328-57827350 CACGTCTCTGCAGCCGGCAGTGG - Intronic
1139073950 16:63419928-63419950 CTCCTCTCTTTCCCTGGCATAGG + Intergenic
1139449404 16:67017604-67017626 GGCCTCTCAGCACCTGGCAGGGG + Intergenic
1141683735 16:85558406-85558428 CACCCCTCTTCACCTGCCACTGG + Intergenic
1141827904 16:86493873-86493895 AACTTCTCTGCACCCGGCACTGG + Intergenic
1142607487 17:1090217-1090239 CACCTCTGTGCTCCTGACACTGG - Intronic
1143851084 17:9812599-9812621 AAGCTCTCTGCACCTGGAAGAGG - Intronic
1143940235 17:10533323-10533345 GAACCCTCTGCACCTGGCCTGGG + Exonic
1148231319 17:45936940-45936962 CATCTCTCTCCACCTGGGAGAGG + Intronic
1151685399 17:75643321-75643343 CACCTCTCCGCAGCTGGGCTGGG - Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152464253 17:80456866-80456888 CACCTCTCTGCTCCTCGGCTGGG + Intergenic
1154441261 18:14392293-14392315 CACCCCTCTGCACATGGCTGTGG - Intergenic
1156324726 18:36064188-36064210 CCCCTCTCTGCGGCTGGCAGAGG + Intronic
1156408255 18:36803509-36803531 CACCTCTCTGCAGATGGAAAGGG - Intronic
1157696038 18:49724469-49724491 CACCTGCCTGTACCTGGCATTGG - Intergenic
1158036633 18:53039672-53039694 CATCTCTCTGTCTCTGGCATAGG + Intronic
1161423317 19:4187699-4187721 CACCTCTTTGTGCCTGGCCTGGG + Intronic
1161531690 19:4793462-4793484 CACCCCTCTGCACATGGCTGTGG + Exonic
1163019677 19:14475459-14475481 CCCCTCTCTGCTCCTGGCAATGG + Intergenic
1164619784 19:29687786-29687808 CACCTCCCAGCCCCTGGCAACGG + Intergenic
1165472350 19:36010756-36010778 CACCTCCCTGTCCCTGGCTTGGG - Intronic
1166165232 19:40983073-40983095 CCCCTCCCTGCCCCTGGCAGGGG - Intergenic
1167291131 19:48625829-48625851 CCCCTCCCTGCCCCTGCCATGGG + Intronic
1167493120 19:49803052-49803074 TGCCTGTCTGCACCTGGCCTGGG - Intronic
1168270222 19:55245749-55245771 CTCTTCTCTGCACCGGGCACTGG + Intronic
925110854 2:1335446-1335468 CTCCTCTCTGACCCTGGCTTTGG + Intronic
926225682 2:10965361-10965383 GCCCTCCCTGCACCAGGCATTGG + Intergenic
926758644 2:16256790-16256812 CACGTCACTCCACCTGGCAGGGG + Intergenic
926772417 2:16390308-16390330 CACATCCCTGAACCTGACATAGG + Intergenic
928081950 2:28319674-28319696 CAACTCTCTGCTCCCAGCATGGG - Intronic
928431114 2:31219097-31219119 CAGCACCCTGCACCTGGCACAGG + Intronic
931988095 2:67760350-67760372 CACCTTTCTGTACTTGACATTGG - Intergenic
934503338 2:94875027-94875049 CCCCTCTCATCACCTGGCCTGGG + Intronic
934759551 2:96846175-96846197 CACCCCTCAGCACGTGGCACTGG + Intronic
934987424 2:98897927-98897949 GCCCTCTCTGCACCTTGCTTAGG + Intronic
935063062 2:99624575-99624597 CACCTCCTTGCAAGTGGCATTGG - Intronic
936144994 2:109974948-109974970 CTCCACTCTGAACATGGCATTGG + Intergenic
