ID: 900649318

View in Genome Browser
Species Human (GRCh38)
Location 1:3723255-3723277
Sequence CACCCTTTGAACCCGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900649312_900649318 4 Left 900649312 1:3723228-3723250 CCTCTCTGCACCTGACATGGGGC 0: 2
1: 2
2: 6
3: 27
4: 222
Right 900649318 1:3723255-3723277 CACCCTTTGAACCCGGCACAGGG 0: 1
1: 0
2: 0
3: 2
4: 83
900649308_900649318 23 Left 900649308 1:3723209-3723231 CCTGGCACGGGGCTGGGTACCTC 0: 1
1: 0
2: 5
3: 44
4: 721
Right 900649318 1:3723255-3723277 CACCCTTTGAACCCGGCACAGGG 0: 1
1: 0
2: 0
3: 2
4: 83
900649315_900649318 -6 Left 900649315 1:3723238-3723260 CCTGACATGGGGCTGGGCACCCT 0: 1
1: 0
2: 1
3: 49
4: 552
Right 900649318 1:3723255-3723277 CACCCTTTGAACCCGGCACAGGG 0: 1
1: 0
2: 0
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900649318 Original CRISPR CACCCTTTGAACCCGGCACA GGG Intronic
900649318 1:3723255-3723277 CACCCTTTGAACCCGGCACAGGG + Intronic
901329937 1:8398756-8398778 CACCCATGGAATCTGGCACAGGG + Intronic
902778299 1:18688825-18688847 AACCATTTGAACCCGGGAGATGG + Intronic
906460520 1:46032481-46032503 CACCCTTTGACCCCCGAGCAGGG - Intronic
912650830 1:111437486-111437508 CACCCTTTGATCTAGGCACCTGG - Intergenic
915469274 1:156115869-156115891 AACCCTTAGAACCCAGGACAAGG - Intronic
915484984 1:156213996-156214018 AATCCTTTGAACCCGGGAGACGG - Intronic
917434153 1:175001826-175001848 AATCCTTTGAACCCGGGAGACGG - Intronic
920868784 1:209775673-209775695 GACCCTTGGGACCCAGCACAGGG + Exonic
924694370 1:246383101-246383123 CACCTATTGACCCAGGCACAAGG + Intronic
1065921024 10:30392823-30392845 CACCGTTTGAAATCGACACATGG + Intergenic
1069215275 10:65812029-65812051 CACCCAGTGAATCCGGCACTAGG + Intergenic
1070245186 10:74724334-74724356 AATCATTTGAACCCGGGACATGG + Intergenic
1072667685 10:97406231-97406253 CAGCCTGTGACCCAGGCACAGGG - Intronic
1073156246 10:101349325-101349347 AACCCCTTGAACCCGGGAGATGG - Intergenic
1083830713 11:65231557-65231579 AATCCCTTGAACCCGGGACACGG - Intergenic
1100409739 12:94304077-94304099 TAACCTTTGAATCAGGCACAAGG + Intronic
1103500618 12:121399262-121399284 AATCCTTTGAACCCGGGAGACGG + Intronic
1104465840 12:128989649-128989671 CAGCTTTTCAACCAGGCACATGG - Intergenic
1115523401 14:34255353-34255375 CATCCTTTGAACCCAACAAAAGG + Intronic
1116868223 14:50048492-50048514 CATCCCTAGAACCCGGCACAGGG + Intergenic
1132495716 16:262364-262386 CACGCTGTGAACCCGGACCAGGG - Intronic
1133797295 16:9056475-9056497 AACCGCTTGAACCCGGGACACGG + Intergenic
1135892057 16:26366114-26366136 CCCCCATAGAACCCAGCACAGGG - Intergenic
1138089002 16:54158971-54158993 CAACCTTTGACCCCGCCAGATGG + Intergenic
1143289584 17:5818802-5818824 CACCTTGTTAACCCGGGACAAGG - Intronic
1143863224 17:9906026-9906048 CACACTTAGAAACTGGCACATGG + Intergenic
1151386817 17:73760119-73760141 CACCCTTTGCTCCCTGCCCAAGG - Intergenic
1151755670 17:76074227-76074249 AACCGTTTGAACCCGGGAGACGG + Intronic
1158392212 18:57052929-57052951 CACCCTTTGACCCCTGCAGCAGG + Intergenic
1161748172 19:6074528-6074550 CAGCACTTGAAGCCGGCACATGG - Intronic
1164902386 19:31939062-31939084 CACCATCTGTACCAGGCACAGGG + Intergenic
926686845 2:15704605-15704627 TACACTTTGAAACCAGCACAGGG - Intronic
926850724 2:17193936-17193958 CACCCAGTGGATCCGGCACAGGG - Intergenic
928431810 2:31226439-31226461 CTCTCTTTTAACCCTGCACAGGG - Intronic
937999007 2:127717172-127717194 CCCCCTCTGAACCCCGGACAAGG - Exonic
945338348 2:208619047-208619069 CACACTTAGAACCCTGCAAAGGG - Intronic
