ID: 900650315

View in Genome Browser
Species Human (GRCh38)
Location 1:3727191-3727213
Sequence CAGGGTGATGATGATGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1974
Summary {0: 1, 1: 1, 2: 15, 3: 212, 4: 1745}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900650315_900650323 0 Left 900650315 1:3727191-3727213 CCATCCTCATCATCATCACCCTG 0: 1
1: 1
2: 15
3: 212
4: 1745
Right 900650323 1:3727214-3727236 GAGATGCGGGAGTGAGTCCCGGG 0: 1
1: 0
2: 1
3: 20
4: 199
900650315_900650327 12 Left 900650315 1:3727191-3727213 CCATCCTCATCATCATCACCCTG 0: 1
1: 1
2: 15
3: 212
4: 1745
Right 900650327 1:3727226-3727248 TGAGTCCCGGGCACACGGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 116
900650315_900650334 25 Left 900650315 1:3727191-3727213 CCATCCTCATCATCATCACCCTG 0: 1
1: 1
2: 15
3: 212
4: 1745
Right 900650334 1:3727239-3727261 CACGGGGTGGAGGTGGGACAGGG 0: 1
1: 1
2: 5
3: 58
4: 577
900650315_900650331 18 Left 900650315 1:3727191-3727213 CCATCCTCATCATCATCACCCTG 0: 1
1: 1
2: 15
3: 212
4: 1745
Right 900650331 1:3727232-3727254 CCGGGCACACGGGGTGGAGGTGG 0: 1
1: 0
2: 1
3: 25
4: 300
900650315_900650333 24 Left 900650315 1:3727191-3727213 CCATCCTCATCATCATCACCCTG 0: 1
1: 1
2: 15
3: 212
4: 1745
Right 900650333 1:3727238-3727260 ACACGGGGTGGAGGTGGGACAGG 0: 1
1: 0
2: 2
3: 33
4: 395
900650315_900650336 30 Left 900650315 1:3727191-3727213 CCATCCTCATCATCATCACCCTG 0: 1
1: 1
2: 15
3: 212
4: 1745
Right 900650336 1:3727244-3727266 GGTGGAGGTGGGACAGGGCTGGG 0: 1
1: 0
2: 8
3: 137
4: 1070
900650315_900650332 19 Left 900650315 1:3727191-3727213 CCATCCTCATCATCATCACCCTG 0: 1
1: 1
2: 15
3: 212
4: 1745
Right 900650332 1:3727233-3727255 CGGGCACACGGGGTGGAGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 230
900650315_900650325 8 Left 900650315 1:3727191-3727213 CCATCCTCATCATCATCACCCTG 0: 1
1: 1
2: 15
3: 212
4: 1745
Right 900650325 1:3727222-3727244 GGAGTGAGTCCCGGGCACACGGG 0: 1
1: 0
2: 1
3: 14
4: 229
900650315_900650322 -1 Left 900650315 1:3727191-3727213 CCATCCTCATCATCATCACCCTG 0: 1
1: 1
2: 15
3: 212
4: 1745
Right 900650322 1:3727213-3727235 GGAGATGCGGGAGTGAGTCCCGG 0: 1
1: 0
2: 3
3: 16
4: 243
900650315_900650324 7 Left 900650315 1:3727191-3727213 CCATCCTCATCATCATCACCCTG 0: 1
1: 1
2: 15
3: 212
4: 1745
Right 900650324 1:3727221-3727243 GGGAGTGAGTCCCGGGCACACGG 0: 1
1: 0
2: 1
3: 17
4: 234
900650315_900650326 9 Left 900650315 1:3727191-3727213 CCATCCTCATCATCATCACCCTG 0: 1
1: 1
2: 15
3: 212
4: 1745
Right 900650326 1:3727223-3727245 GAGTGAGTCCCGGGCACACGGGG 0: 1
1: 0
2: 0
3: 7
4: 88
900650315_900650335 29 Left 900650315 1:3727191-3727213 CCATCCTCATCATCATCACCCTG 0: 1
1: 1
2: 15
3: 212
4: 1745
Right 900650335 1:3727243-3727265 GGGTGGAGGTGGGACAGGGCTGG 0: 1
1: 0
2: 13
3: 198
4: 1488
900650315_900650328 15 Left 900650315 1:3727191-3727213 CCATCCTCATCATCATCACCCTG 0: 1
1: 1
2: 15
3: 212
4: 1745
Right 900650328 1:3727229-3727251 GTCCCGGGCACACGGGGTGGAGG 0: 1
1: 0
2: 1
3: 23
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900650315 Original CRISPR CAGGGTGATGATGATGAGGA TGG (reversed) Exonic
900334513 1:2155137-2155159 GATGGTGATGATGGTGATGATGG + Intronic
900488176 1:2933342-2933364 CAGGGTGATGAGGATGAAATGGG + Intergenic
900505091 1:3026082-3026104 GATGGTGAGGATGATGATGATGG + Intergenic
900505116 1:3026276-3026298 GATGGTGATGGTGATGATGATGG + Intergenic
900650315 1:3727191-3727213 CAGGGTGATGATGATGAGGATGG - Exonic
900716056 1:4144846-4144868 GATGGTGATGATGGTGATGATGG - Intergenic
900742099 1:4336723-4336745 GATGGTGATGATGATGGTGATGG + Intergenic
900747303 1:4369514-4369536 GATGATGATGATGATGATGATGG + Intergenic
900768864 1:4524725-4524747 AATGATGATGATGATGATGATGG + Intergenic
900805814 1:4767676-4767698 GATGGTGATGGTGATGATGATGG - Intronic
901127138 1:6937591-6937613 GATGGTGATGATGATGGTGATGG - Intronic
901127147 1:6937656-6937678 GATGGTGATGATGATGGTGATGG - Intronic
901193965 1:7429619-7429641 GATGGTGATAATGATGATGATGG + Intronic
901194044 1:7430217-7430239 TATGGTGGTGATGATGATGATGG + Intronic
901194065 1:7430409-7430431 CAGGAGGATGATGATGATGGTGG + Intronic
901218468 1:7568087-7568109 GGTGGTGATGATGATGATGATGG - Intronic
901218587 1:7569123-7569145 CGTGGTGATGATGATGGAGATGG - Intronic
901218599 1:7569235-7569257 TTTGGTGATGATGATGATGATGG - Intronic
901218637 1:7569615-7569637 CATGATGATGATGATGAAGATGG - Intronic
901275817 1:7990219-7990241 GAGGGTGATGGTGATGACGGTGG - Intergenic
901385819 1:8908447-8908469 CACACTGATGATGACGAGGAAGG - Intergenic
901565072 1:10107307-10107329 GATGGTGATGGTGATGATGAAGG + Intronic
901638462 1:10681236-10681258 CAGGGTGAGGATGGGGATGAGGG - Intronic
901670754 1:10855212-10855234 GAGGGTGATGACGATGATGGTGG - Intergenic
901825319 1:11857688-11857710 GAGGGTGATGATGGTTAGGGTGG + Intronic
901844426 1:11972951-11972973 CAGGGCGATGTTGATGGTGAAGG - Exonic
902150154 1:14436329-14436351 GAGGATGATGATGATGACCATGG + Intergenic
902391213 1:16108085-16108107 CACACTGATGATGAGGAGGAAGG - Intergenic
902548106 1:17202951-17202973 AAAGATGATGATGATGATGATGG - Intergenic
902751218 1:18512593-18512615 GATGGTGACGATGATGGGGAAGG + Intergenic
902838569 1:19061519-19061541 GATGATGATGATGATGATGATGG - Intergenic
902957085 1:19933064-19933086 GGTGGTGATGATGATGATGATGG - Intergenic
902995740 1:20223419-20223441 TAGGGTGCTGATGGTGGGGATGG - Intergenic
903030918 1:20463764-20463786 GATGATGATGATGATGATGATGG - Intergenic
903287337 1:22285391-22285413 CCGGATGCTGATGAAGAGGAAGG + Intergenic
903392140 1:22972173-22972195 GATGATGATGATGATGATGAAGG + Intergenic
903420359 1:23214635-23214657 CAGGGTGATGTGGTGGAGGAGGG - Intergenic
903476924 1:23625979-23626001 GATGGTGATGGTGATGATGATGG + Intronic
903476940 1:23626084-23626106 GATGGTGATGGTGATGATGATGG + Intronic
903583076 1:24386993-24387015 GATGGTGATGATGATGATGGCGG - Intronic
903835065 1:26198365-26198387 CTGGGTGATGCAGATGAAGAGGG - Exonic
904324441 1:29718917-29718939 GATGGTGATGATGATGAAGGTGG - Intergenic
904324455 1:29719034-29719056 GAAGGTGATGGTGATGATGATGG - Intergenic
904413342 1:30338836-30338858 GATGGTGATGGTGATGATGATGG + Intergenic
904413349 1:30338956-30338978 GATGGTAATGATGATGATGATGG + Intergenic
904413354 1:30339019-30339041 AATGGTGATGGTGATGATGATGG + Intergenic
904431017 1:30464219-30464241 GATGGTGATGATGATGGTGATGG + Intergenic
904431030 1:30464369-30464391 GATGGTGATGATGATGGTGATGG + Intergenic
904431108 1:30465076-30465098 GATGATGATGATGATGATGATGG + Intergenic
904434969 1:30488878-30488900 AATGGTGATGATGGTGATGATGG + Intergenic
904439260 1:30519265-30519287 GAGGATGATGATGATGATGGTGG + Intergenic
904439278 1:30519460-30519482 GAGGATGATGACGATGATGATGG + Intergenic
904471971 1:30741664-30741686 CAGGCTGATGATGAAGAGCATGG + Exonic
904565471 1:31425803-31425825 CTGGATGAGGATGAAGAGGAAGG - Exonic
904634301 1:31867772-31867794 GAGGGTGATCATGACGAAGAAGG - Intergenic
904789774 1:33010717-33010739 CAGGGTGAGGATGGTGAGGGAGG - Intronic
904880480 1:33692859-33692881 CCTGGTGATGATGCTGATGATGG + Intronic
904978114 1:34473828-34473850 CTGGTTGATCAAGATGAGGAAGG + Intergenic
905871595 1:41407535-41407557 CAGGGTGAACATGAGAAGGATGG - Intergenic
906150170 1:43583030-43583052 GAGTGCGATGAAGATGAGGAGGG - Intronic
906449928 1:45936764-45936786 CAAGATGATGATGATGATGGTGG - Intronic
906856997 1:49318408-49318430 GATGATGATGATGATGATGACGG + Intronic
906874638 1:49523956-49523978 GATGATGATGATGATGATGATGG - Intronic
906955294 1:50369113-50369135 GGTGGTGATGATGATGATGATGG + Intergenic
906955319 1:50369303-50369325 GATGGTGATGATGATGATGGTGG + Intergenic
906955328 1:50369378-50369400 GGTGGTGATGATGATGATGATGG + Intergenic
907070157 1:51527350-51527372 GATGATGATGATGATGATGATGG + Intergenic
907245272 1:53104344-53104366 CAACGTGATGATGACGATGATGG - Intronic
907507035 1:54926859-54926881 GAGGCTGATGGTGATGAGGATGG - Intergenic
907517669 1:55003056-55003078 GACGGTGATGATGATGGTGACGG + Intronic
907724717 1:57008439-57008461 GATGGTGATGGTGATGATGAGGG + Intronic
907818647 1:57945242-57945264 GATGATGATGATGATGACGATGG - Intronic
907890295 1:58630729-58630751 CAGGGTGAGGATGGTGAGGGAGG - Intergenic
907908066 1:58802816-58802838 GATGATGATGATGATGATGATGG + Intergenic
907908067 1:58802834-58802856 GATGGTGATGATGATGATGAAGG + Intergenic
908634025 1:66142170-66142192 CAGGTTGAGGAGGAAGAGGAAGG + Intronic
908885011 1:68779088-68779110 CAGGGTGATGATGTCTAGCAAGG - Intergenic
909040517 1:70643895-70643917 GATGGTGATGATGATGATTATGG - Intergenic
909345299 1:74578292-74578314 GATGATGATGATGATGATGATGG + Intronic
909535266 1:76728633-76728655 GAGGGAGATGCTGAGGAGGAGGG - Intergenic
909541120 1:76792532-76792554 GATGATGATGATGATGATGATGG - Intergenic
909822675 1:80086017-80086039 CAAGGTCTTGGTGATGAGGATGG + Intergenic
910206239 1:84751602-84751624 CAGGGTGGTGGTGGGGAGGAGGG - Intergenic
910429120 1:87143700-87143722 CAGGATGATGATGACGATGATGG + Intronic
910896426 1:92074651-92074673 GATGATGATGATGATGATGATGG - Exonic
911415249 1:97563805-97563827 AAGGGTGGAGGTGATGAGGATGG - Intronic
911864882 1:103005900-103005922 GATGATGATGATGATGATGATGG - Intronic
912179972 1:107208021-107208043 CACGATCATGATGAAGAGGAGGG - Intronic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
912561953 1:110557333-110557355 TAAGGTGATGGTGATGATGATGG + Intergenic
913071554 1:115303545-115303567 GATGGTGATGATGATGATGACGG - Intronic
913334401 1:117695917-117695939 CAGTGAGATGATGCTGAGGGAGG + Intergenic
914260138 1:145992118-145992140 CAGGGAGATGATGTTTATGAGGG - Intergenic
915052668 1:153092720-153092742 GATGATGATGATGATGATGATGG + Intergenic
915053846 1:153106824-153106846 CAGGGTGATGGTTATGGGGAAGG + Intergenic
915346644 1:155200919-155200941 CAGTGTGATGATGATGCTGATGG - Exonic
915826861 1:159087284-159087306 CAGGGTGATGGTAAGGATGATGG + Intronic
916085913 1:161269238-161269260 CAGGGTGCTGAGGGTGGGGAAGG + Intronic
916346203 1:163794171-163794193 GATGGTGATGATGATGACCATGG + Intergenic
916514112 1:165499233-165499255 CAGGGTGATGCTGATGATACTGG + Intergenic
916576918 1:166075550-166075572 GAGCATGAGGATGATGAGGACGG + Intronic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
918067159 1:181109199-181109221 CAGGGGGCTGCTGATGGGGATGG - Intergenic
919259443 1:195172889-195172911 AAAGATGATGATGATGATGACGG + Intergenic
919507031 1:198412218-198412240 CAATGTGAAGATGATGACGATGG - Intergenic
919754664 1:201059225-201059247 CAGGGTGAAGATGATAGTGAAGG + Exonic
920725559 1:208431595-208431617 AATGGTGATGATGATTATGAGGG + Intergenic
920848392 1:209612063-209612085 CAGGCTGCTGCTGATGTGGAGGG - Exonic
920864984 1:209744403-209744425 CAGGCTGATGATGATGGCAAAGG - Intergenic
921276311 1:213524272-213524294 CTGGGTGATGGTGAGGAGCAGGG - Intergenic
921300890 1:213750514-213750536 CAGGGTGCTGAGAATAAGGATGG + Intergenic
922001317 1:221481246-221481268 AAGGAAGATGATGATGATGATGG - Intergenic
922212312 1:223495635-223495657 CAGGTGGAGGATGGTGAGGAGGG - Intergenic
922525992 1:226304538-226304560 CAGGGTGATATTGGTGGGGACGG + Intronic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923083048 1:230678306-230678328 GATGATGATGATGATGATGATGG + Intronic
923216133 1:231849509-231849531 CAGGGCTCTGATGATGATGATGG + Intronic
923820571 1:237435942-237435964 CAGGATGATTATGATCAGGCTGG + Intronic
924206466 1:241716656-241716678 GATGATGATGATGATGATGATGG + Intronic
924522484 1:244817022-244817044 CAGGGTGGGGAAGGTGAGGAAGG - Intergenic
924765152 1:247025345-247025367 CACACTGATGATGAGGAGGAAGG + Intergenic
1062912360 10:1219842-1219864 GATGGTGATGGTGATGATGATGG + Intronic
1062912413 10:1220179-1220201 GATGGTGGTGATGATGATGATGG + Intronic
1062912444 10:1220357-1220379 GATGGTGATGATGATGGTGATGG + Intronic
1062950405 10:1496089-1496111 GATGGTGATGACGATGATGATGG - Intronic
1062950416 10:1496368-1496390 GATGGTGATGATGACGATGATGG - Intronic
1062950433 10:1496782-1496804 GTTGGTGATGATGATGATGACGG - Intronic
1063012434 10:2037470-2037492 CATGGTGATGATGATGTTGATGG + Intergenic
1063012437 10:2037488-2037510 GATGGTGATGAGGATGATGAGGG + Intergenic
1063033702 10:2263124-2263146 GAAGATGATGATGATGATGATGG + Intergenic
1063206984 10:3841991-3842013 CACAGTGATGGTGATGATGATGG - Intergenic
1064425953 10:15229522-15229544 GATGGTGATGATGGTGAGGGGGG - Intronic
1064425958 10:15229531-15229553 AATGGTGATGATGGTGATGATGG - Intronic
1064425966 10:15229573-15229595 GATGGTGATGATGATGACGTTGG - Intronic
1064425987 10:15229699-15229721 GATGGTGGTGATGATGATGATGG - Intronic
1064426009 10:15229822-15229844 GATGGTGGTGATGATGATGATGG - Intronic
1064426026 10:15229918-15229940 GATGGTGATGATGATGATGTTGG - Intronic
1064456186 10:15489612-15489634 GATGATGATGATGATGATGATGG + Intergenic
1064609047 10:17078070-17078092 GACGATGATGATGATGATGATGG - Intronic
1064736491 10:18386893-18386915 AAATGTGATGATGATGATGAAGG + Intronic
1065115600 10:22479871-22479893 CATGGTGATGGTGATGGTGATGG - Intergenic
1065123812 10:22553716-22553738 CACAGTGATGATGATGACGATGG - Intronic
1065145452 10:22763630-22763652 GAGGAAGAAGATGATGAGGATGG + Intergenic
1065569002 10:27048876-27048898 GAAGATGATGATGATGATGATGG - Exonic
1065832590 10:29628900-29628922 CAGGGTGTGGATGCTGAGTATGG + Intronic
1065930413 10:30473886-30473908 CAGGGTGAGTAGGATGAGTAGGG + Intergenic
1065979901 10:30883399-30883421 GAGGATGATGATAATGATGATGG - Intronic
1066000819 10:31102804-31102826 CAGGGTGATGGAGACCAGGAGGG + Intergenic
1066122133 10:32299540-32299562 GATGATGATGATGATGATGATGG - Intronic
1066293187 10:34032428-34032450 CATGATGAAGATGATGAAGATGG + Intergenic
1066343119 10:34555850-34555872 CAGGGTGATGACAATGAAGGTGG - Intronic
1066559256 10:36651363-36651385 TAGGGTGATGAAGAGGAGAAGGG - Intergenic
1067181961 10:43994779-43994801 GATGATGATGATGATGATGATGG - Intergenic
1067290216 10:44934659-44934681 CAGGCCGGTGATGATGAGCATGG - Exonic
1067759582 10:49034193-49034215 GATGGTGATGATGGTGATGATGG - Intronic
1067794473 10:49310780-49310802 GATGATGATGATGATGATGATGG + Intronic
1068027136 10:51660298-51660320 GATGATGATGATGATGATGAAGG - Intronic
1068083028 10:52343433-52343455 CAGGATGATGATGATGATGATGG + Intergenic
1068166675 10:53340295-53340317 CACACTGATGATGAGGAGGAAGG - Intergenic
1068245514 10:54360689-54360711 TAGGATGATGATGATGATGTAGG - Intronic
1068485003 10:57646512-57646534 CAGGCTGAGGACGATGGGGAAGG + Intergenic
1068600481 10:58951485-58951507 AAGGGAGATGATCATGAGAAGGG + Intergenic
1068982889 10:63079962-63079984 AAAAGTGATGATGATGATGATGG + Intergenic
1069186644 10:65430775-65430797 GATGATGATGATGATGATGATGG - Intergenic
1069561391 10:69432972-69432994 CATGGCGAAGAGGATGAGGAAGG + Intergenic
1069792672 10:71033168-71033190 AATGGTGATGATGATGATGATGG + Intergenic
1069852683 10:71420394-71420416 GATGGTGATGGTGATGATGATGG + Intronic
1069852684 10:71420400-71420422 GATGGTGATGATGATGGTGATGG + Intronic
1069852685 10:71420418-71420440 GATGGTGATGATGATGATGATGG + Intronic
1069852687 10:71420448-71420470 GATGGTGATGATAATGATGATGG + Intronic
1069852689 10:71420466-71420488 GATGGTGATGATGATGGTGATGG + Intronic
1069852697 10:71420561-71420583 GATGATGATGATGATGATGATGG + Intronic
1069902932 10:71716212-71716234 CAGGGCGATGAGCATGGGGAGGG + Exonic
1069995664 10:72340775-72340797 CAGGGTGATGTGAGTGAGGAGGG - Exonic
1070121198 10:73579050-73579072 GAGGGTGATGGGGCTGAGGAAGG - Intronic
1070442682 10:76462454-76462476 CTGGGTGAAGAGGAAGAGGATGG - Intronic
1070650297 10:78230526-78230548 GAGGGTGATGGTGGTGAAGATGG - Intergenic
1070697661 10:78574795-78574817 CAGGGTGATGCTCCTGAGCAGGG + Intergenic
1070749448 10:78955332-78955354 CAGGGTGAGGATCAGGAGGTAGG - Intergenic
1070758837 10:79010557-79010579 GGTGATGATGATGATGAGGACGG - Intergenic
1070830100 10:79412923-79412945 AATGGTGATGATGATGTTGATGG - Intronic
1071090021 10:81907420-81907442 GTGGATGATGATGATGATGATGG + Intronic
1071356829 10:84805333-84805355 GATGATGATGATGATGATGATGG - Intergenic
1071393711 10:85200645-85200667 CAGAGTGATGATAATGATAATGG - Intergenic
1071488714 10:86121481-86121503 GATGGTGATGATGGTGATGATGG - Intronic
1071488718 10:86121520-86121542 GATGGTGATGATGGTGATGATGG - Intronic
1071601639 10:86961441-86961463 CATGATGATGATGATGATGATGG - Intronic
1071772197 10:88741670-88741692 AAGAGTGATGATCATGATGATGG + Intronic
1071958259 10:90782450-90782472 GATGATGATGATGATGATGATGG + Intronic
1072082263 10:92044173-92044195 GATGATGATGATGATGAAGACGG + Intergenic
1072215701 10:93285602-93285624 GAGGGTGGTGATGAGGATGAGGG + Intergenic
1072226578 10:93375692-93375714 CAACGAGATGATGATGAGGATGG - Intronic
1072464234 10:95648318-95648340 GATGATGATGATGATGATGAAGG - Intronic
1072572572 10:96671666-96671688 GATGATGATGATGATGACGACGG - Intronic
1072978076 10:100076402-100076424 CAGGGTGAGGGTAATAAGGATGG + Intronic
1072985236 10:100133907-100133929 CAGGGGGATGGAGAGGAGGAAGG - Intergenic
1073096585 10:100983832-100983854 GAGGGTGATGATGAGGGGGCTGG + Exonic
1073178682 10:101571051-101571073 CAAGGTCAGGATGATGAGGGAGG + Intronic
1073551587 10:104407313-104407335 GATGATGATGATGATGATGATGG - Intronic
1073580211 10:104658728-104658750 CATGATGATGATGATGATGATGG + Intronic
1073660165 10:105466697-105466719 GATGATGATGATGATGATGATGG - Intergenic
1074136538 10:110632116-110632138 GATGATGATGATGATGATGATGG + Intergenic
1074379156 10:112964720-112964742 GATGATGATGATGATGATGATGG + Intronic
1074388434 10:113036115-113036137 GATGATGATGATGATGATGATGG - Intronic
1074503226 10:114044410-114044432 CAGGGACATGATGAAGAGGTTGG - Exonic
1074556444 10:114495447-114495469 GATGATGATGATGATGATGATGG + Intronic
1075088063 10:119426814-119426836 GATGGTGATGATGCTGATGATGG - Intronic
1075088099 10:119427238-119427260 GATGGTGATGATGCTGATGATGG - Intronic
1075088107 10:119427347-119427369 GATGGTGATGATGCTGATGATGG - Intronic
1075088130 10:119427581-119427603 GATGGTGATGATGCTGATGATGG - Intronic
1075175881 10:120160724-120160746 CTGGGTGATGATGGTGAGCGAGG + Intergenic