936181680 2:110272911-110272933 CTCCACTCTGAACATGGCATTGG + Intergenic
936199692 2:110396519-110396541 CTCCACTCTGAACATGGCATTGG - Intergenic
936230886 2:110698769-110698791 CTCCACTCTGAACATGGCATTGG - Intergenic
937126009 2:119475428-119475450 CAGCTCTGGGCACCTGGCCTGGG - Intronic
937716261 2:125037274-125037296 CACCTCTCTGGGGCTGGCAGAGG + Intergenic
938322919 2:130377204-130377226 CAGCTCTCTGCCCCTGAGATTGG - Intergenic
945024736 2:205609244-205609266 CATCTCTGTGCACATAGCATGGG + Intronic
945048677 2:205803174-205803196 CAGCTCTCTGCACTTTGCTTTGG - Intergenic
948127065 2:235572077-235572099 CACAGCTCTGCTCCTGGCTTTGG + Intronic
1170593792 20:17790756-17790778 CCCCTCTCTGCCACTGGCACAGG + Intergenic
1170693333 20:18634869-18634891 CCCCTCTGTGCACCTGTGATGGG - Intronic
1171128136 20:22622931-22622953 CCCCGCTCTCCACATGGCATTGG - Intergenic
1174544827 20:51317512-51317534 CACTTCTGTTCACCTTGCATCGG + Intergenic
1175581446 20:60102900-60102922 CTCCTCTCTGCACCTCACAGAGG - Intergenic
1175771718 20:61628304-61628326 CACCCCTCTGCACATGGAACCGG + Intronic
1175851628 20:62097095-62097117 CACTTCTCGGCTCCTGGCCTGGG - Intergenic
1176622691 21:9070139-9070161 CCCCTCTCATCACCTGGCCTGGG - Intergenic
1177789531 21:25707886-25707908 CACACCACTGCACCAGGCATGGG - Intronic
1178901532 21:36602824-36602846 CAGCTCTCAGCAACTGGCACCGG + Intergenic
1180175367 21:46084539-46084561 CTCCCCTCTGGACCTGGCCTCGG - Intergenic
1180465207 22:15604363-15604385 CACCACCCTGCACATTGCATAGG + Intergenic
1182246773 22:28964436-28964458 CACCCCTCTGCCCCTGGCCCAGG - Intronic
1183661741 22:39225383-39225405 CAGCTCCCTGCCCCTGGCATCGG - Intronic
1184161765 22:42701263-42701285 CACCTCTCTGAACCTGTCTGTGG + Intronic
1185077700 22:48692060-48692082 CTCCTCCCTGAACCTGGGATGGG + Intronic
1185149087 22:49154087-49154109 CACCTCCCTGCCCCTTGCTTAGG - Intergenic
1185252821 22:49814325-49814347 CACCTCGCACCACCTGGCATGGG - Intronic
949367922 3:3302956-3302978 CACCTCTCTGTATCTGGATTCGG - Intergenic
950404668 3:12797085-12797107 CACCCCTCTGCACCCTGCCTCGG + Intronic
950895881 3:16450380-16450402 CACCTCTGTGCACCTGGATGTGG - Intronic
954676245 3:52317275-52317297 CTGCTCTCAGCACCTGGCATGGG - Intronic
954681943 3:52350609-52350631 CTCCACCCCGCACCTGGCATGGG - Intronic
959443131 3:106404329-106404351 CACCACTCTGAACCTTGAATTGG + Intergenic
960636149 3:119786833-119786855 CTCCTCACTGGCCCTGGCATGGG - Intronic
961452915 3:127010530-127010552 CAGCTTCCTGCACCTGGCAGAGG + Intronic
965665458 3:171089010-171089032 CAGCTCTCTGCACCTGCCTCTGG + Intronic
965924720 3:173963804-173963826 CACCTCTGTTCACCAGGAATGGG - Intronic
966321727 3:178708353-178708375 TAGCTCTCTGTGCCTGGCATTGG + Intronic