946497932 2:220214716-220214738 AACACTTAGAACCAGGCACATGG + Intergenic
947937108 2:234016625-234016647 CAACCTTTGATCCCGGAACTTGG + Intronic
948653520 2:239463401-239463423 CACCCTTTCAACCCGGCTGGAGG + Intergenic
1171007258 20:21478701-21478723 AATCCTTTGAACCCGGGAGATGG + Intergenic
1171973341 20:31578504-31578526 CACCCTGTGGATCCCGCACAGGG + Intergenic
1174600988 20:51724680-51724702 CACCCCCAGAACCCAGCACAGGG + Intronic
1176027854 20:62995121-62995143 CACCCTGTCAACCCGGCGCCCGG + Intergenic
1179717915 21:43299483-43299505 CAGCCTCAGAACCAGGCACAGGG + Intergenic
1182658699 22:31909810-31909832 AACCATTTGAACCCGGGAGATGG + Intergenic
1183325426 22:37188753-37188775 CCCCCTTTGTGCCAGGCACATGG + Intronic
1183725018 22:39583756-39583778 CATCCTTTGAACCACTCACAAGG + Intronic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
949153400 3:798393-798415 CACCCTGTAAACCCAGCACCTGG - Intergenic
949555484 3:5148808-5148830 CAACCCTTGAACCAGGCAAAAGG - Intronic
950708452 3:14798336-14798358 CACCGATAGAACCTGGCACAAGG - Intergenic
953811643 3:46117644-46117666 CAACCCTTGAACCAGGGACAAGG - Intergenic
954712818 3:52513362-52513384 CATCCTTTGAGCCCGGCTCTGGG - Intronic
959072409 3:101714992-101715014 AATCGCTTGAACCCGGCACAGGG - Intergenic
964751937 3:160060953-160060975 CACCCAGTGGACCCTGCACAGGG - Intergenic
967946775 3:194810344-194810366 CCCACTTTGCACCCGGCACTGGG - Intergenic
973713347 4:53650873-53650895 CTCCCTTGGAGCCAGGCACATGG + Intronic
976504636 4:85832553-85832575 AACCCATTGAACACCGCACATGG - Intronic
976585052 4:86787503-86787525 AATCCTTTGAACCTGGCAGACGG + Intronic
982738369 4:159030755-159030777 CACCCTGTGATCCCAGCACCTGG - Intronic
983118841 4:163854436-163854458 AACACTTAGAACCTGGCACAAGG - Intronic
984835594 4:184017150-184017172 CCCGCTTTGAGCCCGGCCCATGG + Exonic
998615714 5:143737897-143737919 CACCCTTTGAAAACTTCACAGGG - Intergenic
1002299676 5:178250180-178250202 CACACTGTGCACCCGGCCCAGGG + Intronic
1009602891 6:65825828-65825850 CATCCTTTGAACCCCACTCATGG - Intergenic
1016378205 6:143445765-143445787 CAGCCTATGCACCCAGCACAAGG + Intronic
1017690979 6:156964044-156964066 CACCCTTGGAAGCAGTCACAAGG + Intronic
1019863639 7:3684266-3684288 CACCCTTTCAGTCAGGCACAGGG + Intronic
1020146205 7:5645675-5645697 AATCATTTGAACCCGGCAGATGG - Intronic
1020451621 7:8326154-8326176 CACCCTTTTAATGTGGCACACGG - Intergenic
1028148628 7:87346103-87346125 TACCCTTTGAACCCGTCTAATGG + Intronic
1029925245 7:104308898-104308920 CACCCTGTGATCTCTGCACATGG + Intergenic
1035986072 8:4433410-4433432 CAACCTTTGAACCAGGAATAGGG + Intronic
1036721199 8:11177120-11177142 CATCATTTCAACCTGGCACATGG - Intronic
1040531751 8:48271789-48271811 CACTCTTTGAAACATGCACAGGG - Intergenic
1045347252 8:101304423-101304445 CATTCTTTAAACCCAGCACAGGG + Intergenic
1047314622 8:123721347-123721369 CTACCTTTGAACCAGGCACGAGG + Intronic
1049812629 8:144582294-144582316 CACCCTTTGAAACCAGGCCAGGG + Intronic
1062473500 9:136716660-136716682 CACCCTGTAAACCCAGCACTCGG - Intronic
1187233383 X:17443702-17443724 CACCATTTGAACAAGGCAGAGGG - Intronic
1189231243 X:39454102-39454124 GACTCTTTGAACAGGGCACATGG - Intergenic
1193230625 X:79041346-79041368 CACCCTCTGAAGCCAGCAGAAGG - Intergenic
1194932660 X:99906517-99906539 CACCCTATGAACTCTCCACATGG - Intergenic
1196724685 X:118885570-118885592 CAACCCTTGAACCAGGGACAAGG + Intergenic
1197464935 X:126792139-126792161 CTCCCTCTGAACCCTGCAAATGG + Intergenic