1075584234 10:123645571-123645593 CAGGGTGGTGGTGGTGATGATGG + Intergenic
1075622144 10:123935746-123935768 GATGGTGATGGTGATGATGATGG - Intronic
1075677519 10:124305926-124305948 AATGGTGATGATAATGAAGATGG - Intergenic
1075677530 10:124306035-124306057 AATGGTGATGATAATGAAGATGG - Intergenic
1075677550 10:124306221-124306243 GATGGTGATGATGATTATGATGG - Intergenic
1075677562 10:124306314-124306336 AATGATGATGATGATGATGATGG - Intergenic
1075926698 10:126256923-126256945 GATGATGATGATGATGATGATGG + Intronic
1076065577 10:127445199-127445221 CAGGGAGAAGGTGCTGAGGATGG + Intronic
1076720887 10:132392429-132392451 GATGGTGATCATGATGATGATGG + Intergenic
1076728784 10:132427389-132427411 GATAGTGATGATGATGATGATGG - Intergenic
1076728818 10:132428029-132428051 TGGTGTGATGATGATGATGATGG - Intergenic
1077146633 11:1049425-1049447 GATGATGATGATGATGATGATGG + Intergenic
1077417006 11:2428754-2428776 AAAGGTGGTGATGATGATGATGG + Intergenic
1077546658 11:3174027-3174049 GATGGTGATGATGATGAAGGTGG - Intergenic
1077546669 11:3174139-3174161 GACAGTGATGATGATGATGATGG - Intergenic
1077546683 11:3174256-3174278 GATAGTGATGATGATGATGATGG - Intergenic
1077552435 11:3206719-3206741 GATGGTGATAATGATGATGATGG + Intergenic
1077552458 11:3206893-3206915 GATGGTGATAATGATGATGATGG + Intergenic
1077552494 11:3207136-3207158 GAGGATGGTGATGGTGAGGATGG + Intergenic
1077606219 11:3614656-3614678 GACGAAGATGATGATGAGGAGGG - Intergenic
1077607418 11:3621441-3621463 CATGGTGAGGAAGATGAGGAAGG - Intergenic
1077717991 11:4600533-4600555 CTGGGTGATAAGGCTGAGGAAGG - Exonic
1078116902 11:8462808-8462830 CAGGGCGGTGATGGTGAGGGTGG - Intronic
1078335320 11:10458653-10458675 CAGAATTATGATTATGAGGATGG - Intronic
1078584748 11:12573610-12573632 TATGATGATGATGATGATGAAGG + Intergenic
1078822504 11:14895921-14895943 CATGGTGATGATGATGATGGTGG + Intergenic
1079079984 11:17407353-17407375 CAGGATGAGGAAGAGGAGGAAGG - Exonic
1079247838 11:18766117-18766139 GATGGTGATGATGATGATGATGG - Intronic
1079320127 11:19445034-19445056 GATGGTGGTGATGATGAAGATGG - Intronic
1079350463 11:19687509-19687531 CTGGGAGATAATGATTAGGAGGG - Intronic
1079390037 11:20014214-20014236 CAGGGTGATAATGAGGGAGAGGG - Intronic
1079510796 11:21207500-21207522 CACTGTGATGATGTTGATGATGG + Intronic
1080760738 11:35246444-35246466 GAGGATGATGATGAGGATGATGG + Intergenic
1080925945 11:36755926-36755948 CAGGGTGAATAAGGTGAGGATGG + Intergenic
1081064903 11:38529886-38529908 AGGGGTGATGATGTTGAAGATGG + Intergenic
1081460002 11:43263791-43263813 CAGGGAGAAGCTGAGGAGGATGG - Intergenic
1081598355 11:44474886-44474908 GATGATGATGATGATGATGATGG + Intergenic
1081609507 11:44551919-44551941 GATGGGGATGATGATGATGATGG + Intergenic
1081735947 11:45404372-45404394 CAGGAGGATGGTGATGGGGAAGG - Intergenic
1082737827 11:56875935-56875957 AAAGGTGATAATGAGGAGGAAGG + Intergenic
1083073625 11:60014026-60014048 GGGGGTGTTGATAATGAGGAAGG - Intergenic
1083150864 11:60790975-60790997 CAGAGCGATGGTGATGTGGAAGG - Exonic
1083199392 11:61110869-61110891 GATGGTGATGATGATGGTGACGG + Intronic
1083199394 11:61110887-61110909 GACGGTGATGGTGATGATGATGG + Intronic
1083199395 11:61110893-61110915 GATGGTGATGATGATGGTGACGG + Intronic
1083815685 11:65131131-65131153 CAGGGTGTTCATGTTGCGGATGG + Exonic
1083962451 11:66021803-66021825 CAGGGCGATGATCTTGAGCAGGG + Exonic
1084093335 11:66893855-66893877 CAGGGAGAGGGTGGTGAGGAAGG - Intronic
1084443383 11:69189081-69189103 GATGGTGATGATGATGATGGTGG - Intergenic
1084443385 11:69189099-69189121 GATGGTGATTATGATGATGATGG - Intergenic
1084444305 11:69194622-69194644 CGTGGTGATGATGATGATGATGG + Intergenic
1084444368 11:69195126-69195148 GATGGTGATGATGATGATGATGG + Intergenic
1084459972 11:69291444-69291466 GCTGGTGATGATGATGATGATGG - Intergenic
1084459978 11:69291519-69291541 GATGGTGATGATGGTGATGATGG - Intergenic
1084508646 11:69587511-69587533 CAGGGTGATGATGCTGTTGAAGG - Intergenic
1084551316 11:69844199-69844221 AATGGTGATGATGATGATGATGG + Intergenic
1084581370 11:70025730-70025752 GATGGTGATGATGATGATGATGG + Intergenic
1084581387 11:70025856-70025878 GATGGTGATGATGATGATGGTGG + Intergenic
1084581390 11:70025886-70025908 GATGGTGATGATGATGATGATGG + Intergenic
1084581415 11:70026077-70026099 GATGATGATGATGATGATGACGG + Intergenic
1084581462 11:70026452-70026474 AATGGTGATGATGGTGAAGATGG + Intergenic
1084686944 11:70701881-70701903 GAGGGTGGTGGTGATGATGATGG - Intronic
1084686996 11:70702271-70702293 GATGGTGGTGATGATGATGATGG - Intronic
1084687016 11:70702409-70702431 GATGGTGGTGATGATGATGATGG - Intronic
1084730152 11:71067689-71067711 GCTGGTGATGATGATGATGATGG - Intronic
1084730303 11:71068919-71068941 CATGGTGATGGTGATGATGGTGG - Intronic
1084730321 11:71069034-71069056 CATGGTGATGGTGATGATGGTGG - Intronic
1084730334 11:71069113-71069135 CATGGTGATGGTGATGATGGTGG - Intronic
1084738773 11:71123965-71123987 CAGGGAGGGGATGATGATGATGG + Intronic
1084773332 11:71358233-71358255 GACCGTGATGATGATGATGATGG - Intergenic
1084778505 11:71393435-71393457 GATGGTGATGGTGATGATGATGG - Intergenic
1085323649 11:75590286-75590308 CAGGGTGAGGAAGCTGAGAAGGG + Intronic
1085472053 11:76764708-76764730 CAGTGTGAGAATGATGTGGAAGG - Intergenic
1085793114 11:79513179-79513201 CTGGATGATAATGATGATGACGG - Intergenic
1085831915 11:79910734-79910756 AATGGCGATGATGATGAAGAAGG + Intergenic
1085907851 11:80786125-80786147 AACAGTGATGATGATGATGATGG + Intergenic
1086575895 11:88338534-88338556 CAGGGTGAGAAGGGTGAGGAAGG + Intergenic
1086581187 11:88400918-88400940 GATGATGATGATGATGATGATGG + Intergenic
1086581941 11:88409360-88409382 GATGATGATGATGATGATGATGG - Intergenic
1086582381 11:88414163-88414185 CAGGGTGGTGGTGGGGAGGATGG - Intergenic
1086634962 11:89070494-89070516 GGTGGTGATGATGATGATGATGG + Intergenic
1086862691 11:91943821-91943843 CAGGGTAATGGTGGTGAAGATGG - Intergenic
1087105127 11:94400909-94400931 CAGGTTGACGATGAAGAGGCTGG + Exonic
1087260205 11:96002616-96002638 GATGGAGATGATGATGATGATGG + Intronic
1087601330 11:100319706-100319728 CAGGGTGAGAATGATTGGGAGGG - Intronic
1087663972 11:101020968-101020990 TATGATGATGATGATGAGGCAGG + Intergenic
1088047790 11:105474416-105474438 CAAGGTATTGAGGATGAGGAAGG + Intergenic
1088353599 11:108917912-108917934 GATGATGATGATGATGATGATGG + Exonic
1088603566 11:111507136-111507158 CAGAGTGATGTTTAAGAGGATGG + Intronic
1088614797 11:111614590-111614612 CAATGTGAAGATAATGAGGATGG - Intronic
1089126264 11:116178633-116178655 CAGAGTGAGGAAGATGGGGAAGG - Intergenic
1089790019 11:120936023-120936045 CAGGATGATGATGACGAAGTTGG - Intronic
1089967959 11:122669349-122669371 GGAGGTGATGATGATGAGGAGGG - Intronic
1090090465 11:123692439-123692461 CAGGGGGGTGATGGTGAGGCTGG + Intergenic
1090493654 11:127188849-127188871 CATGATAATGATGATGATGATGG + Intergenic
1090524577 11:127518711-127518733 CATGATGCTGATGATGAGAAAGG - Intergenic
1090763559 11:129857371-129857393 CATGGTGATGAACATGAGGTTGG - Exonic
1090828125 11:130402162-130402184 CGGGGTGAACATCATGAGGACGG - Intergenic
1090921538 11:131210479-131210501 AAGGGTAATGGTGATGGGGAGGG + Intergenic
1091068372 11:132539820-132539842 GACGGTGATGATGATGTTGAGGG + Intronic
1091668868 12:2438328-2438350 GATGGTGATGATAATGATGATGG + Intronic
1091709289 12:2726421-2726443 CAAGGTGATGAGGGTGTGGATGG + Intergenic
1092555960 12:9561719-9561741 AGGAGTGATGATTATGAGGAAGG - Intergenic
1092931927 12:13324077-13324099 CAGGGTATTTATGAGGAGGAGGG - Intergenic
1093112288 12:15166480-15166502 GATGATGATGATGATGATGATGG + Intronic
1093112291 12:15166486-15166508 GATGATGATGATGATGGGGATGG + Intronic
1094566923 12:31607191-31607213 CAATATGAAGATGATGAGGATGG + Intergenic
1094822389 12:34236465-34236487 CATGGTGATGATGATGATGATGG - Intergenic
1095092349 12:38119031-38119053 GACGGTGATGGTGATGATGATGG + Intergenic
1095345352 12:41143157-41143179 CAGAGTGAGTATGCTGAGGAAGG + Intergenic
1095615200 12:44180222-44180244 GACGATGATGATGATGATGATGG - Intronic
1095982708 12:47982141-47982163 CAGGGTGACGTTGGTGAGAAAGG - Exonic
1097152212 12:56987383-56987405 CAGGGTGTTGATGGACAGGAGGG + Intergenic
1097818132 12:64098226-64098248 CAAGGTGATGGGGATGGGGAAGG - Intronic
1097900985 12:64873695-64873717 CTGGGTGATAATGTTTAGGATGG + Intronic
1098101875 12:67026608-67026630 CAGGATAATGAAGAAGAGGAAGG - Intergenic
1098164765 12:67683366-67683388 AACGATGATGATGATGATGATGG + Intergenic
1098432676 12:70437002-70437024 GATGATGATGATGATGATGATGG + Intergenic
1098463065 12:70754664-70754686 CAGGGTGCTGATGTTGTGGGAGG - Intronic
1099017312 12:77359346-77359368 GAGGATGTTGATGATGAGGCAGG - Intergenic
1099151873 12:79124530-79124552 AATGGTGATGATGATGATGATGG - Intronic
1099200304 12:79668522-79668544 CAGGGGGATAATGGGGAGGATGG + Intronic
1099420336 12:82450420-82450442 CAGAGTGATGGTCCTGAGGACGG - Intronic
1100322596 12:93509880-93509902 CTGGGGGATGGTGATGAGGGAGG - Exonic
1100992091 12:100262096-100262118 CAGGATGTTGATAATGGGGAAGG + Intronic
1101018030 12:100522180-100522202 GATGGTGATGGTGATGATGATGG + Intronic
1101239199 12:102821326-102821348 GATGATGATGATGATGATGATGG - Intergenic
1101416671 12:104514414-104514436 CATGGTGAAGAGGATGAGGAAGG - Intronic
1101417075 12:104517592-104517614 CCGGGTGATGATGTGGAGGTGGG + Intronic
1101442571 12:104714556-104714578 GATGATGATGATGATGATGATGG + Intronic
1101642641 12:106599491-106599513 GATGATGATGATGATGATGAAGG + Intronic
1101711551 12:107271721-107271743 GATGATGATGAAGATGAGGAAGG + Intergenic
1101740659 12:107497393-107497415 GATGGTGGTGATGATGATGATGG - Intronic
1101740684 12:107497561-107497583 GGTGGTGATGATGATGATGATGG - Intronic
1101744546 12:107528825-107528847 CATGGTGATGATGATGGTGATGG + Intronic
1101744547 12:107528843-107528865 GATGGTGATGATGATGATTATGG + Intronic
1101744570 12:107529088-107529110 GATGGTGATGATGATGGTGACGG + Intronic
1101744578 12:107529169-107529191 GATGGTGATGGTGATGATGATGG + Intronic
1101744579 12:107529175-107529197 GATGGTGATGATGATGGTGATGG + Intronic
1101744587 12:107529259-107529281 CATGTTGATGATGATGGTGATGG + Intronic
1101744588 12:107529271-107529293 GATGGTGATGGTGATGATGATGG + Intronic
1101744589 12:107529277-107529299 GATGGTGATGATGATGGTGATGG + Intronic
1101744596 12:107529346-107529368 GATGGTGATGATGATGGTGATGG + Intronic
1101744605 12:107529462-107529484 GATGGTGATGAAGATGAAGATGG + Intronic
1101826945 12:108227732-108227754 GATGATGATGATGATGATGATGG + Intronic
1101826946 12:108227750-108227772 GATGGTGATGATTATGATGATGG + Intronic
1101826948 12:108227786-108227808 GATGGTGATGATTATGACGATGG + Intronic
1101872527 12:108577697-108577719 GATGGTGATGGTGATGATGATGG - Intergenic
1101927194 12:108982010-108982032 GATGGTGGTGATGATGATGATGG - Intronic
1101927199 12:108982070-108982092 GATAGTGATGATGATGAAGATGG - Intronic
1101927208 12:108982207-108982229 TATGGTGATGAAGATGATGATGG - Intronic
1101927218 12:108982326-108982348 GATGGTGAAGATGATGATGATGG - Intronic
1101927248 12:108982713-108982735 GATAGTGATGATGATGATGATGG - Intronic
1102072727 12:110035137-110035159 CAGGCTGATGGTGATGTGCAGGG - Intronic
1102149870 12:110681660-110681682 CGGGATGATGATGATGATGATGG - Intronic
1102385614 12:112506972-112506994 GATGATGATGATGATGATGATGG + Exonic
1102599749 12:114020800-114020822 CAGGTGGAAGATGATTAGGAAGG + Intergenic
1102737676 12:115177805-115177827 GGTGGTGATGATGATGATGATGG - Intergenic
1102737718 12:115178228-115178250 GAGGGTGATGCTGATGGTGATGG - Intergenic
1102824571 12:115937179-115937201 CAGGATGTTGATGATGGGGGAGG + Intergenic
1102845420 12:116176395-116176417 GATGATGATGATGATGATGATGG - Intronic
1102871366 12:116416740-116416762 GATGATGATGATGATGATGATGG - Intergenic
1102990594 12:117313012-117313034 TATGGTGATGATGATGGTGATGG - Intronic
1103059754 12:117848843-117848865 GATGGTGATGATGGTGATGATGG + Intronic
1103059755 12:117848852-117848874 GATGGTGATGATGGTGATGACGG + Intronic
1103165978 12:118770976-118770998 CCAGGTGATGCTGATGAGGCTGG - Intergenic
1103199534 12:119075904-119075926 GATGGTGATGATGATGATGATGG + Intronic
1103248638 12:119480608-119480630 GATGGTGATGATGATGATGATGG - Intronic
1103248642 12:119480656-119480678 GATGGTGATGATGATGATGCTGG - Intronic
1103248653 12:119480731-119480753 GAGGATGATGGTGATGATGATGG - Intronic
1103248677 12:119480911-119480933 GATGGTGATGATGATGGTGATGG - Intronic
1103248681 12:119480944-119480966 GATGGTGATGATGGTGATGATGG - Intronic
1103248686 12:119480992-119481014 GATGGTGATGATGATGATGCTGG - Intronic
1103248689 12:119481022-119481044 GATGGTGATGATGATGATGGTGG - Intronic
1103248693 12:119481052-119481074 GATGGTGATGATGATGATGGTGG - Intronic
1103252202 12:119509653-119509675 GATGATGATGATGATGATGATGG + Intronic
1103259524 12:119574432-119574454 GATGATGATGATGATGATGATGG + Intergenic
1103411673 12:120716630-120716652 CAGGAGGAGGATGAGGAGGAGGG + Exonic
1103561353 12:121794703-121794725 CAGGGTGAGGAGTAAGAGGAGGG - Intronic
1103871091 12:124092544-124092566 TATGGTGATGATGGTGATGATGG + Intronic
1103871110 12:124092685-124092707 GATGGTGATGGTGATGATGATGG + Intronic
1103871111 12:124092691-124092713 GATGGTGATGATGATGGTGATGG + Intronic
1103871112 12:124092703-124092725 GATGGTGATGGTGATGATGATGG + Intronic
1103871114 12:124092721-124092743 GATGGTGATGATGATGGTGATGG + Intronic
1103871118 12:124092765-124092787 GATGGTGATGGTGATGATGATGG + Intronic
1103871127 12:124092857-124092879 GATGGTGATCATGATGATGATGG + Intronic
1103871131 12:124092896-124092918 GATGGTGATCATGATGATGATGG + Intronic
1103871135 12:124092929-124092951 GATGGTGATGATGATGGTGATGG + Intronic
1103871201 12:124093514-124093536 GATGGTGATGGTGATGATGATGG + Intronic
1103871209 12:124093565-124093587 GATGGTGATGGTGATGATGATGG + Intronic
1103871217 12:124093628-124093650 GATGGTGATGATGATGGTGATGG + Intronic
1103932135 12:124456509-124456531 GATGATGATGATGATGATGATGG - Intronic
1103934399 12:124467706-124467728 GAGGGTGATGAGGATGATGAGGG - Intronic
1103934451 12:124467929-124467951 GGGGGTGATGAGGATGAGGGGGG - Intronic
1103934457 12:124467947-124467969 GGGGGTGATGAGGATGAGGGGGG - Intronic
1103934478 12:124468029-124468051 GAGGGTGATGAGGATGATGAGGG - Intronic
1103934516 12:124468202-124468224 GGGGGTGATGAGGATGAGGGGGG - Intronic
1103934522 12:124468220-124468242 GGGGGTGATGAGGATGAGGGGGG - Intronic
1103934535 12:124468262-124468284 GAGGGTGATGAGGATGATGGGGG - Intronic
1103934545 12:124468304-124468326 GAGGGTGATGAGGATGATGAGGG - Intronic
1103934630 12:124468670-124468692 GGGGGTGATGAGGATGAGGGGGG - Intronic
1103934636 12:124468688-124468710 GGGGGTGATGAGGATGAGGGGGG - Intronic
1103934648 12:124468729-124468751 GAGGGTGATGAGGATGATGGGGG - Intronic
1103934658 12:124468771-124468793 GAGGGTGATGAGGATGATGAGGG - Intronic
1104050420 12:125190575-125190597 AGGGGTGATGATGGTGATGATGG + Intronic
1104050433 12:125190622-125190644 GATGGTGATGGTGATGGGGAAGG + Intronic
1104050554 12:125190973-125190995 GATGGTGATGGTGATGGGGAAGG + Intronic
1104050639 12:125191235-125191257 GATGGTGATGGTGATGGGGAAGG + Intronic
1104110239 12:125697874-125697896 CAGGCTCATGACCATGAGGAGGG + Intergenic
1104214061 12:126718572-126718594 GATGATGATGATGATGATGATGG + Intergenic
1104256755 12:127146234-127146256 CAGGACGATGACGAAGAGGACGG + Intergenic
1104329625 12:127832388-127832410 TACGGTGATGGTGATGATGAAGG - Intergenic
1104421451 12:128639140-128639162 AATGGTGATGATGATGGTGATGG + Intronic
1104484300 12:129136681-129136703 GATGGTGATGTTGATGATGATGG - Intronic
1104484312 12:129136756-129136778 GATGGTGATGATGGTGATGATGG - Intronic
1104484335 12:129136955-129136977 GATGGTGATGATGATAATGATGG - Intronic
1104484363 12:129137304-129137326 CATGATGATGATGATGGTGATGG - Intronic
1104510279 12:129371535-129371557 TATGATGATGATGATGATGATGG + Intronic
1104524307 12:129504161-129504183 CAGGATGATGATGATGGTGATGG - Intronic
1104578928 12:129994931-129994953 CATGGTGATGAAGATGGTGATGG - Intergenic
1104613285 12:130247723-130247745 GATGGTGATGATGGTGAAGATGG + Intergenic
1104613287 12:130247741-130247763 GATGGTGATGATGATGGTGATGG + Intergenic
1104636977 12:130443771-130443793 GACGGTGATGATGATGATGGTGG + Intronic
1104683204 12:130766681-130766703 GATGGTGATGGTGATGACGATGG - Intergenic
1104743975 12:131199127-131199149 GATGGTGGTGATGGTGAGGATGG - Intergenic
1104744006 12:131199359-131199381 GACGGTGATGGTGATGATGATGG - Intergenic
1104744018 12:131199462-131199484 GATGGTAATGATGGTGAGGATGG - Intergenic
1104762126 12:131303379-131303401 GATGGTGATGATGATGATGATGG - Intergenic
1104762165 12:131303774-131303796 GATGGTGGTGATGATGATGATGG - Intergenic
1104762171 12:131303828-131303850 GATGGTGATGATGATGATGATGG - Intergenic
1104762182 12:131303992-131304014 GATGGTGATGGTGATGATGATGG - Intergenic
1104762192 12:131304135-131304157 AATGGTGATGGTGATGATGATGG - Intergenic
1104776969 12:131395402-131395424 GATGGTGATGATGATGATGATGG + Intergenic
1104776979 12:131395555-131395577 GATGATGATGATGATGATGATGG + Intergenic
1104776987 12:131395641-131395663 GATGGTGATGATGATGGTGATGG + Intergenic
1104776994 12:131395704-131395726 GATGGTGATGATGATGGTGATGG + Intergenic
1104777001 12:131395767-131395789 GATGGTGATGATGATGGTGATGG + Intergenic
1104777006 12:131395814-131395836 GATGGTGATGGTGATGATGATGG + Intergenic
1104777007 12:131395820-131395842 GATGGTGATGATGATGGTGATGG + Intergenic
1104777010 12:131395864-131395886 CATGATGATGATGGTGATGATGG + Intergenic
1104777012 12:131395923-131395945 GATGGTGATGATGATGATGATGG + Intergenic
1104777016 12:131395982-131396004 GATGGTGATGATGATGATGATGG + Intergenic
1104777420 12:131399046-131399068 AATGGTGATGGTGATGATGATGG + Intergenic
1104777421 12:131399052-131399074 GATGGTGATGATGATGGTGATGG + Intergenic
1104777450 12:131399320-131399342 AATGGTGATGATTATGATGATGG + Intergenic
1104798848 12:131539434-131539456 GATGGTGATGGTGATGATGATGG + Intergenic
1104798851 12:131539458-131539480 AATGGTGATGATGATGGTGATGG + Intergenic