966405972 3:179598682-179598704 AACCGCTCTGGACTTGGCATTGG + Exonic
968522432 4:1040016-1040038 CACCTCCCTGGACCTGGGCTTGG - Intergenic
972429281 4:38964824-38964846 CTTCACTCTACACCTGGCATGGG - Intergenic
972699526 4:41480680-41480702 CACATCTCTGCTCCTGGAAATGG + Intronic
977761774 4:100746300-100746322 CAAGTCTCTGCACCAGGCAAGGG - Intronic
981229029 4:142331425-142331447 AACCTGGCTGCAACTGGCATAGG + Intronic
985327749 4:188791380-188791402 CATCTCTCTGCAGTTGGGATAGG + Intergenic
985667044 5:1186736-1186758 CATCCCTCAGCACCCGGCATTGG - Intergenic
985931719 5:3063681-3063703 CTCCTCTTAGCACCTGGAATTGG - Intergenic
989292107 5:39780128-39780150 CAGCTCTCTCCACCTGAGATGGG - Intergenic
995233787 5:109801423-109801445 CACATGTCTGCATCTAGCATGGG + Intronic
997249252 5:132376282-132376304 CAACTCTCTGGGCCTGGCTTTGG - Intronic
997364299 5:133315792-133315814 CTCCTCCCTGCAACTGGCAGTGG + Intronic
998478015 5:142437618-142437640 CTACGCTCTGCACCAGGCATCGG - Intergenic
998930883 5:147180471-147180493 AACCTCTCTGCACCTGTCTTTGG + Intergenic
999239652 5:150120170-150120192 CCCCACTCTGCACCTGGGATGGG + Intronic
1000991397 5:167915496-167915518 CAGCTCCCTTCAGCTGGCATTGG + Intronic
1001837738 5:174845947-174845969 CACCTCTTTGTTCCTGCCATGGG - Intergenic
1001985638 5:176072838-176072860 CACCTGTCAACACCTGGCCTGGG - Intronic
1002021143 5:176365327-176365349 CTCCACCCTGCACCTGGCAGGGG + Intergenic
1002231233 5:177765286-177765308 CACCTGTCAACACCTGGCCTGGG + Intronic
1002264104 5:178018462-178018484 CACCTGTCAACACCTGGCCTGGG - Intronic
1002475291 5:179461759-179461781 CACATCCCAGCACCTGGCATGGG + Intergenic
1003496775 6:6670412-6670434 CATCTCTCTGCACGTGAGATGGG - Intergenic
1006023628 6:31133065-31133087 CAGCTCTCTGCCCCTGGAAAAGG + Intronic
1006369538 6:33635439-33635461 CCCCTCTCTGCACCAGACAGTGG + Intronic
1007527832 6:42512161-42512183 CACTCCTATGCACATGGCATAGG - Intergenic
1007833593 6:44657232-44657254 CCCCTGGCTGCACCTGGCATAGG - Intergenic
1013635487 6:112025481-112025503 CACAGCTCTGCACCATGCATGGG + Intergenic
1013667708 6:112365794-112365816 CACCCCTCTGCACATGGCTGTGG - Intergenic
1014477435 6:121890576-121890598 CACCCCTCTGGACATGGGATGGG + Intergenic
1014914300 6:127126932-127126954 CTCTTCTTTGCACTTGGCATGGG + Intronic
1017027834 6:150197268-150197290 CACTTCCCTGCACCTGCCACAGG + Intronic
1019344741 7:523692-523714 CACCTGCCTGCACCTGGGTTGGG + Intergenic
1022473194 7:30694282-30694304 CGCCTCTCAGTGCCTGGCATGGG + Intronic
1024259099 7:47560554-47560576 CACCTCTCTGCTGCTGTCAGGGG + Intronic
1024545289 7:50512675-50512697 CACCTCTTTGCACCTGTGACTGG - Intronic