1104798956 12:131540250-131540272 GATGGTGATGATGGTGATGATGG + Intergenic
1104817584 12:131656661-131656683 AATGGTGATGGTGATGATGATGG + Intergenic
1104817594 12:131656804-131656826 GATGGTGATGGTGATGATGATGG + Intergenic
1104817604 12:131656953-131656975 CATCATGATGATGATGATGATGG + Intergenic
1104817605 12:131656971-131656993 GATGGTGATGATGATGATGATGG + Intergenic
1104817611 12:131657025-131657047 GATGGTGGTGATGATGATGATGG + Intergenic
1104817650 12:131657405-131657427 GATGGTGATGATGATGATGATGG + Intergenic
1104932947 12:132349631-132349653 GATGGTGATGATGATGGTGATGG - Intergenic
1104932956 12:132349702-132349724 GATGGTGATGATGATGGTGATGG - Intergenic
1104932986 12:132350000-132350022 GATGGTGATGATGGTGATGATGG - Intergenic
1104955518 12:132463449-132463471 GATGGTGATGCTGATGATGATGG - Intergenic
1104955526 12:132463524-132463546 GATGGTGATGATGGTGATGATGG - Intergenic
1104955539 12:132463629-132463651 GATGGTGATGATGGTGATGATGG - Intergenic
1104955563 12:132463851-132463873 GATGGTGATGATGGTGATGATGG - Intergenic
1104955565 12:132463869-132463891 GATGGTGATGATGATGGTGATGG - Intergenic
1104955592 12:132464097-132464119 GATGATGATGATGATGATGATGG - Intergenic
1104955597 12:132464268-132464290 GATGGTGATGGTGATGATGATGG - Intergenic
1104955605 12:132464340-132464362 GATGGTGATGATGATGGTGATGG - Intergenic
1104955620 12:132464463-132464485 GACGGTGATGATGGTGATGATGG - Intergenic
1104955622 12:132464481-132464503 GACGGTGATGATGATGGTGACGG - Intergenic
1104955631 12:132464553-132464575 GATGGTGATGATGGTGATGATGG - Intergenic
1104955636 12:132464586-132464608 GATGGTGATGATGATGGTGACGG - Intergenic
1104955640 12:132464616-132464638 GATGGTGATGATGATGGTGATGG - Intergenic
1104974144 12:132544669-132544691 CATGGTGGTGGTAATGAGGATGG + Intronic
1104974175 12:132544854-132544876 GAGGGTGATGGTGATGAGGATGG + Intronic
1105009035 12:132742756-132742778 GAGGATGATGGTGGTGAGGATGG - Intronic
1105407244 13:20142665-20142687 CAGCATGAAGATGATGAAGATGG + Exonic
1105710753 13:23006801-23006823 CACACTGATGATGAGGAGGAAGG + Intergenic
1105769238 13:23592669-23592691 CTTGGTGATGATGATAAAGATGG - Intronic
1105795368 13:23846832-23846854 GATGATGATGATGATGATGATGG + Intronic
1106017404 13:25882919-25882941 GATGATGATGATGATGATGATGG + Intronic
1106017408 13:25882952-25882974 GATGGTGATGGTGATGATGATGG + Intronic
1106068899 13:26387561-26387583 CAGGGTGATGATAGAGAGTAGGG + Intronic
1106138977 13:26994903-26994925 GATGGTGATAATGATGAGCATGG - Intergenic
1106404556 13:29462509-29462531 CAGGGTGGTGGTGGTGAGGAGGG + Intronic
1106444749 13:29817461-29817483 CAGGGTTATGATGATAAAGCCGG + Intronic
1106554194 13:30796131-30796153 CAGGGGGAGAATGCTGAGGATGG + Intergenic
1106563846 13:30868995-30869017 CACAGTGGTGATGATGAGGAGGG + Intergenic
1107160273 13:37217642-37217664 GGGGATGATGATGATGGGGAAGG - Intergenic
1107177741 13:37419412-37419434 GAGTGTGATGATTAAGAGGAGGG + Intergenic
1107685381 13:42892397-42892419 CAGGATAATGATGATAAGGGTGG + Intronic
1107725363 13:43293426-43293448 GAGGGTGATTGTGGTGAGGATGG - Intronic
1108395938 13:49991712-49991734 CAGGGTGGAGATGAGGAGCATGG - Intergenic
1108458814 13:50644465-50644487 TGGGGTGGTGATGATGAAGATGG - Intronic
1108705083 13:52978032-52978054 TATGGTGATGATGATGATGATGG + Intergenic
1108705615 13:52982823-52982845 CAATGGGAAGATGATGAGGATGG + Intergenic
1108808944 13:54196444-54196466 AATGATGATGATGATGATGATGG - Intergenic
1108865671 13:54919676-54919698 CACACTGATGATGAGGAGGAAGG - Intergenic
1109767843 13:66928286-66928308 TGGGGTCATGATGATGAAGATGG + Intronic
1110146988 13:72203542-72203564 AAAGATGATGATGATGAGGGAGG - Intergenic
1110545215 13:76748554-76748576 GAAGATGATGATGATGAAGATGG - Intergenic
1111225557 13:85266534-85266556 CAGGAAGGTGATGATGAGCAGGG - Intergenic
1111638490 13:90936409-90936431 AATGGTGATGTTGATGAAGAGGG - Intergenic
1111707539 13:91769624-91769646 CAGGGTGATGCAGATGATGCTGG + Intronic
1111905967 13:94256551-94256573 GAGGATGATGATGATGGAGATGG - Intronic
1112629606 13:101146387-101146409 CATGGTTATGATGATGACAATGG + Intronic
1113899133 13:113786546-113786568 GACGGTGATGATGTTGACGATGG - Intronic
1113930452 13:113965670-113965692 AATGGTGATGGTGATGATGATGG + Intergenic
1113930460 13:113965733-113965755 GAAGGTGATGATGGTGATGATGG + Intergenic
1113930486 13:113965937-113965959 GATGGTGATGATGATGGTGATGG + Intergenic
1113930540 13:113966474-113966496 AATGGTGATGATGATGGTGATGG + Intergenic
1114253591 14:20982607-20982629 CAGGGTCATGAGGGTGAGCAAGG - Intergenic
1114273175 14:21117211-21117233 CATGGTAATGATGTTGAGTAGGG + Intergenic
1114675701 14:24438912-24438934 GAGTGTAATGATGATGGGGAGGG + Exonic
1115360434 14:32494279-32494301 TAGGGTGTTGATGATGAAGTTGG + Intronic
1116238704 14:42313470-42313492 CACACTGATGATGAAGAGGAAGG - Intergenic
1116520101 14:45836089-45836111 CAATGTGAAGATGATAAGGATGG - Intergenic
1116578840 14:46611867-46611889 GATGATGATGATGATGATGATGG - Intergenic
1116817720 14:49599154-49599176 CAGGGTGGAGATGAGCAGGAAGG - Exonic
1117541037 14:56746732-56746754 GAGGTGGATGATGAGGAGGAGGG + Intergenic
1117545351 14:56790164-56790186 GATGATGATGATGATGATGATGG - Intergenic
1117579443 14:57137393-57137415 GAGGATGATGATGACGATGATGG - Intergenic
1117600238 14:57366666-57366688 CACACTGATGATGAGGAGGAAGG + Intergenic
1118007639 14:61578247-61578269 GATGATGATGATGATGATGATGG - Intronic
1118583170 14:67325242-67325264 GAGGGTGAAGAGGAAGAGGAAGG - Intronic
1118963648 14:70559392-70559414 CAGGGTGATAATGATGGGGATGG - Intergenic
1119327573 14:73770363-73770385 GATGATGATGATGATGATGATGG + Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119691599 14:76677245-76677267 GATGATGATGGTGATGAGGATGG - Intergenic
1119762109 14:77158914-77158936 CAGGGTGGTGAAGGTGAGGGTGG - Intronic
1119800668 14:77442210-77442232 CAGGGTTATTATGAAGATGAAGG - Intronic
1120047911 14:79829013-79829035 GAGGGTGATGGTGAGGAAGAAGG - Intronic
1120217940 14:81700507-81700529 CAGAGTGATGCAGAAGAGGAGGG - Intergenic
1120332271 14:83108667-83108689 AAAGATGATGATGAGGAGGAAGG - Intergenic
1121023382 14:90596416-90596438 CTGGCAGATGATGATGATGATGG + Intronic
1121101240 14:91251951-91251973 CACGGTGAGGATGATGATGATGG - Exonic
1121227896 14:92334866-92334888 GATGATGATGATGATGATGATGG - Intronic
1121254459 14:92521059-92521081 CTGGATGATGATTAGGAGGATGG - Intronic
1121316483 14:92964104-92964126 CGGGGGAATGAGGATGAGGAGGG - Intronic
1121426328 14:93854737-93854759 CAGGGTGTGGATGCTGATGAGGG + Intergenic
1121440053 14:93942854-93942876 GATGATGATGATGATGATGATGG + Intronic
1121559974 14:94867175-94867197 TAGGGTGATGGTGGTGATGATGG - Intergenic
1121586502 14:95066550-95066572 GATGGTGATGGTGATGACGATGG - Intergenic
1121681639 14:95797659-95797681 CAGGGTGATGAACATGATAAAGG + Intergenic
1121704637 14:95982288-95982310 CAGGGTGCGGGTGATGAGGAGGG - Intergenic
1121740097 14:96245895-96245917 GATGATGATGATGATGATGATGG + Intronic
1121835164 14:97085700-97085722 CTTAGTGATGATGATGATGATGG + Intergenic
1121889518 14:97575985-97576007 AACAATGATGATGATGAGGATGG + Intergenic
1121889521 14:97576000-97576022 GAGGATGGTGATGGTGAGGATGG + Intergenic
1122086462 14:99310385-99310407 GATGATGATGATGATGATGATGG - Intergenic
1122095102 14:99364708-99364730 GAGGGTGAGGATGATGATGGTGG - Intergenic
1122801468 14:104232089-104232111 AATGGTGATGGTGATGATGACGG - Intergenic
1122801474 14:104232132-104232154 AATGGTGATGGTGATGATGATGG - Intergenic
1122801513 14:104232593-104232615 CATGATGATGATGGTGATGATGG - Intergenic
1123202536 14:106680113-106680135 CAGGGAGCTGATCATGGGGAGGG + Intergenic
1202843826 14_GL000009v2_random:148705-148727 CACACTGATGATGAGGAGGAAGG - Intergenic
1202913228 14_GL000194v1_random:138949-138971 CACACTGATGATGAGGAGGAAGG - Intergenic
1202879424 14_KI270722v1_random:43736-43758 CACACTGATGATGAGGAGGAAGG + Intergenic
1123405256 15:20016358-20016380 CAGGAGGATGATGATGATGGTGG - Intergenic
1123410790 15:20057138-20057160 CATGGTGGGGATGCTGAGGAGGG - Intergenic
1123514585 15:21023006-21023028 CAGGAGGATGATGATGATGGTGG - Intergenic
1123520120 15:21063844-21063866 CATGGTGGGGATGCTGAGGAGGG - Intergenic
1124430172 15:29600439-29600461 GATGATGATGATGATGATGATGG - Intergenic
1125007870 15:34838432-34838454 GATGGTGATGATGGTGAGGGTGG - Intergenic
1125007884 15:34838519-34838541 GGTGGTGATAATGATGAGGATGG - Intergenic
1125717268 15:41826486-41826508 CAGGGTGGTGAAGCTGAGGCAGG - Exonic
1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG + Exonic
1126348746 15:47722733-47722755 AAGGATGATGGTGATGATGATGG + Intronic
1126397333 15:48232885-48232907 GATGGGGATGGTGATGAGGAGGG - Intronic
1126410788 15:48371062-48371084 CAGGATGGTGATGATGATGATGG + Intergenic
1126410789 15:48371065-48371087 GATGGTGATGATGATGATGGTGG + Intergenic
1126581387 15:50245393-50245415 GAGGATGATGATGATGATGATGG + Intronic
1126952602 15:53898206-53898228 GATGATGATGATGATGATGATGG - Intergenic
1126974192 15:54156088-54156110 CAGGGTGATGGTGAAAATGACGG + Intronic
1126977961 15:54207108-54207130 GATGATGATGATGATGATGATGG + Intronic
1127483002 15:59394376-59394398 CAGGATGATGGTGATGAAGATGG + Intronic
1127754906 15:62082802-62082824 AAGGATGGTGATGATGAAGAAGG - Intergenic
1128606889 15:69043255-69043277 GATGGTGATGATGATGATGAGGG - Intronic
1128761817 15:70221674-70221696 CATGATGATGATGGTGATGATGG - Intergenic
1128774954 15:70313316-70313338 GATGGTGATGATGATGGTGATGG - Intergenic
1128780458 15:70355641-70355663 CAGGGTGAGAGTGATGATGATGG - Intergenic
1129113982 15:73354778-73354800 GATGATGATGATGATGATGATGG - Intronic
1129292678 15:74580468-74580490 CAGGATGATGATGACGATAATGG + Intronic
1129754697 15:78090623-78090645 GATGATGATGATGATGATGATGG - Intronic
1129912178 15:79237090-79237112 GATGATGATGATAATGAGGATGG + Intergenic
1130127080 15:81103067-81103089 CATGATGATGATGATGATGATGG + Intronic
1130194170 15:81763514-81763536 GATGATGATGATGATGATGATGG - Intergenic
1130298663 15:82664382-82664404 CAGGATGAGGATGAGGAGAAAGG - Exonic
1130435459 15:83894241-83894263 CAGGGTGATGATGTTTAGTCTGG - Intronic
1130651536 15:85764742-85764764 CAGGGAGATGCTGATGCTGATGG - Intronic
1130838103 15:87671686-87671708 TAAGGTGATGGTGATGAGGATGG - Intergenic
1130857466 15:87853598-87853620 GATGGTGATGGTGATGATGATGG + Intergenic
1130978749 15:88797800-88797822 GATGATGATGATGATGATGATGG + Intergenic
1131175887 15:90209598-90209620 ATGTTTGATGATGATGAGGAGGG - Intronic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1132421479 15:101673507-101673529 AATGGTGATGATGATAACGATGG - Intronic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133042415 16:3067684-3067706 CAGGGTGAGAAGGATGAAGAGGG + Intronic
1133070456 16:3243401-3243423 CTGGGTGGTGATAATGATGAAGG - Exonic
1133202310 16:4211447-4211469 GATCGTGATGATGATGATGATGG + Intronic
1133202320 16:4211561-4211583 GATCGTGATGATGATGATGATGG + Intronic
1133202332 16:4211678-4211700 GATCGTGATGATGATGATGATGG + Intronic
1133202338 16:4211738-4211760 GATCGTGATGATGATGATGATGG + Intronic
1133202342 16:4211795-4211817 GATCGTGATGATGATGATGATGG + Intronic
1133202345 16:4211822-4211844 AATGGTGGTGATGATGATGATGG + Intronic
1133219741 16:4315075-4315097 CAGGGTGCTGATGTCCAGGAGGG + Exonic
1133367656 16:5223724-5223746 CAGGATTCTGATGAGGAGGAAGG + Intergenic
1133401128 16:5488002-5488024 AATAGTGATGATGATGATGATGG + Intergenic
1133401230 16:5488757-5488779 GATGGTGATGATGATGATTATGG + Intergenic
1133419185 16:5631184-5631206 GAGGTTGATGATGATGATGTTGG + Intergenic
1133438021 16:5796562-5796584 CACCCTGATGATGATGATGATGG + Intergenic
1133443721 16:5841996-5842018 CAGGGAGAGGAGGATGAGGATGG - Intergenic
1133534963 16:6693091-6693113 GAGGATGAGGATGATGATGATGG - Intronic
1133534970 16:6693119-6693141 GATGGTGATGATGATGGTGATGG - Intronic
1133534971 16:6693125-6693147 GAGGATGATGGTGATGATGATGG - Intronic
1133535004 16:6693356-6693378 TAGGATGATGTTGATGATGATGG - Intronic
1133535018 16:6693455-6693477 GAGGATGATGGTGATGATGATGG - Intronic
1133535034 16:6693569-6693591 GAGGATGATGACGATGATGATGG - Intronic
1133535046 16:6693685-6693707 GAGGATGATGGTGATGATGATGG - Intronic
1133545043 16:6798002-6798024 AGGGATGATGATGATGATGATGG + Intronic
1133595726 16:7289508-7289530 AATGGTGATGATGACGATGAAGG - Intronic
1133618827 16:7506577-7506599 GATGATGATGATGATGATGAAGG - Intronic
1133732860 16:8591027-8591049 GATGGTGGTGATGATGATGATGG - Intergenic
1133742674 16:8663236-8663258 TAGGGAGATGATGATGATGATGG - Intergenic
1133815135 16:9191326-9191348 CAGGATGATGATGATGATGGTGG + Intergenic
1133840224 16:9401444-9401466 GAAGGTGATGATGATGGTGATGG - Intergenic
1133840230 16:9401501-9401523 AGTGGTGATGATGATGATGATGG - Intergenic
1133867229 16:9655550-9655572 TGTGGTGATGATGATGATGATGG + Intergenic
1133882374 16:9795012-9795034 CATGATGATGATGATGATGACGG + Intronic
1134210175 16:12269837-12269859 GATGATGATGATGATGATGATGG - Intronic
1134230022 16:12421745-12421767 GATGGTGATGATGATAATGATGG - Intronic
1134331718 16:13257484-13257506 GATGGTGGTGATGATGATGATGG - Intergenic
1134449268 16:14353882-14353904 CAGGGGGAGGAAGAAGAGGAGGG + Intergenic
1134556035 16:15166034-15166056 TATGGTGATGATGATGATGATGG - Intergenic
1134630307 16:15751461-15751483 GATGATGATGATGATGATGATGG - Intronic
1134642954 16:15843870-15843892 CCGGGTGATGATGATGATGCTGG + Intronic
1134916619 16:18077769-18077791 TATGGTGATGATGATGATGATGG - Intergenic
1135195532 16:20391146-20391168 TATGGTGATGATGATGACAATGG - Intronic
1135539024 16:23315896-23315918 AATGGTGATGATGATGGTGATGG - Intronic
1135539037 16:23315972-23315994 GATGGCGATGATGGTGAGGATGG - Intronic
1135539040 16:23315990-23316012 GATGGTGGTGATGATGATGATGG - Intronic
1135539051 16:23316053-23316075 GATGGTGGTGATGGTGAGGATGG - Intronic
1135539070 16:23316164-23316186 GATGGTGGTGATGATGATGATGG - Intronic
1135539077 16:23316206-23316228 GATGGTGGTGATGGTGAGGATGG - Intronic
1135539091 16:23316290-23316312 GATGGTGATGGTGGTGAGGATGG - Intronic
1135539105 16:23316374-23316396 GATGGTGATGATGGTGAGGATGG - Intronic
1135539108 16:23316392-23316414 GATGGTGGTGATGATGATGATGG - Intronic
1135539124 16:23316500-23316522 GATGGTGGTGATGGTGAGGATGG - Intronic
1135539134 16:23316560-23316582 GATGGTGGTGATGGTGAGGATGG - Intronic
1135539143 16:23316611-23316633 GAGGGTGATGGTGATCATGATGG - Intronic
1135539150 16:23316659-23316681 GATGGTGATGATGGTGAGGATGG - Intronic
1135539163 16:23316749-23316771 GATGGTGATGATGGTGAGGATGG - Intronic
1135539175 16:23316821-23316843 GAGGATGATGATGGTGATGATGG - Intronic
1135539190 16:23316929-23316951 GATGGTGATGATGGTGAGAATGG - Intronic
1135597917 16:23757273-23757295 GAGGCTGATGAAGATGGGGATGG + Exonic
1135609998 16:23858097-23858119 GATGATGATGATGATGATGAAGG + Intronic
1135788210 16:25369387-25369409 CAGGGTGGTGATTATGAGGCAGG - Intergenic
1135907477 16:26526044-26526066 GATAGTGATGGTGATGAGGATGG - Intergenic
1135949347 16:26898732-26898754 CTGGGTGATGGTGTTGGGGAAGG - Intergenic
1136283320 16:29227060-29227082 GATGGTGGTGATGATGATGATGG - Intergenic
1136412859 16:30086864-30086886 GGTGGTGATGATGATGATGATGG + Intronic
1136982939 16:35074781-35074803 CACACTGATGATGAGGAGGAAGG - Intergenic
1137250835 16:46739549-46739571 TAGGCTGAGGAGGATGAGGAAGG - Intronic
1137604640 16:49779416-49779438 CAGGGTGATGTTGATGCTGCTGG - Intronic
1137754283 16:50889086-50889108 GATGATGATGATGATGATGATGG + Intergenic
1137855319 16:51789126-51789148 GATGGCGATGATGATGATGAAGG - Intergenic
1138043951 16:53702073-53702095 AATGATGATGATGATGATGATGG + Intronic
1138156315 16:54708001-54708023 GATGATGATGATGATGATGATGG - Intergenic
1138204931 16:55117699-55117721 GAGGATGATGATGATGATGATGG + Intergenic
1138217047 16:55213570-55213592 AATGATGATGATGATGATGATGG + Intergenic
1138241807 16:55433598-55433620 AAGGATGGTGATGGTGAGGAAGG - Intronic
1138510471 16:57505812-57505834 CAGGGTGGGGATGGTGGGGACGG + Intergenic
1138535583 16:57658582-57658604 GTAGGTGATGGTGATGAGGAAGG + Intronic
1138563803 16:57817922-57817944 GATGGTGATGATGATGGTGATGG - Intronic
1139258208 16:65563754-65563776 AAGGGTGATGAGGGTGAGGAGGG - Intergenic
1139266862 16:65648170-65648192 GATGATGATGATGATGACGATGG - Intergenic
1139302173 16:65954792-65954814 CCAGGTGATGCTGATGAGGATGG - Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140194229 16:72843725-72843747 CAAGGTGGTGATGTTGAGGCAGG + Intronic
1140756763 16:78074575-78074597 CAGGGTGATGCTGATGTTGTGGG + Intergenic
1140834847 16:78783795-78783817 GAGGGTGATGGTGATGATGATGG + Intronic
1140889337 16:79271837-79271859 CAGGGAGGTGATGAGGAAGAAGG + Intergenic
1140894385 16:79312116-79312138 GATGATGATGATGATGATGAAGG - Intergenic
1140901882 16:79375595-79375617 GATGGTAATGATGATGATGAAGG + Intergenic
1141029661 16:80576408-80576430 GATGGTGATGATGTTGATGATGG + Intergenic
1141029690 16:80576837-80576859 GATGGTGATGATGTTGATGATGG + Intergenic
1141061682 16:80878613-80878635 CGTGGTGATGATGATGATGATGG + Intergenic
1141088353 16:81112563-81112585 GATGATGATGATGATGATGAGGG + Intergenic
1141310700 16:82910984-82911006 TAGGGTAATGATGCTGAGGTTGG + Intronic
1141319783 16:82996707-82996729 GAGAGTGATGATGATGATGATGG + Intronic
1141731062 16:85823316-85823338 GATGGTGATGGTGATGATGAAGG - Intergenic
1141731069 16:85823391-85823413 GATGGTGATGATGATGTTGATGG - Intergenic
1141731082 16:85823520-85823542 GATGGTGATGATGATGTTGATGG - Intergenic
1141731092 16:85823628-85823650 GATGGTGATGATGATGTTGATGG - Intergenic
1141731094 16:85823661-85823683 GATGGTGATGATGATGGTGATGG - Intergenic
1141731106 16:85823757-85823779 GATGGTGGTGATGATGAGGATGG - Intergenic
1141731109 16:85823775-85823797 GATGGTGATGATGGTGATGATGG - Intergenic
1141758903 16:86013951-86013973 GGTGGTGATGATGATGATGAAGG - Intergenic
1141813638 16:86393829-86393851 GATGATGATGATGATGGGGATGG - Intergenic
1141813641 16:86393835-86393857 GGGGATGATGATGATGATGATGG - Intergenic
1141813693 16:86394269-86394291 GATGGTGATAATGATGATGATGG - Intergenic
1141817114 16:86419095-86419117 GATGGTGATGATGATGATGGTGG + Intergenic
1141817119 16:86419146-86419168 AATGGTGATGGTGATGATGATGG + Intergenic
1141817122 16:86419176-86419198 GATGGTGATGATGATGATGGTGG + Intergenic
1141817135 16:86419257-86419279 GATGGTGATGGTGATGATGATGG + Intergenic
1141817141 16:86419296-86419318 GATGGTGATGATGATGATGGTGG + Intergenic
1141817144 16:86419320-86419342 GATGGTGATGGTGATGATGATGG + Intergenic
1141817148 16:86419326-86419348 GATGGTGATGATGATGGGGGTGG + Intergenic
1141817179 16:86419494-86419516 GATGGTGATGGTGATGATGATGG + Intergenic
1141817186 16:86419533-86419555 GATGGTGATGATGATGATGGTGG + Intergenic
1141817211 16:86419737-86419759 AATGGTGATGGTGATGATGATGG + Intergenic
1141823687 16:86464588-86464610 GATGGTGATGATGATGATGTTGG + Intergenic
1141823689 16:86464615-86464637 GATGGTGATGATGATGTTGATGG + Intergenic
1141843117 16:86587414-86587436 GATAGTGATGATGATGATGATGG - Intergenic
1141843189 16:86587912-86587934 GATGGTGATGGTGATGATGATGG - Intergenic
1141843199 16:86587990-86588012 GATGATGATGATGATGATGATGG - Intergenic
1141843204 16:86588032-86588054 GATGGTGATGATGATGGTGATGG - Intergenic
1141843239 16:86588296-86588318 AATGGTGAAGATGATGATGATGG - Intergenic
1141843591 16:86591369-86591391 GAAGATGATGATGATGATGATGG + Intergenic
1141872739 16:86799475-86799497 GAGGATGATGGTGATGAGGATGG - Intergenic
1141880070 16:86852062-86852084 GATGGTGATGATGATGGTGATGG - Intergenic
1141880071 16:86852068-86852090 GATGGTGATGGTGATGATGATGG - Intergenic
1141880073 16:86852086-86852108 GATGGTGATGATGGTGATGATGG - Intergenic
1141880087 16:86852206-86852228 CATGGTGGTGATGATGGTGATGG - Intergenic
1141880098 16:86852293-86852315 GATGGTGATGATGATGGTGATGG - Intergenic
1141880099 16:86852299-86852321 GATGGTGATGGTGATGATGATGG - Intergenic
1141880108 16:86852388-86852410 GATGGTGATGATGTTGATGATGG - Intergenic
1141881247 16:86861133-86861155 GATGGTGATGATGGTGATGATGG + Intergenic
1141881277 16:86861334-86861356 AATGGTGATGATGATGATGATGG + Intergenic
1141881322 16:86861661-86861683 GATGGTGATGATGATGATGATGG + Intergenic
1141881402 16:86862243-86862265 GATGGTGATGATGATCATGATGG + Intergenic
1141928085 16:87182342-87182364 CATGGGGATGGTGATGAGGAGGG - Intronic
1141931771 16:87209819-87209841 CATGGTGATGGTGATGATGGTGG + Intronic
1141931809 16:87210125-87210147 AATGGTGATGATGGTGATGATGG + Intronic
1141931846 16:87210407-87210429 AATGGTGATGATGGTGATGATGG + Intronic
1141932250 16:87213728-87213750 GATGGTGATGGTGATGATGATGG + Intronic
1141932251 16:87213734-87213756 GATGGTGATGATGATGGTGAAGG + Intronic
1141988768 16:87597696-87597718 GATGGCGATGGTGATGAGGATGG - Intergenic
1142031296 16:87839795-87839817 CAGGGAGATGATGATGGCCAGGG + Exonic
1142064529 16:88053573-88053595 GTTGGTGATGATGATGATGATGG - Intronic
1142064629 16:88054167-88054189 GTTGGTGATGATGATGATGATGG - Intronic
1142071867 16:88095052-88095074 GATGATGATGATGATGATGATGG - Intronic
1142103532 16:88289221-88289243 GAGGGTGATGATGATGATGAAGG + Intergenic
1142103539 16:88289275-88289297 GAGGGTGATGGTGATGATGATGG + Intergenic
1142103544 16:88289314-88289336 GATGGCGATGATGATGATGAGGG + Intergenic
1142103550 16:88289356-88289378 GAGGGTGATGATGGTGATGATGG + Intergenic
1142103552 16:88289380-88289402 GATGGTGATGATCATGATGATGG + Intergenic
1142110940 16:88331036-88331058 GATGGTGATGATGGTGATGATGG - Intergenic
1142117415 16:88366701-88366723 GATGGTGATGATGATGGTGATGG - Intergenic
1142118227 16:88371996-88372018 GATGGTGATGATGGTGATGATGG - Intergenic
1142118292 16:88372428-88372450 GATGGTGATGGTGATGATGATGG - Intergenic
1142118308 16:88372554-88372576 GATGGTGATGATGGTGAAGATGG - Intergenic
1142208891 16:88798134-88798156 CACGGTGATGATAATGAAGGTGG + Intergenic
1142208901 16:88798222-88798244 GAGGATGGTGATGATGATGATGG + Intergenic
1142208902 16:88798225-88798247 GATGGTGATGATGATGATGGTGG + Intergenic
1142208905 16:88798240-88798262 GATGGTGGTGATGGTGAGGATGG + Intergenic
1142208928 16:88798378-88798400 CCTGGTGATGATGATGTTGAAGG + Intergenic
1142261799 16:89046136-89046158 GATGATGATGATGGTGAGGATGG - Intergenic
1142267029 16:89068821-89068843 GATGGTGACGATGATGATGATGG + Intergenic
1142267041 16:89068929-89068951 GATGGTGATGATGATGATGGTGG + Intergenic
1142267052 16:89069013-89069035 GATGGTGATGATGATGATGGTGG + Intergenic
1142267079 16:89069217-89069239 GATGGTGATGATGATGATGGTGG + Intergenic
1142267086 16:89069277-89069299 GATGGTGACGATGATGATGATGG + Intergenic
1142267089 16:89069301-89069323 GATGGTGATGATGATGATGGTGG + Intergenic
1142382488 16:89741157-89741179 CAGGGAGATGATGCTGAGTTGGG - Intronic
1142502993 17:343916-343938 GATGATGGTGATGATGAGGATGG - Intronic
1142623426 17:1179020-1179042 GAGGGTGGTGGTGATGATGAGGG + Intronic
1142692175 17:1613243-1613265 CAGGGCGATGAAGATGAGCACGG + Exonic
1143096484 17:4481039-4481061 CAGGGTGAGGAGGGTGAGGGAGG + Intronic
1143515439 17:7417345-7417367 CAGGATGTTGAGGAAGAGGAGGG - Exonic
1143557944 17:7674192-7674214 CAGTGTGATGATGGTGAGGATGG + Exonic
1143692578 17:8582077-8582099 AATGATGATGATGATGAAGATGG + Intronic
1143709808 17:8726538-8726560 CAGGGTGGTGAAGCCGAGGAGGG + Intergenic
1144036152 17:11367728-11367750 GAGGCTGAGGATGCTGAGGATGG + Intronic
1144077306 17:11730938-11730960 GACGGTGATGATGATGATGGTGG + Intronic
1144077319 17:11731046-11731068 GATGGTGATGGTGATGATGATGG + Intronic
1144180456 17:12746697-12746719 TAAGGAGATGATGATGATGATGG + Intronic
1144243108 17:13333875-13333897 GGTGGTGATGATGATGATGATGG - Intergenic
1144260892 17:13519546-13519568 GATGATGATGATGATGATGATGG + Intronic
1144719705 17:17460178-17460200 GATGGTGATGATGATGATGGTGG - Intergenic
1144719729 17:17460365-17460387 CATGGTGATGATGGTGATGATGG - Intergenic
1144789365 17:17848837-17848859 AAGGGTGATGATCTGGAGGAGGG - Exonic
1145304252 17:21664083-21664105 GAGGATGATGATGGTGAGAATGG + Intergenic
1145347841 17:22052917-22052939 TAAGGTGATGATGATGAGGATGG - Intergenic
1145347865 17:22053141-22053163 GATGATGATGATGGTGAGGATGG - Intergenic
1145415728 17:22712238-22712260 GATGATGATGATGGTGAGGATGG + Intergenic
1145415765 17:22712576-22712598 GACGGTGATAATGATGATGATGG + Intergenic
1146259119 17:31410327-31410349 GAGGATGATGATGATGATGAAGG + Intronic
1146639445 17:34528981-34529003 TTGAGTGATGAGGATGAGGATGG + Intergenic
1146640565 17:34537632-34537654 GATGATGATGATGATGATGATGG - Intergenic
1146643634 17:34561546-34561568 CATGGTGATGACAATGATGATGG + Intergenic
1146675397 17:34769995-34770017 GATGGTGATGATGATAATGATGG + Intergenic
1147041137 17:37719983-37720005 CATGATGATGGTGATGATGATGG - Intronic
1147657265 17:42098098-42098120 CAGGTTGGGGATGGTGAGGACGG - Intergenic
1148375026 17:47135429-47135451 GATGATGATGATGATGATGATGG + Intronic
1148601248 17:48895744-48895766 CATGGCGAAGAGGATGAGGAAGG - Exonic
1149321781 17:55488897-55488919 GATGATGATGATGATGATGATGG - Intergenic
1149561195 17:57609104-57609126 CAGGGAGATGGTGAAGAGGAGGG - Intronic
1149630463 17:58117670-58117692 GATGGTGATGATGATGGTGATGG + Intergenic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1149880162 17:60281802-60281824 CAGGGTGATTTTGATGTAGATGG - Intronic
1150444725 17:65220028-65220050 TATGGTGATGATGGTGATGATGG - Intronic
1150444734 17:65220104-65220126 CTAGGTGATGATGGTGATGATGG - Intronic
1150624169 17:66830755-66830777 ATGGGTGATGCTGATGTGGATGG + Intergenic
1150624726 17:66834750-66834772 GATGATGATGATGATGATGATGG - Intergenic
1151209944 17:72537114-72537136 GAGGGTGAAGATGGTGATGAAGG - Intergenic
1151374703 17:73679182-73679204 CTGAGTGATGAAGATGAGGAAGG - Intergenic
1151532925 17:74718963-74718985 GAGGGTGTTGATAATGGGGAAGG + Intronic
1151981127 17:77509695-77509717 GATGGTGATGATGATAATGATGG - Intergenic
1152004921 17:77674599-77674621 GATGATGATGATGATGATGATGG + Intergenic
1152025775 17:77808229-77808251 GATGATGATGATGATGATGATGG + Intergenic
1152026041 17:77810012-77810034 GATGGTGATGATGGTGATGATGG + Intergenic
1152026042 17:77810021-77810043 GATGGTGATGATGGTGATGATGG + Intergenic
1152026060 17:77810138-77810160 GATGGTGATGGTGATGATGATGG + Intergenic
1152026061 17:77810144-77810166 GATGGTGATGATGATGGTGATGG + Intergenic
1152026062 17:77810156-77810178 GATGGTGATGGTGATGATGATGG + Intergenic
1152026069 17:77810201-77810223 CATGGTGATGGTGATGGTGATGG + Intergenic
1152115905 17:78386959-78386981 GATGATGATGATGATGATGATGG + Intronic
1152115907 17:78386986-78387008 GATGGTGATGATGATGATGATGG + Intronic
1152131260 17:78477999-78478021 GATGGTGATGATGGTGATGATGG - Intronic
1152214832 17:79025885-79025907 GATGGTGATGATGATGATGATGG - Intronic
1152214833 17:79025903-79025925 CATCATGATGATGATGATGATGG - Intronic
1152273319 17:79338451-79338473 CAGGGTGATGCTGGTGAGATGGG + Intronic
1152334139 17:79690721-79690743 CAGTGGGATGACGAGGAGGATGG + Intergenic
1152371946 17:79893743-79893765 GATGGTGATGATGATGATGATGG - Intergenic
1152371948 17:79893776-79893798 GATGGTGATGATGATGATGATGG - Intergenic
1152371950 17:79894040-79894062 GATGATGATGATGATGATGATGG - Intergenic
1152371951 17:79894070-79894092 GATGGTGATGATGATGATGATGG - Intergenic
1152371956 17:79894130-79894152 GATGGTGATGATGATGATGATGG - Intergenic
1152371958 17:79894169-79894191 GATGGTGATGATGATGATGATGG - Intergenic
1152371961 17:79894220-79894242 GATGGTGATGATGATGATGATGG - Intergenic
1152371962 17:79894238-79894260 GATGGTGATGATGATAATGATGG - Intergenic
1152502538 17:80722179-80722201 AATGATGATGATGATGATGACGG - Intronic
1152599335 17:81253742-81253764 GACGGTGATGATGATGGTGATGG - Intronic
1152599344 17:81253793-81253815 GACGGTGATGATGATGGTGATGG - Intronic
1152599356 17:81253865-81253887 GATGGTGATGATGATGGTGATGG - Intronic
1152658662 17:81531938-81531960 AATGGTGATGATGATGGTGATGG + Intronic
1152658665 17:81531974-81531996 AATGGTGATGATGATGGTGATGG + Intronic
1152658685 17:81532142-81532164 GATGGTGATGGTGATGATGATGG + Intronic
1152658686 17:81532148-81532170 GATGGTGATGATGATGGTGATGG + Intronic
1152658719 17:81532433-81532455 AATGGTGATGATGATGGTGATGG + Intronic
1152659502 17:81535756-81535778 GAGGGGGATGGGGATGAGGATGG - Intronic
1152696569 17:81800615-81800637 CAAGGGGCTGATGAGGAGGAGGG - Intergenic
1152998691 18:433017-433039 CAGTGTGATGATTGTTAGGAAGG + Intronic
1153607172 18:6846286-6846308 GATGGCGATGATGATGATGATGG + Intronic
1153851426 18:9098953-9098975 GATGGTGATGATGATGATGAAGG + Intergenic
1155071357 18:22319285-22319307 TACGATGATGATGATGATGATGG + Intergenic
1155152822 18:23135962-23135984 CAGCGAGATGTTGGTGAGGAAGG - Exonic
1155335875 18:24764962-24764984 CACAGTGATGATGATGGTGATGG + Intergenic
1155546539 18:26921671-26921693 GATGATGATGATGATGATGATGG - Intronic
1155871059 18:31028866-31028888 CAGGGAGATGAGGCTGAAGAGGG - Intronic
1155873886 18:31061137-31061159 CAGGGTGATTCTGATGCTGATGG + Exonic
1156361185 18:36386251-36386273 CAGGGAGATGAGGCAGAGGACGG - Intronic
1156569343 18:38235230-38235252 GATGATGATGATGATGATGATGG + Intergenic
1156787532 18:40933257-40933279 GAGGGTGATGATGATGATGGTGG - Intergenic
1157166649 18:45363734-45363756 CCAGGTGGTGATGATGGGGAGGG + Intronic
1157305797 18:46516713-46516735 GATGGTGATTATGATGATGAGGG - Intronic
1157328163 18:46684082-46684104 GATGATGATGACGATGAGGATGG + Intronic
1157570464 18:48708975-48708997 AACGATGATGATGATGATGATGG + Intronic
1158254636 18:55532278-55532300 GATGATGATGATGATGAGGATGG - Intronic
1158403675 18:57142711-57142733 GATGGTGATGATGATGAAGGTGG - Intergenic
1158880873 18:61778656-61778678 CAGGGAGATAAGGACGAGGAGGG + Intergenic
1159840938 18:73398496-73398518 CAGCGTGAAGATGATGAGGATGG - Intergenic
1160143186 18:76344317-76344339 GACGGTGATGATGGTGATGATGG + Intergenic
1160143202 18:76344494-76344516 GATGGTGATGATGGTGAAGATGG + Intergenic
1160277863 18:77455170-77455192 GATGGTGATGGTGATGATGATGG + Intergenic
1160384523 18:78486778-78486800 CATGCTGATGAAGAAGAGGATGG - Intergenic
1161156170 19:2732859-2732881 CAGGAAGGTGATGAAGAGGAAGG + Exonic
1161334337 19:3704352-3704374 CAGGGTGAGGCTGATGTGGCTGG - Intergenic
1161536886 19:4824968-4824990 AAGGGTGGTGGTGAGGAGGAGGG + Intronic
1161873481 19:6888993-6889015 AATGGTGATGATGATGGTGATGG + Intronic
1161873498 19:6889201-6889223 TATGGTGGTGATGATGATGATGG + Intronic
1161881288 19:6955012-6955034 AATGGTGATGATGGTGATGAAGG + Intergenic
1161899392 19:7106791-7106813 AAGGATGGTGATGATGATGATGG + Intergenic
1161899404 19:7106888-7106910 GATGGTGATGGTGATGATGATGG + Intergenic
1161899408 19:7106930-7106952 GATGGTGATGATGGTGATGATGG + Intergenic
1161899416 19:7106995-7107017 AATGGTGGTGATGATGATGATGG + Intergenic
1161899428 19:7107093-7107115 GATGGTAATGGTGATGAGGATGG + Intergenic
1161899450 19:7107363-7107385 GATGGCGATGGTGATGAGGATGG + Intergenic
1161899452 19:7107396-7107418 GATAGTGATGATGATGATGATGG + Intergenic
1161899465 19:7107520-7107542 GATGGTGAAGGTGATGAGGATGG + Intergenic
1161899467 19:7107538-7107560 GATGGTGATGATGGTGATGATGG + Intergenic
1161899480 19:7107710-7107732 GATGGTGATGATGATGATGATGG + Intergenic
1161988482 19:7670442-7670464 GATGATGATGATGATGATGATGG + Exonic
1162043018 19:7981802-7981824 CTGGGTGGTGAGGATGAGGAAGG + Intronic
1162183541 19:8887233-8887255 GGTGGTGATGATGATGATGATGG - Intronic
1162183997 19:8890530-8890552 GATGGTGATGATGATGATGATGG - Intronic
1162184426 19:8893919-8893941 TATTGTGATGATGATGATGATGG - Intronic
1162186012 19:8905560-8905582 GAGTGTGATGATGATGATGATGG - Intronic
1162186739 19:8910998-8911020 GAGTGTGATGGTGATGATGATGG - Intronic
1162186761 19:8911275-8911297 TATGATGATGATGATGATGATGG - Intronic
1162252166 19:9454818-9454840 CACACTGATGATGAGGAGGAAGG + Intergenic
1162355425 19:10180644-10180666 GATGATGATGATGATGATGAAGG - Intronic
1162603234 19:11686611-11686633 CATGATGATGATGAGGATGATGG + Intergenic
1162727572 19:12699314-12699336 CAGGGGGAAGAGGGTGAGGAGGG + Exonic
1162875260 19:13616693-13616715 AAGGGAGATGAGGATGAGGGAGG + Intronic
1162922585 19:13912376-13912398 CCGGATGAGGATGAGGAGGAGGG + Exonic
1163050131 19:14676785-14676807 CGTGGTGGTGATGATGATGATGG + Intronic
1163679534 19:18672664-18672686 CAGGGATCTGATGGTGAGGAGGG - Intergenic
1164262048 19:23576591-23576613 CACACTGATGATGAGGAGGAAGG - Intronic
1164592691 19:29514807-29514829 GAGAGTGAGGATGAGGAGGAAGG + Intergenic
1164708550 19:30338494-30338516 GATGATGATGATGATGATGATGG + Intronic
1164721471 19:30434852-30434874 GATGGTGATAATGATGATGATGG + Intronic
1164721517 19:30435364-30435386 GGTGGTGATGATGATGATGATGG + Intronic
1164790985 19:30980597-30980619 GGTGGTGATGATGATGACGATGG - Intergenic
1164868744 19:31626014-31626036 GAGGGGGAGGATGAGGAGGAAGG - Intergenic
1165324359 19:35105611-35105633 GATGGTGATGATGATGTTGATGG - Intergenic
1165348302 19:35262579-35262601 CAGGAGGAGGAAGATGAGGAAGG - Exonic
1165351772 19:35279599-35279621 CAGGGTGCTGATGGGAAGGAGGG + Exonic
1165832754 19:38737313-38737335 GAGGATGACGAGGATGAGGAAGG - Exonic
1166203209 19:41252261-41252283 GATGATGATGATGATGATGATGG + Intronic
1166373574 19:42315209-42315231 GAGGATGAAGATGAGGAGGAAGG - Exonic
1166625291 19:44346408-44346430 CATAGTGATGATAATGAAGATGG - Intronic
1166872188 19:45877389-45877411 CCAGATGATGATGATGATGATGG + Intergenic
1167092004 19:47350880-47350902 GAGGGTGATGATGAACAAGACGG + Intronic
1167130514 19:47582246-47582268 CAAGGGGAGGATGAAGAGGAGGG - Intergenic
1167144321 19:47672835-47672857 CTGAATGATGAGGATGAGGATGG - Intronic
1167299312 19:48670094-48670116 GATGGTGATGATGATGATGATGG - Intronic
1167325452 19:48821731-48821753 GAGGATGGTGATGGTGAGGATGG + Intronic
1167325468 19:48821914-48821936 AATGGTGATGTTGGTGAGGATGG + Intronic
1167325512 19:48822268-48822290 GGTGGTGATGATGATGAGGATGG + Intronic
1167325535 19:48822445-48822467 GGTGGTGATGATGGTGAGGATGG + Intronic
1167325550 19:48822578-48822600 AGTGGTGATGATGATGAGGATGG + Intronic
1167569230 19:50276602-50276624 CTGGGTGGTGATGCTGTGGAAGG - Intronic
1167640376 19:50678463-50678485 GAGGGTGAAGGTGATGAGGCAGG + Intronic
1167739407 19:51315258-51315280 CAGAGTGATGATGGTCAGGAGGG + Intronic
1167909336 19:52689502-52689524 CAGGGTGAGGGAGAGGAGGAGGG - Intronic
1167991819 19:53366666-53366688 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1167999469 19:53432912-53432934 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168003841 19:53469673-53469695 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168144659 19:54414268-54414290 GATGGTGATGATGATGATGATGG - Intergenic
1168322708 19:55519447-55519469 CATGATGATGATGATGATGGTGG + Intergenic
1168322724 19:55519583-55519605 TATGATGATGATGATGAAGATGG + Intergenic
1168322748 19:55519749-55519771 GATGGTAATGATGATGATGATGG + Intergenic
1168361760 19:55746726-55746748 GATGGTGATGATGATGATGACGG + Intergenic
1168361774 19:55746894-55746916 GATGGTGAAGATGATGATGATGG + Intergenic
1168361778 19:55746942-55746964 GATGGTGATGATGGTGATGATGG + Intergenic
1168361779 19:55746951-55746973 GATGGTGATGATGGTGATGATGG + Intergenic
1168361780 19:55746960-55746982 GATGGTGATGATGGTGATGATGG + Intergenic
1168517384 19:57018836-57018858 CAGGTTGATGATGAAGAGCCTGG - Intergenic
1168574569 19:57499359-57499381 GATGGAGATGATGATGAAGATGG - Intronic
925250366 2:2430363-2430385 GATGGTGACGATGATGAAGATGG + Intergenic
925287481 2:2725389-2725411 CAGGGAGACGCTGATGTGGAAGG - Intergenic
925897317 2:8482603-8482625 GATGGTGATGGTGATGATGATGG + Intergenic
925991781 2:9260284-9260306 CTGGGTCATGAGGATGAGGTGGG + Intronic
926112116 2:10190118-10190140 GATGGTGATGATGATGGTGATGG + Intronic
926117355 2:10221821-10221843 CAGGGTGATGATGATGAAGATGG + Intergenic
926120716 2:10239925-10239947 CAGGGTGCTGTTGGGGAGGAAGG + Intergenic
926129930 2:10296601-10296623 CAGTGGGAGGATGATGATGAGGG + Intergenic
926132362 2:10311836-10311858 GATAGTGATGATGATGATGATGG - Intronic
926132431 2:10312565-10312587 GATGGTGATGATGATGAGGATGG - Intronic
926132445 2:10312698-10312720 GATGGTGATGATGATGGGGATGG - Intronic
926315837 2:11708808-11708830 GAAGGTGATGATGATGATGTTGG + Intronic