1028485152 7:91349259-91349281 TACCTCTGTGCTCCTGGCAGGGG - Intergenic
1032541188 7:132704437-132704459 CACTTCTCTGCCCCTGGCAGAGG - Intronic
1033428191 7:141264393-141264415 CACATTTCTGCATCTGGCATGGG - Intronic
1035298904 7:157884398-157884420 CTCCTCTCTGCACCTGGAAGAGG + Intronic
1036661892 8:10714347-10714369 CTCCTCTCTGACCCTGGCCTTGG - Intergenic
1037926185 8:22845848-22845870 CTCCTCTCTGGACCTGGCACGGG + Intronic
1038478751 8:27886985-27887007 CCTCTCTCTGCACGTGGCAGTGG + Intronic
1040588765 8:48769778-48769800 GACCCCGCAGCACCTGGCATGGG - Intergenic
1040813753 8:51484678-51484700 CACCTTCCATCACCTGGCATGGG - Intronic
1042214714 8:66418550-66418572 CACATCTCTGCATCTAACATAGG + Intergenic
1043218705 8:77630138-77630160 CCGCTTTCTGCACCTGACATAGG + Intergenic
1043628786 8:82300068-82300090 AACTTCACTGAACCTGGCATGGG - Intergenic
1045217933 8:100167044-100167066 CACACCACTGCACCTGGCTTGGG - Intronic
1048477262 8:134754808-134754830 CACCCCTCAGCACCTCTCATTGG - Intergenic
1048567275 8:135614890-135614912 CTCCACTCTGCATCTAGCATTGG + Intronic
1049848907 8:144820398-144820420 CATCCCTGAGCACCTGGCATCGG + Intergenic
1051729543 9:20125923-20125945 CACCACTCTGCAGCTGCCAGAGG + Intergenic
1057554562 9:96077212-96077234 CACCTCTCTGCCCCTCGCTGTGG - Intergenic
1058098056 9:100886145-100886167 CCAGTCTCTGCACCTGGCCTGGG - Intergenic
1058545053 9:106052390-106052412 CACCTCCCTGCTTCTGGCAGAGG - Intergenic
1058956331 9:109952034-109952056 CACCTCTCTTTACCTGGAACAGG + Intronic
1059282831 9:113149517-113149539 CACCTCTCTGGGCCTTACATGGG - Intergenic
1060915937 9:127390730-127390752 GACCTCACTGCCCCTGGCTTGGG - Exonic
1061349651 9:130054172-130054194 CACCTCTTTGCCCCTGGCTGCGG + Intronic
1061618280 9:131794225-131794247 CACCTCTGGGCACCTGGTGTAGG + Intergenic
1061973600 9:134057417-134057439 CACCTCACCTCACCTGGCAGAGG - Intronic
1203745882 Un_GL000218v1:40567-40589 CCCCTCTCATCACCTGGCCTGGG - Intergenic
1185485229 X:476919-476941 CACCGGTCTGCACCTGTCACAGG + Intergenic
1190165793 X:48071841-48071863 CACTTCTCCCCACCTGGCCTCGG + Intergenic
1190658604 X:52634742-52634764 TTCCTCTCTGCACCTTGCAATGG - Intergenic
1195094071 X:101489380-101489402 CACCTCCCTGGACATGCCATTGG - Exonic
1195411048 X:104567791-104567813 TGCCTCTCTGGGCCTGGCATTGG + Intronic
1198203553 X:134445364-134445386 CACCCCTCTGCACCTGCCAGGGG + Intergenic
1199095709 X:143736084-143736106 CACCACTCTGCAGCTGGGGTTGG - Intergenic
1199652603 X:149961541-149961563 TATCTCTCTGCACCTGACCTGGG - Intergenic
1200143028 X:153911062-153911084 CAGTTCCCAGCACCTGGCATGGG - Intronic
1201901646 Y:19049867-19049889 CACCTCTTTGTGCCTGGCGTGGG + Intergenic