926681815 2:15669805-15669827 CATGGTGCTTATGAGGAGGAAGG - Intergenic
926774656 2:16409897-16409919 GAGGGTGTTGATAATGATGATGG - Intergenic
926774684 2:16410137-16410159 AATGGTGATGATGATGATGATGG - Intergenic
926791066 2:16572264-16572286 CAGGGTCATAATGAAGATGATGG + Intronic
926855374 2:17250810-17250832 CAGGGTGTGCTTGATGAGGAGGG - Intergenic
927117929 2:19923455-19923477 CACACTGATGATGAGGAGGAAGG + Intronic
927332688 2:21884459-21884481 CATAGTGATGATGATGATGATGG + Intergenic
927561696 2:24077812-24077834 AAGGCTGAGGAGGATGAGGAGGG - Intronic
927882841 2:26700730-26700752 GATGGTGATGATGATGATGATGG - Intronic
927882842 2:26700748-26700770 GATGGTGATGATGATGATGATGG - Intronic
928042380 2:27890973-27890995 CAGCGTGATGGGGATGAGAAGGG - Exonic
928276192 2:29902359-29902381 CAGGATGATGGAGAAGAGGATGG - Intronic
928280461 2:29941826-29941848 GATGGTGATGGTGATGATGATGG - Intergenic
928353625 2:30586724-30586746 CAGGGACAAGATGTTGAGGATGG - Intronic
928989338 2:37215871-37215893 CTGGGTGATGGTAATGGGGAGGG + Intronic
929146595 2:38711854-38711876 GATGTTGATGATGATGATGATGG - Intronic
929703249 2:44183549-44183571 CTGGGTGGTGATGAGGAGGCAGG - Intronic
929883293 2:45855938-45855960 CAGGGTTTTCATGATGATGATGG + Intronic
930140561 2:47947571-47947593 CAAGATGAGGATGTTGAGGATGG + Intergenic
930183186 2:48385236-48385258 CACACTGATGATGAGGAGGAAGG + Intergenic
930369672 2:50487182-50487204 GAGGATGATGGTGATGATGATGG + Intronic
930485186 2:52002472-52002494 CAAGGTGATGGTGAGGAGGTGGG - Intergenic
930748197 2:54906374-54906396 CAGGGGGATGCTGCTGTGGAGGG + Intronic
930889073 2:56361972-56361994 TAGGGTGGAGATGGTGAGGAGGG + Intronic
931381569 2:61758272-61758294 CAGGCAGGTGAAGATGAGGAGGG - Intergenic
931999430 2:67870781-67870803 CAGAGGAATGGTGATGAGGATGG - Intergenic
932113522 2:69023520-69023542 GATGATGATGATGATGATGATGG + Intronic
932132912 2:69203754-69203776 GATGATGATGATGATGATGATGG - Intronic
932383866 2:71312653-71312675 CAATGTGAAGATGATGTGGATGG - Intronic
933021857 2:77204376-77204398 GATGGTGATAATGATGATGATGG + Intronic
933353875 2:81191199-81191221 GAAGATGATGATGATGATGATGG - Intergenic
933810943 2:86032351-86032373 GAGGGTGATGAGGAAGAGGAGGG - Exonic
933833113 2:86226138-86226160 GAGGATGATGATGATGATGATGG - Intronic
934629599 2:95902723-95902745 GTGGGTGATGATGATGATGCTGG - Intronic
934695909 2:96400019-96400041 CAGGGTTCTGTTGCTGAGGAGGG - Intergenic
935026027 2:99277874-99277896 CACACTGATGATGAGGAGGAAGG - Intronic
935292241 2:101620509-101620531 CAGGCTGAGGATGGTGAGGAAGG - Intergenic
935588650 2:104824668-104824690 GAAGGTGATGATGATGTTGATGG + Intergenic
935607338 2:104984187-104984209 GACGGTGATGATAATGAGGGTGG - Intergenic
935634809 2:105242226-105242248 CACGCTGATGATGAGCAGGATGG - Exonic
935995117 2:108762798-108762820 GATGATGATGATGATGATGATGG - Intronic
935995234 2:108764023-108764045 CATGGGGATGATGATGATGACGG + Exonic
936475941 2:112839796-112839818 AAGAGTGATGATGATGTAGATGG + Intergenic
936718478 2:115218966-115218988 CAGTGTGATGGGTATGAGGATGG - Intronic
936962724 2:118093085-118093107 GATGATGATGATGATGATGAAGG + Intronic
936962728 2:118093149-118093171 GATGATGATGATGATGATGAAGG + Intronic
936962732 2:118093228-118093250 GATGATGATGATGATGATGATGG + Intronic
936962746 2:118093373-118093395 GATGATGATGATGATGATGAAGG + Intronic
936962750 2:118093437-118093459 GATGATGATGATGATGATGAAGG + Intronic
936962754 2:118093516-118093538 GATGATGATGATGATGATGATGG + Intronic
936962777 2:118093724-118093746 CCAGATGATGATGATGATGAAGG + Intronic
936962806 2:118094029-118094051 GATGATGATGATGATGATGATGG + Intronic
936962826 2:118094249-118094271 GATGATGATGATGATGATGAAGG + Intronic
936962830 2:118094307-118094329 CCAGATGATGATGATGATGAAGG + Intronic
936962834 2:118094368-118094390 GATGATGATGATGATGATGATGG + Intronic
937090928 2:119205680-119205702 CAGGGTGATGCTGAAGTGTAGGG - Intergenic
937302160 2:120849461-120849483 CATGATGATGATGATGATGGCGG + Intronic
937877783 2:126838214-126838236 CAGGGTGTGGATGAGGAGGCAGG - Intergenic
938161931 2:128993665-128993687 AAGGTGGATGAGGATGAGGAAGG + Intergenic
938364546 2:130724505-130724527 GAGGATGATGATGGTGATGATGG + Intergenic
938364552 2:130724606-130724628 GATGGTGATGATGATAATGATGG + Intergenic
938680458 2:133684594-133684616 CATGATGATGATGATGATGATGG + Intergenic
938690249 2:133781417-133781439 GATGGTGATGATGATGGTGATGG + Intergenic
938999388 2:136716387-136716409 TAGAGTGAGGAGGATGAGGAGGG + Intergenic
939840040 2:147175894-147175916 TATGATGATGATGATGATGATGG + Intergenic
940100225 2:150029059-150029081 GATGGTGATGATGATAATGATGG - Intergenic
940290677 2:152074822-152074844 AGGGGTGGTGATGATGAAGATGG - Intronic
940301536 2:152180717-152180739 CACGCTGATGATGAGGAGGAAGG - Intergenic
940369902 2:152889536-152889558 GATGATGATGATGATGATGATGG + Intergenic
940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG + Intergenic
941553690 2:166948278-166948300 CAGGATGTTGATAATGAGCAGGG + Intronic
942163841 2:173221471-173221493 GACGATGATGATGATGATGACGG + Intronic
942213788 2:173698012-173698034 GAGGATGATGGTGATGATGATGG - Intergenic
942213801 2:173698201-173698223 GATGGTGATGGTGATGACGATGG - Intergenic
942345938 2:175003372-175003394 CACTGTGGTGAAGATGAGGAAGG - Intronic
942392938 2:175515028-175515050 CAGAGTGATGGTTATGAGGATGG + Intergenic
942813789 2:180027640-180027662 GAGGGGGGTGATGATGGGGATGG - Intergenic
943062477 2:183053035-183053057 CACACTGATGATGAGGAGGAAGG - Intergenic
944194029 2:197033282-197033304 AATGGTGATGATGATGATGGTGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945123044 2:206478522-206478544 GATGATGATGATGATGATGATGG + Intronic
945785660 2:214233362-214233384 GATGATGATGATGATGATGATGG + Intronic
946047802 2:216835742-216835764 CAGGGTGTTGAGGCAGAGGATGG - Intergenic
946116074 2:217463621-217463643 GATGATGATGATGATGATGATGG + Intronic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946206545 2:218112962-218112984 CACACTGATGATGAGGAGGAAGG + Intergenic
946547073 2:220755866-220755888 CAGGGTGATCATGATGCCAATGG + Intergenic
946567927 2:220988044-220988066 GATGATGATGATGATGATGAAGG + Intergenic
946686075 2:222271441-222271463 AATGGTGATGCTGATGATGATGG + Intronic
946799890 2:223403120-223403142 TAGGTTGATGATCATGAAGATGG - Intergenic
946835159 2:223765159-223765181 GATGATGATGATGATGATGATGG - Intronic
947382930 2:229562955-229562977 GAGGATGATGATGATGATGGTGG - Intronic
947382995 2:229563358-229563380 GAGGATGATGATGATGGTGATGG - Intronic
947382996 2:229563364-229563386 TGGGGTGAGGATGATGATGATGG - Intronic
947383055 2:229563737-229563759 GAGGATGATGATGATGGTGATGG - Intronic
947383084 2:229563893-229563915 GAGGATGATGATGATGGTGATGG - Intronic
947383100 2:229563977-229563999 GAGGATGATGATGATGATGATGG - Intronic
947383104 2:229564003-229564025 GAGGATGATGATGATGGTGATGG - Intronic
947383105 2:229564009-229564031 TGGGGTGAGGATGATGATGATGG - Intronic
947383114 2:229564058-229564080 GAGGATGATGATGATGGTGATGG - Intronic
947383115 2:229564064-229564086 TGGGGTGAGGATGATGATGATGG - Intronic
947383123 2:229564113-229564135 GAGGATGATGATGATGGTGATGG - Intronic
947383124 2:229564119-229564141 TGGGGTGAGGATGATGATGATGG - Intronic
947383163 2:229564368-229564390 TGGGGTGATGATGATGATGATGG - Intronic
947383180 2:229564495-229564517 GAGGATGATGATGATGGTGATGG - Intronic
947395563 2:229683625-229683647 GATGGTGACGATGATGATGATGG + Intronic
947395565 2:229683643-229683665 GATGGTGGTGATGATGATGATGG + Intronic
947545096 2:231004989-231005011 GGTGGTGATGATGGTGAGGATGG - Intronic
947545113 2:231005091-231005113 GATGGTGATGGTGATGAGGATGG - Intronic
947545127 2:231005172-231005194 GATGGTGATGGTGATGATGATGG - Intronic
947545142 2:231005274-231005296 GATGGTGATGATGATGGTGATGG - Intronic
947587030 2:231362625-231362647 CAGTGTGAGGAAGAAGAGGATGG + Intronic
947619360 2:231578844-231578866 GATGGTGATGATGATGGTGATGG - Intergenic
947619361 2:231578850-231578872 GATGGTGATGGTGATGATGATGG - Intergenic
947619366 2:231578922-231578944 GATGGTGATGATGATGATGATGG - Intergenic
947619369 2:231578964-231578986 GATGATGATGATGATGATGATGG - Intergenic
947619373 2:231579504-231579526 GATGATGATGATGATGATGATGG - Intergenic
947619387 2:231579642-231579664 GACAGTGATGATGATGATGACGG - Intergenic
947619394 2:231579714-231579736 GATAGTGATGATGATGATGATGG - Intergenic
947619395 2:231579744-231579766 GATGGTGATGATGATGGTGATGG - Intergenic
947619396 2:231579750-231579772 GATGGTGATGGTGATGATGATGG - Intergenic
947619399 2:231579774-231579796 GATGGTGATGATGATGGTGACGG - Intergenic
947619400 2:231579780-231579802 AATGGTGATGGTGATGATGATGG - Intergenic
947744079 2:232498642-232498664 GATGATGATGATGATGATGATGG - Intergenic
948180212 2:235973562-235973584 AAGGGTGGTGATGAGGATGAGGG + Intronic
948247680 2:236500098-236500120 GATGATGATGATGATGATGATGG + Intronic
948518395 2:238520565-238520587 CATGGTGATGATGGTGATGGTGG + Intergenic
948606778 2:239140929-239140951 CACAGTGAGGAGGATGAGGAGGG + Intronic
1168841559 20:913134-913156 GATGGTGATGATGATGCTGATGG + Intronic
1168961136 20:1870772-1870794 CAGAGGGATGATGATGAGATGGG + Intergenic
1169214347 20:3784877-3784899 GACGATGATGATGAGGAGGATGG - Exonic
1169403534 20:5303941-5303963 CACACTGATGATGAGGAGGAAGG + Intronic
1169411969 20:5378971-5378993 AAGGCTGATGATGATGATGATGG + Intergenic
1169488049 20:6049864-6049886 GATGGTGATGGTGATGATGAAGG - Intronic
1169757842 20:9062564-9062586 CTGGATGATGACGATGAAGAAGG - Intergenic
1169865735 20:10197894-10197916 CCTGGTGATGATGATGGTGATGG + Intergenic
1170555731 20:17513396-17513418 GATGATGATGATGATGATGACGG - Intronic
1170580605 20:17696963-17696985 GATGGTGATGATGATGATAATGG + Intronic
1171267478 20:23783518-23783540 GATGGTGATGATGATGGTGATGG - Intergenic
1171267479 20:23783524-23783546 TATGGTGATGGTGATGATGATGG - Intergenic
1171519094 20:25762080-25762102 GAGACTGATGATAATGAGGATGG + Intergenic
1171557862 20:26094693-26094715 AATGATGGTGATGATGAGGAAGG - Intergenic
1171557871 20:26094767-26094789 GAGGATGATGATGGTGAGAATGG - Intergenic
1171877911 20:30595626-30595648 GATGGTGATGATGATGATGGTGG - Intergenic
1171878881 20:30602042-30602064 GATGGTGATGGTGATGATGATGG - Intergenic
1171967660 20:31542601-31542623 TAGGGTGAAGATGATGAGACGGG + Intronic
1172023562 20:31933046-31933068 TGGGGTGAAGATGTTGAGGAAGG + Intronic
1172114902 20:32567921-32567943 GATGGTGATGATGATGATGATGG - Intronic
1172114914 20:32568052-32568074 AATGGTGATGATGGTGATGATGG - Intronic
1172310978 20:33918244-33918266 GATGGTGATGATGATGATGATGG - Intergenic
1172408695 20:34707055-34707077 CTGGGTGAAGATGAAGAGGGAGG - Intronic
1172897971 20:38314013-38314035 AATGGTGGAGATGATGAGGATGG + Intronic
1172940827 20:38653274-38653296 GATGGTGATGATGATTATGATGG + Intergenic
1173000700 20:39103424-39103446 AAGGACGATGATGATGAAGATGG + Intergenic
1173080764 20:39865004-39865026 GAGGGTGATGAGGGTGAGGTGGG - Intergenic
1173080841 20:39865627-39865649 GATGGTGATGATGATGGTGATGG - Intergenic
1173143996 20:40509483-40509505 CAGTATGGTGATGATGAGAAGGG - Intergenic
1173726083 20:45298743-45298765 GATGGTGATGGTGATGATGATGG - Intronic
1173726084 20:45298755-45298777 GAGGGTGATGATGATGGTGATGG - Intronic
1173920616 20:46742119-46742141 GATGGTGATGATGGTGATGATGG + Intergenic
1174086366 20:48010928-48010950 GAAGGTGATGGTGATGATGAAGG - Intergenic
1174094961 20:48081010-48081032 CAGGCTGAGGATGAGGAGAAGGG + Intergenic
1174826110 20:53770354-53770376 CAGGGTGATTAAGGTGGGGAAGG - Intergenic
1175038571 20:56023698-56023720 GAGGGTGAAGAGGGTGAGGAGGG + Intergenic
1175127216 20:56761469-56761491 GATGGTGATGATGGTGATGATGG + Intergenic
1175657831 20:60787111-60787133 GAGGGGGATGAAGAGGAGGAGGG - Intergenic
1175668898 20:60884337-60884359 GATGGTGATGATGATGACGATGG + Intergenic
1175668908 20:60884505-60884527 TATGGTGATGATGATGTTGATGG + Intergenic
1175670154 20:60895484-60895506 GATGGTGATGATAATGATGATGG + Intergenic
1175670161 20:60895561-60895583 GATGGTGATGATAATGATGATGG + Intergenic
1175671476 20:60906827-60906849 GAGGCTAATAATGATGAGGATGG + Intergenic
1175764909 20:61585627-61585649 GACGGTGATGGTGATGATGATGG + Intronic
1175764910 20:61585633-61585655 GATGGTGATGATGATGGTGATGG + Intronic
1175906468 20:62382034-62382056 AATGGTGATGATGGTGATGATGG + Intergenic
1175906478 20:62382129-62382151 GATGGTGAAGATGATGATGATGG + Intergenic
1175933492 20:62504427-62504449 GATGGTGATGATGGTGGGGATGG - Intergenic
1175959361 20:62627393-62627415 GAGGGTGATGATGATGGGGTTGG - Intergenic
1176167304 20:63680938-63680960 CAGGGTGATGCTGGTGAGGGAGG + Intronic
1176245927 20:64096818-64096840 CATGATGATGATGGTGATGATGG - Intronic
1176632578 21:9153619-9153641 CACACTGATGATGAGGAGGAAGG - Intergenic
1176872868 21:14097948-14097970 GATGGTGATGTTGATGATGATGG - Intergenic
1176872875 21:14098011-14098033 GATGGTGATGGTGATGATGATGG - Intergenic
1177007027 21:15686238-15686260 CAGAGTGAAGATGATTAGAAGGG + Intergenic
1177932979 21:27308193-27308215 CAGGGTGGTGATGGTAAGGGTGG + Intergenic
1177935587 21:27341308-27341330 CAGGATGTTGATAATGAGGCAGG + Intergenic
1178105169 21:29310404-29310426 CATGGTGATGGTGATGAGGGTGG + Intronic
1178340782 21:31784310-31784332 AATGGTGATGATGGTGATGATGG - Intergenic
1178364028 21:31973589-31973611 GATGATGATGATGATGATGATGG + Intronic
1178617674 21:34147577-34147599 CAGTGTGATGGTGAGAAGGATGG + Intergenic
1178718972 21:34991554-34991576 GATGATGATGATGATGATGATGG + Intronic
1179095780 21:38313468-38313490 TATTGTGATGATGATGATGATGG - Intergenic
1179345875 21:40556905-40556927 CAATGAGAAGATGATGAGGATGG - Intronic
1179415994 21:41199278-41199300 CAGGTGGAGGAAGATGAGGAAGG - Intronic
1180176102 21:46090712-46090734 CTTGGTGATGGTGATGATGATGG + Intergenic
1180176125 21:46090838-46090860 CTTGGTGATGGTGATGATGATGG + Intergenic
1181054057 22:20251513-20251535 GGTGGTGATGGTGATGAGGATGG - Intronic
1181054072 22:20251642-20251664 GATGGTGATGGTGATGAGGATGG - Intronic
1181054089 22:20251771-20251793 GCTGGTGATGGTGATGAGGATGG - Intronic
1181054096 22:20251822-20251844 GATGGTGATGATGATAATGATGG - Intronic
1181054097 22:20251840-20251862 GATGGTGAGGGTGATGAGGATGG - Intronic
1181054120 22:20251997-20252019 GATGGTGATGAGGATGAGGATGG - Intronic
1181054129 22:20252071-20252093 GACGATGGTGATGATGAGGATGG - Intronic
1181339533 22:22166728-22166750 CAGGGTGTTGTTGACTAGGAGGG - Intergenic
1181532605 22:23525477-23525499 CAGGGTGATAATAATGATGGTGG + Intergenic
1181552993 22:23651675-23651697 CAGGGAGTTGAGGAAGAGGAGGG + Intergenic
1181901200 22:26157388-26157410 GGTGGTGATGATGATGAAGATGG - Intergenic
1181960772 22:26620253-26620275 AATGGTGATGATGAAGATGATGG + Intergenic
1181981451 22:26769635-26769657 AAGGGTGATGGTGCTGAGGCTGG + Intergenic
1182006839 22:26967573-26967595 GATAGTGATGATGATGATGATGG + Intergenic
1182090142 22:27588950-27588972 GATGGTGATGATAATGATGATGG - Intergenic
1182090156 22:27589051-27589073 GATGGTGATGATGATGGTGATGG - Intergenic
1182118601 22:27772852-27772874 GATGATGATGATGATGATGATGG - Intronic
1182143803 22:27984461-27984483 CAGAGTGACAAGGATGAGGAGGG - Intronic
1182476468 22:30579234-30579256 GAAGGTGATGGTGATGAAGAGGG - Exonic
1182655136 22:31884099-31884121 CAAGATGCTGATGATGAGGGTGG - Intronic
1183092664 22:35533546-35533568 GATGGTGATGATGATGATGGTGG + Intergenic
1183092671 22:35533594-35533616 AATGGTGATAATGATGATGATGG + Intergenic
1183092703 22:35533909-35533931 GAGAGTGATGATGGTGATGATGG + Intergenic
1183092710 22:35533978-35534000 AATGGTGATGATGAGGATGATGG + Intergenic
1183206936 22:36426251-36426273 CAGGGAGAGGAGGAAGAGGAAGG - Intergenic
1183231273 22:36583683-36583705 CATGGTGATGGTGAGAAGGAAGG - Intronic
1183236642 22:36623714-36623736 AATGATGATGATGATGACGATGG + Intronic
1183244109 22:36680354-36680376 AATGGTGATGATGGTGATGATGG - Intronic
1183268133 22:36843464-36843486 CTTGGTGATGGTGATGATGATGG + Intergenic
1183268136 22:36843494-36843516 CATGGTGGTGATGATGATGATGG + Intergenic
1183494337 22:38133869-38133891 CAAGATGATGATGATGATGATGG - Intronic
1183530491 22:38350878-38350900 GATGGTGATGATGATGATGACGG + Intronic
1183743093 22:39679072-39679094 GAGGGCGGTGAGGATGAGGACGG - Intronic
1184113432 22:42408723-42408745 CTGGGTGATGATGAGCATGAGGG + Intronic
1184263827 22:43335744-43335766 GATGATGATGATGATGATGATGG + Intronic
1184263829 22:43335762-43335784 GATGGTGATGATGATGGTGATGG + Intronic
1184263831 22:43335780-43335802 GATGGTGATGGTGATGATGATGG + Intronic
1184263832 22:43335798-43335820 GATGGTGATGATGATGATGATGG + Intronic
1184286661 22:43475751-43475773 GGTGGTGATGATGATGATGAGGG + Intronic
1184286680 22:43475902-43475924 GATGGTGATGATGGTGAAGATGG + Intronic
1184289675 22:43491867-43491889 GATGGTGATGGTGATGATGATGG + Intronic
1184292406 22:43504907-43504929 CATGGTGATAGTGATGATGATGG + Intronic
1184392672 22:44213691-44213713 GATGGTGATGTTGATGATGATGG - Intronic
1184392679 22:44213759-44213781 GGAGGTGATGATGATGATGATGG - Intronic
1184436331 22:44479952-44479974 GATGGTGATGATGGTGATGATGG - Intergenic
1184519437 22:44984080-44984102 GATGGTGATGATGATGGTGATGG - Intronic
1184519473 22:44984284-44984306 GGTGGTGATGATGATGATGATGG - Intronic
1184519661 22:44985807-44985829 CATGGTGATGGTGATGGTGATGG - Intronic
1184519690 22:44985978-44986000 CATGGTGATGGTGATGAGGATGG - Intronic
1184534964 22:45080276-45080298 GATGATGATGATGATGATGATGG - Intergenic
1184534965 22:45080300-45080322 GATGGTGATGGTGATGAGGATGG - Intergenic
1184534967 22:45080312-45080334 GATGGTGATGATGATGGTGATGG - Intergenic
1184534975 22:45080414-45080436 GATGGTGATGATGGTGATGACGG - Intergenic
1184534977 22:45080432-45080454 GATGATGATGATGATGATGATGG - Intergenic
1184620345 22:45671986-45672008 AAGGGGGAGGATGACGAGGAGGG - Exonic
1184666776 22:45993464-45993486 GATGGTGATGATGGTGATGATGG + Intergenic
1184666833 22:45993748-45993770 GATGGTGATGATGATGATGATGG + Intergenic
1184833924 22:47009246-47009268 GATGGTGATGATGATGCTGATGG - Intronic
1184833932 22:47009349-47009371 GATGGTGATGGTGATGATGATGG - Intronic
1184833940 22:47009428-47009450 GATGGTGATGGTGATGATGATGG - Intronic
1184837824 22:47034468-47034490 CGTGGTGATGATGAAGAGGAGGG + Intronic
1184908930 22:47512676-47512698 GATGGTGATGATGATGGTGATGG + Intergenic
1184908932 22:47512697-47512719 GGTGATGATGATGATGAGGATGG + Intergenic
1184908951 22:47512945-47512967 GATGGTGATGATGATAATGATGG + Intergenic
1184927752 22:47656026-47656048 CATGGTGGTGATGATGATGGTGG - Intergenic
1184927763 22:47656131-47656153 GATGGTGGTGATGATGATGATGG - Intergenic
1184928377 22:47660517-47660539 GAAGGTGATGAAGATGAAGAAGG - Intergenic
1184998667 22:48228412-48228434 GCTGGTGATGCTGATGAGGATGG - Intergenic
1185003424 22:48261020-48261042 GAGGTTGGTGATGATGATGATGG - Intergenic
1185003425 22:48261035-48261057 GATGGTGATGATGAGGAGGTTGG - Intergenic
1185003451 22:48261284-48261306 GATGGTGATGAGGAGGAGGATGG - Intergenic
1185060718 22:48605236-48605258 GATGGTGATGATGGTGATGAGGG + Intronic
1185060721 22:48605254-48605276 GAGGGTGATGGTGAGGATGATGG + Intronic
1185060729 22:48605317-48605339 GATGGTGATGATGGTGATGATGG + Intronic
1185060743 22:48605401-48605423 GATGGTGGTGATGGTGAGGATGG + Intronic
1185078805 22:48697948-48697970 GAGGATGATGATGGTGATGATGG + Intronic
1185136188 22:49074226-49074248 GATGGTGATGGTGATGATGATGG - Intergenic
1185200489 22:49500650-49500672 TAAGGTGATGGTGATGATGATGG - Intronic
1185200492 22:49500677-49500699 GATGGTGATGATGATGGTGATGG - Intronic
1185201355 22:49507566-49507588 GATGGTCATGATGATGACGATGG + Intronic
1185209571 22:49562611-49562633 GATGATGATGATGATGATGATGG - Intronic
1185209585 22:49562773-49562795 AATGGTGATGGTGATGATGATGG - Intronic
1185215275 22:49595750-49595772 GATGATGATGATGATGATGATGG + Intronic
1185262185 22:49873715-49873737 CAGGGTGGGGGTGATGAGGTGGG - Intronic
949396503 3:3620008-3620030 GATGATGATGATGATGATGATGG - Intergenic
949412214 3:3778372-3778394 GATGGTGTTGATGATGGGGATGG - Intronic
949643852 3:6070658-6070680 CAGCCTGCTGATGATGAAGATGG - Intergenic
950120987 3:10482507-10482529 CAGGCTGATGGTGAGGAGAAGGG + Intronic
951270677 3:20619758-20619780 CACACTGATGATGAGGAGGAAGG - Intergenic
951451640 3:22846445-22846467 TGGGGTGATGATGATGATGATGG + Intergenic
951705599 3:25541243-25541265 GAGGCTGAAGAGGATGAGGAGGG - Intronic
952976127 3:38698072-38698094 CATGTTGACCATGATGAGGAAGG + Exonic
953201579 3:40782527-40782549 GATGATGATGATGATGATGATGG + Intergenic
953772251 3:45786950-45786972 CAGGGAGGTGGTGATGAGTAAGG - Intronic
953965897 3:47306775-47306797 AAAGCTGATGATGATGTGGATGG - Intronic
954556007 3:51518295-51518317 GATGATGATGATGATGATGATGG - Intergenic
954600118 3:51860955-51860977 CATGCTGATGATAATGAGAAGGG + Intergenic
954787996 3:53109069-53109091 CAGGGTGATGAGGGTGAGGTTGG - Intronic
955023971 3:55149165-55149187 CAGGGAACTGATGATGAGTAAGG + Intergenic
955102509 3:55864864-55864886 GATGGTGATAATGATGATGATGG - Intronic
955675652 3:61446098-61446120 GACGACGATGATGATGAGGATGG - Intergenic
955811961 3:62800297-62800319 AATGATGATGATGATGATGATGG - Intronic
956043686 3:65172959-65172981 GAAAGTGATGATGATGATGATGG - Intergenic
956093480 3:65692544-65692566 GATGGTGATGATGATGATGTTGG - Intronic
956145058 3:66183824-66183846 CAGGGTGAGGGTGAGGATGAAGG - Intronic
956512826 3:70013151-70013173 GATGATGATGATGATGATGATGG + Intergenic
956665793 3:71640928-71640950 TGGCGTGATGATGATGATGATGG + Intergenic
956772510 3:72538449-72538471 CAGGGTGATGGTGATGGGGGTGG - Intergenic
957099432 3:75809415-75809437 CACACTGATGATGAGGAGGAAGG - Intergenic
957398994 3:79684659-79684681 GATGATGATGATGATGATGATGG + Intronic
957630221 3:82708312-82708334 AATGATGATGATGATGATGATGG + Intergenic
957937983 3:86968779-86968801 GAGGGTGGTGATGGTGATGATGG + Exonic
959425232 3:106178982-106179004 CTGGGTGATGGTGATGCTGAGGG + Intergenic
959698032 3:109270974-109270996 GATGATGATGATGATGATGATGG - Intergenic
959698033 3:109270998-109271020 GATGATGATGATGATGATGATGG - Intergenic
960799660 3:121525418-121525440 CAAGGTAAAGATGATGAAGATGG - Intronic
961116291 3:124332882-124332904 GAGAGAGATGATGATGATGATGG + Intronic
961656683 3:128446232-128446254 CATGGTGATGATGGTGATGGTGG + Intergenic
962375855 3:134858149-134858171 GATGATGATGATGATGATGATGG - Intronic
962876997 3:139542731-139542753 CAGAGAGATGAGGAGGAGGAAGG + Intergenic
963211884 3:142701722-142701744 AAGGGAGATGATGGTGAGAAAGG - Intronic
963560698 3:146861484-146861506 GATGATGATGATGATGATGATGG + Intergenic
964914561 3:161824419-161824441 CAGGGTGACACTGATGTGGATGG - Intergenic
965315307 3:167183204-167183226 CACACTGATGATGAGGAGGAAGG - Intergenic
965376548 3:167931613-167931635 GATGGTGATGATAATGATGATGG - Intergenic
965508674 3:169544288-169544310 CACTTTGATGATGATGATGATGG - Intronic
966978299 3:185105909-185105931 CACACTGATGATGAGGAGGAAGG + Intronic
967269267 3:187719510-187719532 CAGTGTGATGAGGATGTGTAAGG - Intronic
967434088 3:189424555-189424577 CAGGGTGATGCTGATGTTGCCGG - Intergenic
967622213 3:191647956-191647978 CTAGGTGGTGATAATGAGGATGG - Intergenic
967897364 3:194408890-194408912 CGGGGAGATGATGATGATGAAGG + Intronic
968061712 3:195730901-195730923 CAGGGTTTTGAGGATGGGGATGG + Intronic
968589949 4:1452561-1452583 GAAGGTGATGGTGATGAGGATGG - Intergenic
968590042 4:1453385-1453407 GATGGTGATGGTGATGGGGATGG - Intergenic
968592842 4:1467739-1467761 TATGGTGATGGTGATGATGATGG + Intergenic
968592893 4:1468111-1468133 GATGGTGATGGTGATGATGATGG + Intergenic
968592896 4:1468141-1468163 GATGGTGATGGTGATGATGATGG + Intergenic
968592899 4:1468180-1468202 GATGGTGATGGTGATGATGATGG + Intergenic
968592917 4:1468351-1468373 GATGGTGATGATGATGATGATGG + Intergenic
968602120 4:1514647-1514669 CATGGTGATGGTGATGGTGATGG + Intergenic
968709841 4:2105827-2105849 GATGATGATGATGATGATGATGG + Intronic
968920854 4:3521546-3521568 CAGGGTGGTGTCGATGAGAAAGG - Intronic
969104363 4:4793857-4793879 AATGATGATGATGATGATGATGG + Intergenic
969208843 4:5670886-5670908 CATGGTGAAGATGATGGTGATGG - Intronic
969234546 4:5856407-5856429 TATGGTGATGATGATGATGGTGG - Intronic
969234561 4:5856534-5856556 AATGGTAATGATGATGATGATGG - Intronic
969234580 4:5856673-5856695 AATGGTAATGATGATGATGATGG - Intronic
969234697 4:5857500-5857522 GATGGTGATGATGATGACAATGG - Intronic
969256266 4:6003800-6003822 GATGGTGATGATGGTGATGATGG + Intergenic
969256290 4:6004044-6004066 GATGGTGATGATGGTGATGATGG + Intergenic
969256322 4:6004332-6004354 GATGGTGATGGTGATGATGACGG + Intergenic
969268219 4:6080067-6080089 CAGGGTGATGCTGCTGAGCTGGG - Intronic
969281077 4:6171034-6171056 CATGGTGATGGTGGTGAGGGTGG - Intronic
969485306 4:7469134-7469156 CATGGTGGTGATGATGATGATGG + Intronic
969503056 4:7565822-7565844 AATGGTGATGATGATGGTGATGG + Intronic
969503058 4:7565840-7565862 GATGGTGATGATGGTGATGATGG + Intronic
969541142 4:7789539-7789561 GATGGTGATGATGAAAAGGATGG - Intronic
969541154 4:7789604-7789626 GATGGTGAGGATGAAGAGGATGG - Intronic
969628514 4:8321284-8321306 GAGGGTAATGGTGATGATGATGG - Intergenic
969628518 4:8321314-8321336 GATGATGATAATGATGAGGATGG - Intergenic
969628523 4:8321353-8321375 GAGGGTGATGGTGGTGATGATGG - Intergenic
969628554 4:8321644-8321666 GATGGTGGTGATGATGATGATGG - Intergenic
969710788 4:8841791-8841813 GATGATGATGATGATGAAGATGG + Intergenic
969710861 4:8842386-8842408 GATGATGATGATGATGATGATGG + Intergenic
969710865 4:8842506-8842528 GATGATGATGATGATGATGATGG + Intergenic
969710866 4:8842572-8842594 GATGATGATGATGATGATGATGG + Intergenic
969829342 4:9782172-9782194 CAGGGTCCAGATGATGAGTAGGG - Exonic
969835646 4:9838225-9838247 GATGGTAATGATGATGACGATGG + Intronic
969853579 4:9981197-9981219 CATGATGGTGATGATGATGATGG + Intronic
969853580 4:9981200-9981222 GATGGTGATGATGATGATGGTGG + Intronic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970498961 4:16657330-16657352 CAGGGTAATAATGATGATGATGG - Intronic
971166284 4:24187154-24187176 CAAGGTGATGATGATGATGGCGG + Intergenic
971330312 4:25676358-25676380 CAGGATGATGATGAAGACGACGG - Exonic
971524711 4:27602357-27602379 GATGATGATGATGATGATGATGG + Intergenic
972148955 4:36064887-36064909 AAGGGTGGAGATGATGAGAAAGG + Intronic
973589160 4:52423061-52423083 CATGGTGATGATGATGACAGTGG + Intergenic
974146141 4:57949812-57949834 CAGGGTTAAGATTATGAGTATGG - Intergenic
975441235 4:74413357-74413379 CATGGTGATGATGATGGTGATGG + Intergenic
975791631 4:77959093-77959115 GATGATGATGATGATGATGATGG + Intergenic
976364320 4:84215897-84215919 GATGGTGATGATGATGATGTTGG - Intergenic
976557020 4:86461610-86461632 CACACTGATGATGAGGAGGAAGG + Intronic
976687823 4:87835575-87835597 CAGGCTGATGAGGATGACCAGGG + Intronic
977016802 4:91701277-91701299 CACACTGATTATGATGAGGAAGG - Intergenic
977079351 4:92504106-92504128 TAGGGTGCTGATGTTGAGAAAGG + Intronic
977367736 4:96093093-96093115 AAGGATAATGATGATGAGGCTGG - Intergenic
977583848 4:98753692-98753714 CATGATGATGATGATGATGGTGG - Intergenic
977641989 4:99367758-99367780 CACACTGATGATGAGGAGGAAGG + Intergenic
977679544 4:99784254-99784276 CAGGGTCGTTATGATGAAGATGG - Intergenic
977922612 4:102662211-102662233 GATGATGATGATGATGACGATGG + Intronic
978518714 4:109596555-109596577 CATGCTGATGATAATGAGAAGGG - Intronic
978754079 4:112284782-112284804 CAGGGTGATCCTGTTGAGCAGGG - Intronic
979817536 4:125128766-125128788 CAGGGAGAGGGAGATGAGGAAGG - Intergenic
979871576 4:125829346-125829368 CAGGATGATGATGAGGAGAGAGG + Intergenic
979893581 4:126131445-126131467 CACACTGATGATGAGGAGGAAGG + Intergenic
980507491 4:133741436-133741458 CAGGGTGAAGGTTAGGAGGAGGG - Intergenic
980550518 4:134328451-134328473 CAAGGTGATGGTGATGAAGGGGG + Intergenic
980667687 4:135960314-135960336 CACACTGATGATGAGGAGGAAGG - Intergenic
980979670 4:139643473-139643495 CAGGGTGCTGAGGAGGAAGAAGG - Intergenic
982104208 4:151997601-151997623 GAAGATGATGATGATGAGGGTGG - Intergenic
982104209 4:151997604-151997626 GAGGAAGATGATGATGATGAGGG - Intergenic
982278580 4:153661401-153661423 GATGATGATGATGATGATGATGG + Intergenic
982491580 4:156037382-156037404 CATGGTGATTATGATTAGCACGG - Intergenic
982939913 4:161537507-161537529 TAGGGTGGGGATGCTGAGGATGG - Intronic
983273020 4:165585794-165585816 GATGATGATGATGATGATGATGG + Intergenic
983706850 4:170671982-170672004 GATGGCGATGATGATGAAGATGG + Intergenic
984621124 4:181953276-181953298 CATGATGATGATGATGATGATGG - Intergenic
985034745 4:185827123-185827145 AATGGTGATGATGATGATGATGG - Intronic
985034750 4:185827186-185827208 GATGGTGATGATGATGATGATGG - Intronic
985034751 4:185827204-185827226 GATGGTGATGATGGTGATGATGG - Intronic
985034757 4:185827258-185827280 GATGGTGATGATGGTGATGATGG - Intronic
985034761 4:185827303-185827325 GATGGTGATGATGGTGATGATGG - Intronic
985034763 4:185827321-185827343 GATGATGATGATGATGATGATGG - Intronic
985034765 4:185827435-185827457 GATGATGATGATGATGATGATGG - Intronic
985034767 4:185827612-185827634 GATGATGATGATGATGATGATGG - Intronic
985034770 4:185827684-185827706 GATGGTGATGATGATGATGGTGG - Intronic
985034772 4:185827702-185827724 GATGGTGATGGTGATGATGATGG - Intronic
985034776 4:185827741-185827763 GATGGTGATGATGGTGATGATGG - Intronic
985034778 4:185827759-185827781 GATGGTGATGGTGATGATGATGG - Intronic
985034781 4:185827792-185827814 GATGGTGATGATGACGATGATGG - Intronic
985034786 4:185827861-185827883 GATGGTGACGATGATGATGATGG - Intronic
985034789 4:185827908-185827930 GATGGTGATGATGATGATGATGG - Intronic
985034791 4:185827935-185827957 GACGATGATGATGATGATGATGG - Intronic
985034793 4:185827979-185828001 GATGGTGATGATGATGATGATGG - Intronic
985034794 4:185827997-185828019 GATGGTGACGATGATGATGATGG - Intronic
985034796 4:185828035-185828057 GAGGATGATGATGGTGATGATGG - Intronic
985857320 5:2439951-2439973 GATGGTGATGATAATGATGATGG - Intergenic
985900190 5:2782759-2782781 GAGGGTGATGAGGATGATGTTGG - Intergenic
985978833 5:3445827-3445849 GATGGTGATGATGGTGATGATGG + Intergenic
985978905 5:3446235-3446257 GATGGTGATGATGGTGATGATGG + Intergenic
985978948 5:3446568-3446590 GATGGTGATGATGGTGATGATGG + Intergenic
986075645 5:4335207-4335229 GATGATGATGATGATGATGATGG + Intergenic
986136612 5:4985707-4985729 AAAGGTGATGAAGATCAGGATGG + Intergenic
986196405 5:5540197-5540219 GAGGATGATGATGATGATGGTGG + Intergenic
986196414 5:5540374-5540396 GATGATGATGATGATGATGATGG + Intergenic
986436748 5:7741629-7741651 GATGGTGATGGTGATGATGATGG - Intronic
986436750 5:7741647-7741669 GATGATGATGATAATGAGGATGG - Intronic
986736301 5:10670048-10670070 GATGGTGATAATGATGATGAAGG + Intergenic
986736331 5:10670267-10670289 GATGGTGATGATGGTGATGATGG + Intergenic
986736333 5:10670276-10670298 GATGGTGATGATGGTGATGAGGG + Intergenic
986856730 5:11877721-11877743 GATGATGATGATGATGATGATGG - Intronic
987002733 5:13676735-13676757 GATGATGATGATGATGATGATGG + Intergenic
987574046 5:19703388-19703410 CACAATGATGATGAGGAGGAAGG + Intronic
987817694 5:22924249-22924271 GATGATGATGATGATGATGAAGG + Intergenic
987863257 5:23510649-23510671 GATGATGATGATGATGATGATGG + Intronic
988706878 5:33735307-33735329 CAGGGTGATGCTGATGCTGCTGG + Intronic
988787874 5:34580807-34580829 TAAGGTGATGATGATAATGAAGG + Intergenic
989742479 5:44789286-44789308 CACACTGATGATGAGGAGGAAGG + Intergenic
990059833 5:51633873-51633895 GATGATGATGATGATGATGATGG + Intergenic
990109405 5:52305199-52305221 CACACTGATGATGAGGAGGAAGG + Intergenic
990280410 5:54244726-54244748 AATGGTGATAATGATGGGGAGGG - Intronic
991580671 5:68151972-68151994 CTGGGAGATGATGATGGTGATGG + Intergenic
991981434 5:72235563-72235585 CAGGATGTTGATTATGAGGAAGG + Intronic
992453243 5:76892167-76892189 CATGGTGATGATGATGGTAATGG + Intronic
992467101 5:77017147-77017169 GGAGGTGATGATGATGATGATGG + Intergenic
993547775 5:89233648-89233670 GATGATGATGATGATGATGATGG - Intergenic
993548644 5:89245464-89245486 GATGGTGATGATGGTGATGATGG - Intergenic
994896449 5:105710154-105710176 CAGGATGTTGATCGTGAGGAAGG - Intergenic
995166685 5:109051819-109051841 CAGCATGAAGATGATGAAGATGG + Intronic
995189148 5:109302371-109302393 CAGGGGTATGATGTGGAGGAGGG - Intergenic
995256927 5:110057550-110057572 GATGGTGATGATGATTATGATGG + Intergenic
995592339 5:113712629-113712651 CACACTGATGATGAGGAGGAAGG + Intergenic
995739597 5:115341522-115341544 CAACATGAAGATGATGAGGATGG - Intergenic
996098781 5:119426615-119426637 AAGGATGAAGATGATTAGGAGGG + Intergenic
996217083 5:120882271-120882293 AATGATGATGATGATGATGATGG - Intergenic
996786142 5:127238444-127238466 CAATGAGATGATGATGATGATGG - Intergenic
997289019 5:132711000-132711022 GAGGAAGATGATGATGAAGAGGG - Exonic
997383330 5:133453276-133453298 TATGATGATGATGATGATGATGG - Intronic
997458655 5:134037038-134037060 CAGGCTGATGAGGATGCAGAAGG + Intergenic
998622787 5:143812746-143812768 CATGGCGATGATGGTGATGATGG - Intronic
998811583 5:145971889-145971911 GATGATGATGATGATGATGATGG + Intronic
998998926 5:147898340-147898362 GAAGGTGATGATGAGCAGGAAGG + Intronic
999006164 5:147981885-147981907 GATGATGATGATGATGATGAAGG - Intergenic
999017685 5:148126313-148126335 GATGATGATGATGATGATGATGG + Intronic
999056489 5:148583611-148583633 GATGATGATGATGATGATGATGG - Intronic
999190266 5:149742009-149742031 GATGGTGATGATGATGATGATGG + Intronic
999278660 5:150349908-150349930 CAGGGTGATGATGATTAACAAGG - Intergenic
999470652 5:151851911-151851933 GATGATGATGATGATGATGATGG - Intronic
999525812 5:152404694-152404716 GACGGTGGTGATGCTGAGGATGG + Exonic
999871857 5:155760051-155760073 GAGGGTGATGATGATAACAATGG - Intergenic
999871868 5:155760123-155760145 GAGGGTGATGGAGATGATGATGG - Intergenic
999871887 5:155760231-155760253 GAGGGTGATGGAGATGATGATGG - Intergenic
999871891 5:155760255-155760277 GAGGGTGATGCTGAGGATGATGG - Intergenic
999871907 5:155761361-155761383 GAGAGTGATGATGAGGATGATGG - Intergenic
999871909 5:155761385-155761407 GAGGGTGATGGAGATGATGATGG - Intergenic
999871917 5:155761433-155761455 GAGGGTGATGGTGAGGATGATGG - Intergenic
999871922 5:155761457-155761479 GAGGGTGATGGTGAGGATGATGG - Intergenic
999871936 5:155761539-155761561 GAGGGTGATGGTGAGGATGATGG - Intergenic
999871948 5:155761608-155761630 GAGAGTGATGATGAGGATGATGG - Intergenic
999871951 5:155761644-155761666 GAGAGTGATGATGAGGATGATGG - Intergenic
1000161907 5:158606067-158606089 CAATGTGAAGATGAAGAGGACGG - Intergenic
1000780414 5:165473491-165473513 AAGGCTGATAATGATGATGAAGG - Intergenic
1001214260 5:169840604-169840626 GATGATGATGATGATGATGATGG + Intronic
1001246737 5:170110591-170110613 GATGGTGATGATGATGTTGATGG + Intergenic
1001307114 5:170583414-170583436 CGTGGTGGTGATGATGATGATGG + Intronic
1001313043 5:170624817-170624839 CAGGGTAAGGATGGTGAGGAAGG - Intronic
1001482586 5:172098849-172098871 GGTGGTGATGATGATGATGATGG - Intronic
1001482614 5:172099008-172099030 GATGGTGGTGATGATGATGATGG - Intronic
1001650653 5:173313609-173313631 GAGGGTGATGATGTTGGTGAAGG + Intergenic
1001730909 5:173956201-173956223 CAGCGTGAAGAGGTTGAGGAAGG - Exonic
1001780421 5:174364099-174364121 GATGGTGATGATGATGATGATGG + Intergenic
1001858747 5:175034761-175034783 AATGGTGATGATGATGGTGATGG + Intergenic
1001858798 5:175035219-175035241 GATAGTGATGATGATGATGATGG + Intergenic
1002400516 5:178989230-178989252 CAGGGTGGTGAGGGTGGGGAGGG - Intronic
1002511761 5:179724747-179724769 AAGGGAGATGAGGAGGAGGAAGG + Exonic
1002686792 5:181018487-181018509 CAGGATGTTGATGGTGAGGGAGG - Intergenic
1003243641 6:4366176-4366198 TAGGCTGATGATGATGATTATGG - Intergenic
1003311048 6:4970316-4970338 GATGATGATGATGATGATGAGGG + Intergenic
1003513906 6:6803008-6803030 AAGGGTGAGGAAGGTGAGGACGG + Intergenic
1003516314 6:6821781-6821803 AGTGGTGATGATGATGATGATGG + Intergenic
1003618530 6:7676552-7676574 AAGGGTGATGATGATGCGCTTGG - Intergenic
1003681176 6:8258745-8258767 GATGATGATGATGATGACGATGG - Intergenic
1003988217 6:11459397-11459419 GATGATGATGATGATGATGATGG + Intergenic
1004186334 6:13424343-13424365 GATGATGATGATGATGATGATGG + Intronic
1004244433 6:13959567-13959589 TAGGATGTTGATGATGAAGATGG + Intronic
1004479004 6:16001078-16001100 AGGGGAGATGATGAGGAGGAAGG + Intergenic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1006038698 6:31235365-31235387 CACACTGATGATGAGGAGGAAGG - Intergenic
1006057141 6:31393731-31393753 AAGGTTGATGGTGGTGAGGATGG + Intergenic
1006144305 6:31949148-31949170 CAGGGTGAGCAAGTTGAGGAAGG - Intronic
1006382582 6:33708509-33708531 CAGGGTGATCATTAGGACGAAGG + Intronic
1006403224 6:33829780-33829802 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006403237 6:33829835-33829857 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006403250 6:33829890-33829912 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006403275 6:33830000-33830022 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006501691 6:34463481-34463503 GATGATGATGATGATGATGATGG - Intergenic
1006891068 6:37429162-37429184 CAGAATGATGATGATGGGGGTGG - Intergenic
1007017467 6:38483128-38483150 CAGAGAAATGATGAAGAGGATGG - Intronic
1007230856 6:40346894-40346916 GATGATGATGATGATGATGATGG - Intergenic
1007369720 6:41418369-41418391 AGGGGTGATGGTGGTGAGGATGG - Intergenic
1007554970 6:42758153-42758175 CAGGGAGAAGAAGATGAGGAAGG - Intronic
1007566546 6:42855552-42855574 GATGATGATGATGATGATGATGG + Intronic
1007813975 6:44507062-44507084 GAGGATGATGAGGATGATGATGG + Intergenic
1007886537 6:45236430-45236452 CACACTGATGATGAGGAGGAAGG + Intronic
1008050866 6:46899214-46899236 CAGGGTGTTGATGACGTGAAAGG + Intronic
1008127264 6:47682589-47682611 CAGGGAGAAGATAATGTGGAAGG - Exonic
1008425993 6:51357323-51357345 TATGATGATGATGATGATGATGG - Intergenic
1008535853 6:52505688-52505710 AAGGGTGAGGATGAAGAGGCGGG + Exonic
1008900271 6:56606196-56606218 CAGGATGACGATGATGATGATGG - Intronic
1008974243 6:57405906-57405928 CTGGGTGATGATGATGATGGTGG - Intronic
1009062939 6:58418981-58419003 CACACTGATGATGAGGAGGAAGG - Intergenic
1009250619 6:61293528-61293550 CACACTGATGATGAGGAGGAAGG - Intergenic
1009279716 6:61732745-61732767 CAGGGTTATGATGATGGCTACGG - Exonic
1011484176 6:87824993-87825015 GATGATGATGATGATGATGATGG - Intergenic
1011534419 6:88360678-88360700 CAGAGAGATGAAGAGGAGGATGG - Intergenic
1011792463 6:90913425-90913447 CAGGGGGATGGTGAGGAGGAGGG - Intergenic
1011859489 6:91737369-91737391 AAGGGTGATAAGGATGAAGACGG - Intergenic
1012532416 6:100253854-100253876 CATGGTGATGATGGTGATCAGGG - Intergenic
1012625480 6:101399648-101399670 CACGGAGATGATGATGACGATGG + Intronic
1012954447 6:105553704-105553726 GAGGATGAGGATGATGATGACGG - Intergenic
1013195679 6:107843582-107843604 CAGGTTGATGAAGATGTGGGTGG - Intergenic
1013727053 6:113111730-113111752 GATGATGATGATGATGATGATGG - Intergenic
1013767165 6:113588573-113588595 GATGGTGATGATGATGATGATGG + Intergenic
1014401386 6:120994640-120994662 GAGGATGATGATGGTGATGATGG - Intergenic
1014438548 6:121447467-121447489 CAGCATGAAGATGATGAAGATGG - Exonic
1015467550 6:133563707-133563729 GATGATGATGATGATGATGATGG - Intergenic
1015610004 6:135006782-135006804 CATGATGATGATGACGATGATGG + Intronic
1015729528 6:136334317-136334339 CATGGTGTTGGTGATAAGGAAGG + Intergenic
1015736293 6:136403249-136403271 GACGGTGATAAAGATGAGGATGG - Intronic
1015756893 6:136616709-136616731 GATGATGATGATGATGATGATGG + Intronic
1015782985 6:136890565-136890587 CACGGTGATGGGGGTGAGGAGGG - Intronic
1015917301 6:138230252-138230274 CAGGGTTTTGAAGATGGGGAGGG - Intronic
1016614194 6:146028181-146028203 CAAGGTGATGAGAATGAGGGCGG + Intronic
1017307716 6:152938825-152938847 GATGGTGTTGATGATGATGATGG - Intergenic
1017431387 6:154374540-154374562 GAGGATGTTGATGATAAGGAAGG - Intronic
1017461693 6:154656848-154656870 GATGATGATGATGATGATGATGG + Intergenic
1017720186 6:157238399-157238421 GAGGGTGATGGTGATGATGATGG + Intergenic
1017720189 6:157238417-157238439 GATGGTGATGATGGTAAGGATGG + Intergenic
1017720199 6:157238462-157238484 TATGGTGATGGTGATGATGAGGG + Intergenic
1017720214 6:157238510-157238532 GAGGGTGATGGTGATGGGGGTGG + Intergenic
1017750122 6:157483538-157483560 CACAGTAATGATGATGATGATGG + Intronic
1017816301 6:158018947-158018969 CATGGTGATGACCGTGAGGATGG + Intronic
1017881637 6:158566392-158566414 CAGGATGATGATGGTGAGGGAGG + Intronic
1017969518 6:159299548-159299570 CTGGGTGAAGAAGAGGAGGAAGG + Intergenic
1018103434 6:160461734-160461756 GATGGTGATGAGGATGATGATGG - Intergenic
1018131538 6:160736501-160736523 GATGGTGATGATGATGATTATGG + Intronic
1018683026 6:166280566-166280588 CAGGGAGAGGAGGATGAGGGTGG - Intergenic
1018773651 6:166994535-166994557 CAAGGTGAAAATTATGAGGACGG - Intergenic
1018840924 6:167515979-167516001 GATGGTGATGATGATGATGGTGG - Intergenic
1018840976 6:167516579-167516601 GATGGTGATGATGATGATGGTGG - Intergenic
1018887293 6:167950777-167950799 GAGGGTGAGGAGGATGAGGATGG + Intronic
1018958958 6:168432576-168432598 CAGGGTGAAGATGGTGACAATGG - Intergenic
1018996547 6:168714698-168714720 GATGAAGATGATGATGAGGATGG + Intergenic
1018996575 6:168714884-168714906 GAGAATGATGATGAGGAGGAGGG + Intergenic
1018996609 6:168715067-168715089 GAGGATGATGGTGAAGAGGAGGG + Intergenic
1018996717 6:168715822-168715844 GAGAATGATGATGAGGAGGATGG + Intergenic
1019134637 6:169900301-169900323 TGGGGTGATGATGATGATGGAGG + Intergenic
1019134700 6:169900707-169900729 TGGGGTGATGATGATGATGGAGG + Intergenic
1019134759 6:169901116-169901138 TGGGGTGATGATGATGATGGAGG + Intergenic
1019134764 6:169901151-169901173 TGGGGTGATGATGATGATGGAGG + Intergenic
1019134870 6:169901769-169901791 TGGGGTGATGATGATGATGGAGG + Intergenic
1019134895 6:169901915-169901937 TGGGGTGATGATGATGATGGAGG + Intergenic
1019138029 6:169923593-169923615 GATGGTGATAATGATGGGGATGG - Intergenic
1019138090 6:169924272-169924294 GAATGTGATGATGATGATGACGG - Intergenic
1019180392 6:170183781-170183803 GATGGTGATGATGATGATGATGG + Intergenic
1019251588 7:16659-16681 GAGGGTGAGGATGAGGATGAGGG - Intergenic
1019288871 7:237505-237527 GATGGTGATGATGATAACGATGG + Intronic
1019288885 7:237604-237626 AATGGTGATGGTGATGATGATGG + Intronic
1019310052 7:355758-355780 AATGGTGATGATGATGATGGTGG - Intergenic
1019310078 7:355974-355996 GATGATGATGATGATGATGATGG - Intergenic
1019310079 7:356004-356026 GATGATGATGATGATGATGATGG - Intergenic
1019353474 7:566447-566469 CATGGTGAAGATGGTGATGATGG - Intronic
1019353503 7:566721-566743 GATGGTGATGATGATGATGATGG - Intronic
1019353605 7:567541-567563 GAAGGTGATGGTGATGATGATGG - Intronic
1019369556 7:654020-654042 GATGGTGATGATGATGGTGACGG - Intronic
1019369560 7:654061-654083 GATGGTGATGGTGATGAAGATGG - Intronic
1019369567 7:654112-654134 GATGGTGATGGTGATGAAGATGG - Intronic
1019369571 7:654168-654190 GATGGTGATGGTGATGAAGATGG - Intronic
1019369595 7:654401-654423 GATGGTGATGGTGATGAAGATGG - Intronic
1019369627 7:654681-654703 GATGGTGAAGGTGATGAGGATGG - Intronic
1019372021 7:667025-667047 GATGGTGATGATGATAATGATGG + Intronic
1019438839 7:1036562-1036584 CAGGGTGTTGATAATGGGGGAGG + Intronic
1019688508 7:2396224-2396246 CAGGGTTCTGTTAATGAGGAAGG + Intergenic
1019737391 7:2657376-2657398 GATGGTGATGATGGTGATGATGG + Intronic
1019765948 7:2850405-2850427 GATGGTGGTGATGATGATGATGG - Intergenic
1019765998 7:2850810-2850832 GATGGTGGTGATGATGAAGATGG - Intergenic
1019770359 7:2880552-2880574 CAGGGCGATGATGGAGAGAAAGG + Intergenic
1019843408 7:3473030-3473052 CAGGATGCTGATGATGATGGCGG - Intronic
1019949924 7:4363126-4363148 CAGAGTAAGGAAGATGAGGAAGG - Intergenic
1020247175 7:6438866-6438888 GATGATGATGATGATGATGATGG + Intronic
1020275682 7:6623097-6623119 GAAGATGATGATGATGATGATGG - Exonic
1020939823 7:14518310-14518332 GAGGGTGAAGATTAAGAGGAGGG + Intronic
1020944331 7:14582614-14582636 TATGATGATGATGATGATGATGG + Intronic
1021006005 7:15396002-15396024 TAGGGAGATGATGATGATGATGG - Intronic
1021508859 7:21413863-21413885 AAGGATGATGATGAAGAGGAGGG + Intergenic
1021515964 7:21487743-21487765 GATGATGATGATGATGATGATGG + Intronic
1021767978 7:23968369-23968391 GAGGGTGGGGATGTTGAGGATGG - Intergenic
1022102386 7:27176110-27176132 CAGGGTGCGGAGGAGGAGGATGG + Intronic
1022126136 7:27359428-27359450 GAGGGTGAGGAAGAGGAGGAGGG + Intergenic
1022160451 7:27705386-27705408 GATGATGATGATGATGATGATGG - Intergenic
1022198209 7:28090277-28090299 GAAGGTGATGATGATGATAATGG - Intronic
1022295173 7:29043997-29044019 GATGATGATGATGATGATGATGG + Intronic
1022781725 7:33591866-33591888 GATGATGATGATGATGATGATGG - Intronic
1023059405 7:36313799-36313821 GATGATGATGATGATGACGATGG + Intergenic
1023154500 7:37234678-37234700 GATGATGATGATGATGATGATGG + Intronic
1023362980 7:39434524-39434546 GATAGTGATGATGATGATGATGG + Intronic
1023472732 7:40542239-40542261 GATGATGATGATGATGACGATGG - Intronic
1023615622 7:42016703-42016725 GATGATGATGATGATGATGATGG - Intronic
1023851414 7:44152360-44152382 CAGGGTGATGCTGGTGAAGGTGG - Exonic
1023882586 7:44328695-44328717 GATGGTGATGGTGATGATGAAGG + Intronic
1024114273 7:46177619-46177641 CAAGGTGATGATATTTAGGAGGG + Intergenic
1024121706 7:46248613-46248635 GAGAGTGAAGATGAAGAGGAGGG - Intergenic
1024217559 7:47260355-47260377 GATGGTGATGATGATGATGGTGG + Intergenic
1024217580 7:47260627-47260649 AATGGTGAAGATGATGATGATGG + Intergenic
1024230966 7:47363100-47363122 GATGATGATGATGATGATGATGG - Intronic
1024230983 7:47363293-47363315 GATGGTGATGATGATGGTGATGG - Intronic
1024230984 7:47363299-47363321 GATGGTGATGGTGATGATGATGG - Intronic
1024334574 7:48194292-48194314 GATGGTGATGATGATGATAATGG + Intronic
1024884874 7:54129272-54129294 GATGGTGATGATGATGATGGTGG + Intergenic
1025122572 7:56317641-56317663 CACACTGATGATGAGGAGGAAGG + Intergenic
1025279538 7:57616748-57616770 AATGATGGTGATGATGAGGAAGG + Intergenic
1025282260 7:57636682-57636704 GAGGATGATGATGGTGAGAATGG + Intergenic
1025282263 7:57636739-57636761 AATGATGATGATTATGAGGATGG + Intergenic
1025302467 7:57828780-57828802 AATGATGATGATTATGAGGATGG - Intergenic
1025302470 7:57828837-57828859 GAGGATGATGATGGTGAGAATGG - Intergenic
1025305193 7:57848752-57848774 AATGATGGTGATGATGAGGAAGG - Intergenic
1025770588 7:64501612-64501634 CTGGATGATGATGATAATGAAGG + Intergenic
1025942443 7:66083997-66084019 CAGGGAGTTGAGGAAGAGGAGGG - Intronic
1026023588 7:66728624-66728646 CGAGGCGAGGATGATGAGGATGG - Intronic
1026023597 7:66728681-66728703 TGAGGTGAGGATGATGAGGATGG - Intronic
1026113261 7:67475300-67475322 GATGGTGATGGTGATGATGATGG + Intergenic
1026286455 7:68967762-68967784 GGTGGTGATGATGATGATGATGG + Intergenic
1026286459 7:68967792-68967814 AATGGTGATGATGATGGTGATGG + Intergenic
1026405048 7:70056390-70056412 CAGGGTGAAGGTGATGAAGGAGG - Intronic
1026450140 7:70521495-70521517 CAGGGTTTTGATGATGTTGATGG + Intronic
1026625466 7:71988088-71988110 GATGATGATGATGATGAAGATGG - Intronic
1026643826 7:72150884-72150906 GATGATGATGATGATGATGATGG + Intronic
1027766136 7:82344627-82344649 CAGGGGGAGGATGATGGTGAAGG + Intronic
1027776172 7:82467229-82467251 AATGATGATGATGATGATGATGG - Intergenic
1027952891 7:84840849-84840871 GATGATGATGATGATGATGATGG - Intergenic
1028577378 7:92367019-92367041 CAGGATCATTATCATGAGGAAGG - Intronic
1029202874 7:98850819-98850841 AGGGGTGATGGTGATGAGGGAGG + Intronic
1029385793 7:100242740-100242762 CAGGGTGATTATGGAGAGGCAGG + Intronic
1029490642 7:100868244-100868266 CAGGGTGCTGACGGGGAGGAGGG - Intronic
1029871196 7:103694483-103694505 GATGATGATGATGATGATGATGG + Intronic
1030112451 7:106038423-106038445 CAGAGTGATGAGCATGAGGCTGG + Intergenic
1030138996 7:106285594-106285616 CAGGGTCAGGAGGATCAGGAGGG - Intronic
1030202047 7:106915601-106915623 GATGATGATGATGATGATGATGG + Intergenic
1030328617 7:108248959-108248981 CAGGATGATGATGATGATGATGG + Intronic
1030872177 7:114769776-114769798 GATGATGATGATGATGATGATGG - Intergenic
1031365138 7:120891853-120891875 CAATGTGAAGATGATAAGGATGG - Intergenic
1031542396 7:123010208-123010230 CAGGATGTTGATAATGGGGAAGG + Intergenic
1031566841 7:123309413-123309435 CAGGGTCATGTAGATGAGAAAGG - Intergenic
1031798444 7:126209674-126209696 TAGGATGATGATGGGGAGGAAGG - Intergenic
1031846942 7:126816627-126816649 CATGATGATGATGATGATGATGG + Intronic
1032529386 7:132607787-132607809 GATAGTGATGATGATGATGATGG - Intronic
1032610562 7:133408186-133408208 TAGGGTGATGGTGATGATGGAGG + Intronic
1032610626 7:133408458-133408480 GATGGTGATGATGATGATGGAGG + Intronic
1032854059 7:135819500-135819522 AATGGTGATGATGATGGTGATGG - Intergenic
1032859822 7:135866319-135866341 CATGGTGATGATGAGGAGGAGGG - Intergenic
1033304148 7:140212171-140212193 GATGGTGATGATGATGATGATGG + Intergenic
1033919942 7:146378374-146378396 CATGACGATGATGATGATGATGG + Intronic
1034434537 7:151057067-151057089 CTGGATGACGATGATGAGGTAGG - Exonic
1034679034 7:152914138-152914160 GATGGTGGTGATGATGATGATGG - Intergenic
1034679044 7:152914237-152914259 GATGGTGATGATGGTGATGATGG - Intergenic
1034679111 7:152915006-152915028 GACGGTGATGATGATGATGGTGG - Intergenic
1034826152 7:154265207-154265229 AATGGTGATGATGATAATGATGG + Intronic
1034953629 7:155318071-155318093 GAAGGTGATGGTGATGATGATGG - Intergenic
1034953658 7:155318498-155318520 GATGGTGATGATGACGATGATGG - Intergenic
1034959302 7:155355171-155355193 GAAGATGATGATGATGATGATGG + Intergenic
1034969806 7:155411838-155411860 CATGATGATGGTGATGATGATGG - Intergenic
1035014143 7:155749597-155749619 AATGATGATGATGATGATGATGG + Intronic
1035041753 7:155933963-155933985 GATGGTGATGATGATGATGGTGG - Intergenic
1035041760 7:155934025-155934047 GATGGTGATGATGATGATGATGG - Intergenic
1035041763 7:155934055-155934077 GATGGTGATGATGATGATGATGG - Intergenic
1035041770 7:155934120-155934142 GATGGTGATAATGATGATGATGG - Intergenic
1035041773 7:155934150-155934172 GATGGTGATAATGATGATGATGG - Intergenic
1035041776 7:155934180-155934202 GATGGTGATAATGATGATGATGG - Intergenic
1035106943 7:156449111-156449133 CATAGTGATGATGATGATGGTGG + Intergenic
1035170589 7:157015283-157015305 CAGGGAGAGGCTGAGGAGGAGGG - Intergenic
1035340170 7:158155460-158155482 GATGGTGATGGTGATGATGATGG - Intronic
1035340171 7:158155472-158155494 GATGGTGATGATGATGGTGATGG - Intronic
1035340172 7:158155478-158155500 GATGGTGATGGTGATGATGATGG - Intronic
1035340184 7:158155592-158155614 GATGGTGATGGTGATGATGATGG - Intronic
1035340199 7:158155730-158155752 GATGGTGATGATGGTGATGATGG - Intronic
1035340201 7:158155748-158155770 GATGGTGATGATGATGGTGATGG - Intronic
1035342423 7:158172457-158172479 GAGGGTGATGATGGTAGGGATGG - Intronic
1035639628 8:1174477-1174499 GATGGTAATGATGATGATGATGG - Intergenic
1035659618 8:1337159-1337181 GATGGTGGTGATGATGATGATGG + Intergenic
1035659657 8:1337443-1337465 GATGGTGATGATGGTGAGAATGG + Intergenic
1035659662 8:1337461-1337483 AATGGTGAGGATGATGGGGATGG + Intergenic
1035767680 8:2119970-2119992 GAGGGTGTTGAAGATGAGGAAGG + Intronic
1035931997 8:3790332-3790354 GATGGTGATGGTGATGATGATGG + Intronic
1036053095 8:5222054-5222076 TAGGGTGAGGAGGAGGAGGAAGG + Intergenic
1036460570 8:8948803-8948825 AAGTTTGATGAAGATGAGGATGG - Intergenic
1036476319 8:9096536-9096558 CACTGTGAGGATGATCAGGAGGG + Intronic
1036704030 8:11033183-11033205 GAGGATGATGGTGATGAGGATGG + Intronic
1036704058 8:11033465-11033487 GATGGTGATGATGATGATGGTGG + Intronic
1037157723 8:15725608-15725630 GATGATGATGATGATGATGACGG + Intronic
1037717098 8:21409873-21409895 CAGGGTGCTGAGGATGTGGCTGG - Intergenic
1037733187 8:21546528-21546550 CAGAGTGATGGAGATGAGGCTGG - Intergenic
1037904688 8:22708976-22708998 GATGGTGATGATGATGGTGATGG - Intergenic
1037904689 8:22708982-22709004 GATGGTGATGGTGATGATGATGG - Intergenic
1037904696 8:22709041-22709063 GATGGTGATGATGATGGTGATGG - Intergenic
1037904697 8:22709047-22709069 GATGGTGATGGTGATGATGATGG - Intergenic
1037904732 8:22709392-22709414 GATGGTGATGATGATGGTGATGG - Intergenic
1037904733 8:22709398-22709420 GATGGTGATGGTGATGATGATGG - Intergenic
1037904734 8:22709410-22709432 GATGGTGATGATGATGGTGATGG - Intergenic
1037904735 8:22709416-22709438 GATGGTGATGGTGATGATGATGG - Intergenic
1037904738 8:22709451-22709473 GATGGTGATGATGATGGTGATGG - Intergenic
1037904739 8:22709457-22709479 GATGGTGATGGTGATGATGATGG - Intergenic
1037904751 8:22709576-22709598 CAGGGTGATGATATTGATGATGG - Intergenic
1037908835 8:22731322-22731344 CAATGTGAAGATGATGAGGATGG + Intronic
1037963139 8:23114864-23114886 CAGGGTGATGAAGACCAGGTTGG - Intronic
1038019215 8:23538967-23538989 GAGGGTGAGGATGGTGGGGAGGG - Intronic
1038180356 8:25221670-25221692 AATGATGATGATGATGATGATGG - Intronic
1038394231 8:27235213-27235235 GATGATGATGATGATGATGATGG - Intergenic
1038395506 8:27242948-27242970 CAGAGGGATGGTGGTGAGGACGG - Intronic
1038416704 8:27401881-27401903 GATGGTGATGGTGATGATGATGG + Intronic
1038579118 8:28731883-28731905 AATGATGATGATGATGATGATGG + Intronic
1038666804 8:29544475-29544497 CAGGGAGAAGAAGATAAGGATGG - Intergenic
1038973490 8:32664636-32664658 GATGATGATGATGATGAAGATGG + Intronic
1039317260 8:36387400-36387422 CAGGAGGGTGATGATAAGGATGG + Intergenic
1039623684 8:39025400-39025422 CAGGGTGAACATGAGGAGTAAGG - Intronic
1039628970 8:39088075-39088097 CAGGAAGATGATGAGGATGAAGG - Intronic
1039922104 8:41900546-41900568 GATGGTGATGATGATGATGATGG - Intergenic
1039922109 8:41900594-41900616 GATGGTGATGATGGTGATGATGG - Intergenic
1040318776 8:46278742-46278764 CACACTGATGATGAAGAGGAAGG + Intergenic
1040381471 8:46877241-46877263 CACACTGATGATGAGGAGGAAGG + Intergenic
1040418997 8:47221744-47221766 GATGGTGATGATGCTGTGGATGG - Intergenic
1040419003 8:47221789-47221811 GATGGTGATGATGCTGAGGATGG - Intergenic
1040419016 8:47221886-47221908 GATGGTGATGATGCTGGGGATGG - Intergenic
1040419031 8:47221958-47221980 GATGGTGATGATGCTGAAGATGG - Intergenic
1040419039 8:47222048-47222070 GATGGTGATGATGCTGATGATGG - Intergenic
1040419059 8:47222197-47222219 GATGGTGATGATGCTGGGGATGG - Intergenic
1040419063 8:47222215-47222237 GATGGTGATGATGCTGGGGATGG - Intergenic
1040419091 8:47222383-47222405 AATGGTGATGATGCTGGGGATGG - Intergenic
1040419110 8:47222491-47222513 GATGGTGATGATGATGGAGATGG - Intergenic
1040419115 8:47222533-47222555 GATGGTGATGATGCTGGGGATGG - Intergenic
1040419119 8:47222551-47222573 GATGGTGATGATGCTGAGGATGG - Intergenic
1040419121 8:47222569-47222591 GATGGTGATGAGGCTGAGGATGG - Intergenic
1040419127 8:47222611-47222633 GATGGTGATGATGCTGGGGATGG - Intergenic
1040419131 8:47222629-47222651 GATGGTGATGATGCTGAGGATGG - Intergenic
1040419133 8:47222647-47222669 GATGGTGATGAGGCTGAGGATGG - Intergenic
1040528943 8:48249787-48249809 CACACTGATGATGAGGAGGAAGG - Intergenic
1040684434 8:49855110-49855132 GATGATGATGATGATGATGATGG - Intergenic
1041018838 8:53617775-53617797 CACACTGATGATGAGGAGGAAGG + Intergenic
1041101107 8:54397185-54397207 CAGGGTGTTGACGATGGGGAAGG - Intergenic
1041969027 8:63715534-63715556 CAGCCTGTTGATGATTAGGAGGG - Intergenic
1041975494 8:63794621-63794643 CAGGGTGATGATGCTAAGGAAGG - Intergenic
1042120457 8:65481779-65481801 CACGATGATGATGATGATAATGG - Intergenic
1042446319 8:68889350-68889372 CACACTGATGATGAGGAGGAAGG + Intergenic
1043090711 8:75899416-75899438 GATGATGATGATGATGATGATGG + Intergenic
1043323808 8:79025017-79025039 CAGGGTGATGCTGATGCTGCTGG - Intergenic
1043765948 8:84132532-84132554 CAGGGGGATCATGATCTGGAAGG - Intergenic
1043923976 8:86016044-86016066 CATGATGATGATGATGGCGATGG - Intronic
1043998713 8:86851659-86851681 GATGATGATGATGATGATGATGG - Intergenic
1044111025 8:88273972-88273994 GATGATGATGATGATGATGATGG - Intronic
1044476635 8:92633935-92633957 GATGATGATGATGATGATGATGG - Intergenic
1044581248 8:93828318-93828340 GGGGGTGATGATGATGATGGTGG - Intergenic
1044826017 8:96197852-96197874 TAGTGTTTTGATGATGAGGAAGG + Intergenic
1045271616 8:100667148-100667170 CAAGGTGATGCTCATTAGGAGGG - Intergenic
1045356202 8:101391287-101391309 GATGATGATGATGATGATGATGG + Intergenic
1045767322 8:105689675-105689697 AGTGGTGATGATGATGATGATGG + Intronic
1046030438 8:108776746-108776768 GATGATGATGATGATGATGAAGG + Intronic
1046727245 8:117689340-117689362 GATGATGATGATGATGACGATGG - Intergenic
1047510870 8:125514288-125514310 GATGATGATGATGATGATGATGG - Intergenic
1047633038 8:126728965-126728987 AAGTGTGATAATGATGATGATGG - Intergenic
1047801094 8:128311039-128311061 AATAGTGATGATGATGATGATGG - Intergenic
1047914441 8:129566484-129566506 CAGGGTGATGAGGGTGAGCCAGG + Intergenic
1048007130 8:130428481-130428503 GATGGTGATGGTGATGAAGATGG - Intronic
1048094586 8:131277687-131277709 GATGATGATGATGATGATGATGG + Intergenic
1048116272 8:131526859-131526881 CAGGGTGTTGGTGATGAGGGTGG + Intergenic
1048136798 8:131753902-131753924 GATGATGATGATGATGATGATGG - Intergenic
1048185556 8:132237242-132237264 AAGAGTAATGATGATGATGATGG + Intronic
1048193828 8:132315336-132315358 CAGTGTGATAGTGAAGAGGAGGG + Intronic
1048197679 8:132345925-132345947 GATGATGATGATGATGATGATGG + Intronic
1048197693 8:132346081-132346103 CAAGATGACGATGATGATGATGG + Intronic
1048293363 8:133197072-133197094 AATGATGATGATGATGATGATGG + Intronic
1048308731 8:133301794-133301816 GATGATGATGATGATGATGATGG - Intronic
1048484816 8:134837235-134837257 CAACATGAAGATGATGAGGATGG + Intergenic
1048556772 8:135485711-135485733 AAGGGTGATGACGGTGATGATGG + Intronic
1048574543 8:135680398-135680420 CAGGGAGATGATGAAGACGCCGG - Intergenic
1048615805 8:136074447-136074469 GATGATGATGATGATGATGATGG + Intergenic
1048898770 8:139018250-139018272 GACGGTGATGATGATGATGTTGG + Intergenic
1048931595 8:139319653-139319675 AATGATGATGATGATGATGATGG + Intergenic
1049264201 8:141658392-141658414 GATGGTGATGATGATGATGGTGG - Intergenic
1049274676 8:141714023-141714045 GATGGTGATGGTGATGATGATGG + Intergenic
1049274677 8:141714029-141714051 GATGGTGATGATGATGGTGATGG + Intergenic
1049274680 8:141714059-141714081 GATGGTGATGGTGATGATGATGG + Intergenic
1049274681 8:141714065-141714087 GATGGTGATGATGATGGTGATGG + Intergenic
1049282288 8:141756070-141756092 GATGGTGGTGATGATGATGATGG + Intergenic
1049324132 8:142013119-142013141 GATGGTGATGGTGATGATGAAGG - Intergenic
1049351696 8:142168025-142168047 GGCGGTGCTGATGATGAGGATGG - Intergenic
1049428408 8:142548047-142548069 GATGGTGATGATGGTGATGATGG + Intergenic
1049445625 8:142629623-142629645 GATGGTGATGATGATGGTGATGG - Intergenic
1049445626 8:142629629-142629651 GATGGTGATGGTGATGATGATGG - Intergenic
1049474395 8:142790060-142790082 CAGGGGTGTGATGATGTGGAGGG + Intergenic
1049857461 8:144871753-144871775 CACACTGATGATGAGGAGGAAGG + Intergenic
1049946889 9:605709-605731 CAGGCTGGGGATGTTGAGGAGGG + Intronic
1050199249 9:3125767-3125789 GATGATGATGATGATGATGATGG + Intergenic
1050632316 9:7573133-7573155 CTGGGCCATGATGATGAGGCAGG + Intergenic
1051229658 9:14942619-14942641 GAGGATGATGATGATAATGATGG - Intergenic
1051426351 9:16935283-16935305 CTGGGTCATGATGCTAAGGAAGG + Intergenic
1051656538 9:19387271-19387293 CATAATGACGATGATGAGGATGG - Intergenic
1051714852 9:19971765-19971787 GATGATGATGATGATGACGATGG + Intergenic
1051922672 9:22286376-22286398 CATGGTGATTATGAAGGGGAAGG + Intergenic
1051992824 9:23173986-23174008 GATGGTGGTGATGATGATGATGG + Intergenic
1052514034 9:29456859-29456881 GATGATGATGATGATGATGATGG - Intergenic
1052689074 9:31792129-31792151 GATGGTGATGATAATGATGATGG - Intergenic
1052755661 9:32538161-32538183 CAGGATCATGATCATGAGTAAGG + Intergenic
1053126197 9:35582666-35582688 CACACTGATGATGAGGAGGAAGG + Intergenic
1054728363 9:68675435-68675457 CAGGGAGCTGGAGATGAGGATGG + Intergenic
1054947364 9:70810192-70810214 CAGGGTGATGGAGAGGAGGGTGG - Intronic
1054947398 9:70810326-70810348 CAGGGTGATGGAGAGGAGGGTGG - Intronic
1055070270 9:72158872-72158894 GATGATGATGATGATGATGATGG - Intronic
1055074414 9:72198704-72198726 CAGGCTGATGATGGTGATGATGG + Intronic
1055184947 9:73440001-73440023 GATGATGATGATGATGATGATGG + Intergenic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055989128 9:82086411-82086433 TGGAGTGATGATGATGATGATGG - Intergenic
1056238540 9:84620254-84620276 GTGGATGAAGATGATGAGGATGG + Intergenic
1056469404 9:86890750-86890772 AATGGTGATGGTGATGATGATGG + Intergenic
1056680337 9:88712015-88712037 GATGGTGGTGATGATGATGATGG + Intergenic
1056765444 9:89442090-89442112 CTGGGTGCTGATGATGGGGAGGG - Intronic
1056998033 9:91482443-91482465 GATGATGATGATGATGATGATGG + Intergenic
1057031297 9:91777410-91777432 GATGATGATGATGATGATGATGG - Intronic
1057265556 9:93615147-93615169 AATGGTGATGATGATGGTGATGG + Intronic
1057265561 9:93615189-93615211 GATGGTGATGATGATGGTGATGG + Intronic
1057267073 9:93624668-93624690 GATGGTGATGATGATGATGGTGG + Intronic
1057267089 9:93624804-93624826 GATGGTGATGGTGATGATGATGG + Intronic
1057267091 9:93624822-93624844 GATGGTGATGATGATGATGGTGG + Intronic
1057286027 9:93755084-93755106 CACACTGATGATGAGGAGGAAGG - Intergenic
1057514095 9:95706059-95706081 GACGGTGATGATGATGATAATGG - Intergenic
1057905816 9:98982615-98982637 GACGATGATGATGATGATGATGG + Intronic
1058935421 9:109765425-109765447 CATGATGATGGTGATGAAGACGG - Intronic
1059083039 9:111270247-111270269 GATGATGATGATGATGATGATGG + Intergenic
1059435261 9:114272070-114272092 CTGGGTGGTGATGCTGATGAAGG + Intronic
1059612187 9:115910527-115910549 CATGATGATGATGATGATGATGG - Intergenic
1059742023 9:117161166-117161188 CAGGATGATGATGATGGTGGTGG + Intronic
1059875392 9:118628911-118628933 GGTGGTGATGATGATGTGGAAGG + Intergenic
1060021636 9:120136338-120136360 AATGATGATGATGATGATGATGG - Intergenic
1060022200 9:120141343-120141365 GATGGTGATGATGATGATGATGG + Intergenic
1060246510 9:121950945-121950967 GATGTTGATGATGATGACGAGGG + Intronic
1060404139 9:123364777-123364799 CAGGGTGATGGTGAAGAGGAAGG - Intronic
1060660483 9:125402417-125402439 GAGGATGGCGATGATGAGGATGG + Intergenic
1060675547 9:125511164-125511186 GATGATGATGATGATGATGATGG - Intronic
1060742202 9:126106611-126106633 GATGGTGATGATGGTGATGATGG + Intergenic
1060868869 9:127023100-127023122 GATGATGATGATGATGATGATGG - Intronic
1060963107 9:127695073-127695095 GATGATGATGATGATGATGATGG + Intronic
1061247914 9:129410642-129410664 TAGGGTGATGATAATGATGGTGG - Intergenic
1061313312 9:129777991-129778013 CAAGGTGATGATTAGGAGAAAGG + Intergenic
1061492702 9:130955008-130955030 GGTGATGATGATGATGAGGATGG - Intergenic
1061492715 9:130955113-130955135 GATGGTGATGATGATGGTGATGG - Intergenic
1061492720 9:130955152-130955174 GATGGTGGTGATGATGATGATGG - Intergenic
1061492734 9:130955254-130955276 GATGGTGATGATGATGGTGATGG - Intergenic
1061492739 9:130955293-130955315 GATGGTGCTGATGATGATGATGG - Intergenic
1061511755 9:131065889-131065911 CAAGATGATGATGAAGATGATGG + Intronic
1061511858 9:131066585-131066607 AATGGTGACGATGATGATGAGGG + Intronic
1061845116 9:133383501-133383523 GATGGTGATGATGGTGATGATGG + Intronic
1061860807 9:133467935-133467957 CAGGGTCAGGCTGATGACGATGG - Exonic
1062068500 9:134541633-134541655 CTGTGTCATGAGGATGAGGAGGG + Intergenic
1062211424 9:135366312-135366334 CACTGTGAGGATGCTGAGGAGGG + Intergenic
1062326115 9:136013322-136013344 CAGGGTGAGGATGATGGGGAGGG + Intronic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1203687223 Un_GL000214v1:6515-6537 CACACTGATGATGAGGAGGAAGG + Intergenic
1203755410 Un_GL000218v1:121243-121265 CACACTGATGATGAGGAGGAAGG - Intergenic
1203714785 Un_KI270742v1:133783-133805 CACACTGATGATGAGGAGGAAGG - Intergenic
1203649052 Un_KI270751v1:97538-97560 CACACTGATGATGAGGAGGAAGG - Intergenic
1185688946 X:2137032-2137054 AATGGTGATGATGATGATGTTGG - Intergenic
1185688954 X:2137119-2137141 GATGGTGATGATGATGATGGAGG - Intergenic
1185688966 X:2137197-2137219 GAGGATGGTGATGATGATGATGG - Intergenic
1185688969 X:2137221-2137243 GATGGTGATGATGATGACGATGG - Intergenic
1185689003 X:2137608-2137630 GATGGTGATCATGATGATGATGG - Intergenic
1185689007 X:2137642-2137664 GATGGTGATGATGATGATGGGGG - Intergenic
1185689010 X:2137645-2137667 GAGGATGGTGATGATGATGATGG - Intergenic
1185689011 X:2137660-2137682 GATGATGATGATGGTGAGGATGG - Intergenic
1185689014 X:2137702-2137724 AATGATGATGATGGTGAGGATGG - Intergenic
1185689018 X:2137744-2137766 AATGATGATGATGGTGAGGATGG - Intergenic
1185689020 X:2137753-2137775 GATGGTGATAATGATGATGATGG - Intergenic
1185689037 X:2137932-2137954 GATGGTGATGATGATGATGGGGG - Intergenic
1185689040 X:2137935-2137957 GAGGATGGTGATGATGATGATGG - Intergenic
1185689041 X:2137950-2137972 GAAGATGATGATGGTGAGGATGG - Intergenic
1185689051 X:2138043-2138065 AATGATGATGATGGTGAGGATGG - Intergenic
1185689061 X:2138168-2138190 CATGATGATGGTGATGATGATGG - Intergenic
1185721158 X:2382576-2382598 GATGGTGATGATGATGGTGATGG - Intronic
1185721164 X:2382621-2382643 GATGGTGATGATGGTGATGATGG - Intronic
1185721170 X:2382666-2382688 GATGGTGATGGTGATGATGATGG - Intronic
1185721172 X:2382684-2382706 GATGGTGATGATGGTGATGATGG - Intronic
1185721182 X:2382789-2382811 GACGGTGATGGTGATGATGATGG - Intronic
1185721203 X:2383041-2383063 GATGGTGGTGATGATGATGATGG - Intronic
1185721218 X:2383200-2383222 AATGATGATGGTGATGAGGATGG - Intronic
1185721231 X:2383384-2383406 GATGGTGATGATCATGACGATGG - Intronic
1185721232 X:2383402-2383424 GATGGTGATGATGATGATGATGG - Intronic
1185739499 X:2519731-2519753 GATGGTGAGGATGATGATGATGG - Intergenic
1185739504 X:2519776-2519798 GATGGTGAGGATGATGACGATGG - Intergenic
1185739511 X:2519836-2519858 GATGATGATGATGGTGAGGATGG - Intergenic
1185739513 X:2519845-2519867 GATGGTGAGGATGATGATGATGG - Intergenic
1185739593 X:2520508-2520530 GAGGATGATGATGGTGAGGATGG - Intergenic
1185739618 X:2520733-2520755 GAGAGTGATGATGGTGAGGATGG - Intergenic
1185739625 X:2520802-2520824 GAGGATGATGATGGTGATGATGG - Intergenic
1185739631 X:2520847-2520869 GAGGATGATGGTGATGATGATGG - Intergenic
1185827838 X:3269817-3269839 AATGATGATGAAGATGAGGAAGG + Intergenic
1185844632 X:3426435-3426457 GATGGTGATGATGATGATGCTGG + Intergenic
1185844646 X:3426543-3426565 GATGGTGGTGATGATGATGATGG + Intergenic
1185844669 X:3426840-3426862 GATGGTGATGATGATGATGGTGG + Intergenic
1185844679 X:3426906-3426928 GATGGTGATGATGGTGATGATGG + Intergenic
1185854828 X:3524410-3524432 GATGGTGATGATGATGGTGAAGG - Intergenic
1185854829 X:3524416-3524438 GATGGTGATGGTGATGATGATGG - Intergenic
1185930133 X:4193540-4193562 GATGGTGATGATGATGGTGATGG + Intergenic
1185977288 X:4735631-4735653 GATGGTGATGATGATAACGATGG - Intergenic
1186002730 X:5031876-5031898 GACGGTGATGATGATGATGATGG - Intergenic
1186002741 X:5031995-5032017 GATGGTGATGATGGTGATGATGG - Intergenic
1186010178 X:5122264-5122286 GATGGTGATGATGATGTTGATGG + Intergenic
1186074952 X:5867891-5867913 GATAGTGATGATGATGATGATGG - Intronic
1186074961 X:5868062-5868084 AATGGTGATGATGATGGTGATGG - Intronic
1186098856 X:6133188-6133210 TATGATGGTGATGATGAGGATGG - Intronic
1186131627 X:6472860-6472882 AATGGTGATGATGATGATGATGG + Intergenic
1186214554 X:7284951-7284973 GATGGTGATGATGATGATGATGG + Intronic
1186358947 X:8818722-8818744 CTTGATGATGATGATGATGATGG - Intergenic
1186359119 X:8821077-8821099 GATGATGATGATGATGATGATGG - Intergenic
1186359126 X:8821148-8821170 GATGGTGATGATGATGATGATGG - Intergenic
1186659422 X:11653967-11653989 ATGGGTGAGGATGATGATGATGG - Intronic
1187000784 X:15175197-15175219 GATGATGATGATGATGATGATGG + Intergenic
1187375249 X:18746997-18747019 CATGGTGATAATGACAAGGATGG - Intronic
1188051131 X:25487960-25487982 CAAGATGATGATGATGATAACGG - Intergenic
1188111162 X:26197497-26197519 CAAGGTAAAGATGCTGAGGAAGG + Intergenic
1188111329 X:26198540-26198562 CAGGGCGAGGACCATGAGGAAGG + Intergenic
1188283555 X:28300587-28300609 GATGGTGATGGTGATGATGATGG - Intergenic
1188457792 X:30387141-30387163 CAGGGTAATGAAGGTGAGAATGG - Intergenic
1188856118 X:35198053-35198075 TATGGTGATGATGATGATGATGG - Intergenic
1188973766 X:36649056-36649078 CAGGCTGATGCTGAAGAAGAAGG + Intergenic
1189799955 X:44683046-44683068 CAAGGTGATGTTTATGGGGAAGG - Intergenic
1191085051 X:56557563-56557585 GATGATGATGATGATGATGATGG - Intergenic
1191662494 X:63665809-63665831 CCTGGGGATGATGAAGAGGAGGG + Intronic
1191899393 X:66025086-66025108 CAAGGAGATGATGAGGATGATGG + Exonic
1192624871 X:72715952-72715974 TTTGGTAATGATGATGAGGAAGG + Intergenic
1192671187 X:73143724-73143746 GACGGGGATGGTGATGAGGAAGG - Intergenic
1193248390 X:79258523-79258545 GATGGTGATGATGATGATGATGG + Intergenic
1193642794 X:84032687-84032709 TAGGGGGGTGATGGTGAGGATGG - Intergenic
1194041647 X:88948823-88948845 CATGATGATGATGAGGAGGATGG - Intergenic
1194065695 X:89259152-89259174 GAGAGAGATGATGATGGGGAAGG - Intergenic
1194528004 X:95004059-95004081 AATGGTGATGATGATGGTGATGG - Intergenic
1194536260 X:95108536-95108558 CACACTGATGATGAGGAGGAAGG - Intergenic
1194747311 X:97642193-97642215 TAGGGTGATGGTGATGAAGATGG - Intergenic
1195000809 X:100641634-100641656 CAGGGTGAAGATGCTGCGTAAGG - Intergenic
1195007520 X:100701023-100701045 CAGGGTGGTGGTTATGAGTAGGG + Intronic
1195152508 X:102086232-102086254 GATGGTGGTGATGATGATGATGG + Intergenic
1195159027 X:102153953-102153975 CATGATGATCATGGTGAGGAGGG + Exonic
1195228880 X:102826135-102826157 CTTGGTGATGATGATGATGGTGG - Intergenic
1195481203 X:105347556-105347578 GATGATGATGATGATGATGATGG - Intronic
1195605712 X:106803365-106803387 CAGGGTGCTGATGATCGGTATGG - Intronic
1196122854 X:112069057-112069079 GAGGATGATGAGGATGAGGATGG + Intronic
1196506558 X:116451247-116451269 AAGGGTGACAATGATGAGGGAGG + Intronic
1197659488 X:129154770-129154792 CAGGGTGAAAAAGATGAGCAGGG + Intergenic
1197951500 X:131902347-131902369 GAGGGTGGTGATGGTTAGGAGGG + Intergenic
1198144419 X:133840637-133840659 CATGGTGATGATGGTGATGATGG - Intronic
1198155140 X:133952399-133952421 TAGGAAGATGATGATGATGATGG - Intronic
1198241977 X:134796389-134796411 AAGGAGGATGATGATGAGGAAGG + Intronic
1198617758 X:138478181-138478203 CAAGGTGATGATACTGAGGAAGG + Intergenic
1198670917 X:139079989-139080011 GATGATGATGATGATGATGATGG - Intronic
1198774132 X:140161737-140161759 CATGATGATGATGATGGCGATGG - Intergenic
1199054975 X:143282852-143282874 CGGAGTAATGATGCTGAGGACGG + Intergenic
1200719863 Y:6593282-6593304 GAGAGAGATGATGATGGGGAAGG - Intergenic
1200754053 Y:6973239-6973261 ATGGGGGAAGATGATGAGGAGGG - Intronic
1200808680 Y:7459976-7459998 GATGGTGATGGTGATGATGATGG + Intergenic
1200808681 Y:7459982-7460004 GATGGTGATGATGATGGTGATGG + Intergenic
1201143520 Y:11048012-11048034 GATGGTGATGATGGTGATGATGG + Intergenic
1201143524 Y:11048062-11048084 GATGGTGATGATGATGATGATGG + Intergenic
1201143577 Y:11048526-11048548 GATGGTGATGATGATGGTGATGG + Intergenic
1201143578 Y:11048538-11048560 GATGGTGATGGTGATGATGATGG + Intergenic
1201250171 Y:12049526-12049548 CCAGGTGATGCTGATGAGGGTGG - Intergenic
1201258277 Y:12132113-12132135 CAATGTGAAGATGATGAGAATGG - Intergenic
1201494497 Y:14578237-14578259 GATGATGATGATGATGATGATGG - Intronic
1201501302 Y:14645807-14645829 TATGATGGTGATGATGAGGATGG + Intronic
1201501305 Y:14645822-14645844 GAGGATGGTGATGAGGAGGATGG + Intronic
1201518966 Y:14851285-14851307 GATGGTGATGATGATGATGGTGG + Intergenic
1201614111 Y:15876995-15877017 GATGGTGATGATGATGATGATGG + Intergenic
1201616257 Y:15902782-15902804 GATGGTGATGATGATGATGATGG - Intergenic
1201616278 Y:15903025-15903047 GATGGTGGTGATGATGATGATGG - Intergenic
1201699609 Y:16865957-16865979 GATGGTGATGATGATAATGATGG + Intergenic
1201699617 Y:16866084-16866106 GATGGTGATGATGATAATGATGG + Intergenic
1201768376 Y:17594242-17594264 GATGATGATGATGATGATGATGG - Intergenic
1201768380 Y:17594294-17594316 GATGGTGATGGTGATGATGATGG - Intergenic
1201787034 Y:17795920-17795942 CAGGCTAATGAAGATGAGGTAGG - Intergenic
1201814519 Y:18110068-18110090 CAGGCTAATGAAGATGAGGTAGG + Intergenic
1201833173 Y:18311691-18311713 GATGGTGATGGTGATGATGATGG + Intergenic
1201833177 Y:18311743-18311765 GATGATGATGATGATGATGATGG + Intergenic
1201947199 Y:19524010-19524032 CAGTGTAATAATGATGTGGAAGG + Intergenic