ID: 900650747

View in Genome Browser
Species Human (GRCh38)
Location 1:3729053-3729075
Sequence CTGTTGGTAGGGGAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 507}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900650747 Original CRISPR CTGTTGGTAGGGGAGGAAGA GGG Intronic
900621742 1:3590719-3590741 CTGCTGGCAGGGGAGGGACAGGG - Intronic
900650747 1:3729053-3729075 CTGTTGGTAGGGGAGGAAGAGGG + Intronic
900768417 1:4520813-4520835 CTGTTTGTAATGGAGGTAGAGGG - Intergenic
900768448 1:4520957-4520979 CTGTTTGTAATGGAGGTAGAGGG - Intergenic
902693784 1:18126839-18126861 CTGGTGGTAGGGGTGGAGGATGG - Intronic
902919448 1:19657412-19657434 CTGTGGGAGGGGGAGGAAGTTGG + Exonic
903230918 1:21921897-21921919 ATGTTGGGAGGGGAGCAAGGTGG - Intronic
905796714 1:40820003-40820025 CAGTTGGTGGGGGAGGCTGAGGG + Intronic
906030745 1:42718195-42718217 CAGGTGTTAGGGTAGGAAGATGG - Intergenic
906901232 1:49838349-49838371 GTGTCTGTAGGGCAGGAAGAAGG - Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
907392777 1:54169096-54169118 CTGTTGGGGAGGGAGAAAGAAGG + Intronic
907608194 1:55840598-55840620 CTGTTGGTGGGGGAGTAAGTCGG + Intergenic
907881302 1:58551357-58551379 CTGTTCGTACACGAGGAAGAGGG + Intergenic
909388320 1:75086633-75086655 TTGTGGGAAGTGGAGGAAGAGGG + Intergenic
909503270 1:76359050-76359072 CTGAGAGTAGGGTAGGAAGAAGG + Intronic
910442583 1:87267753-87267775 CTCTTGATATGGGAGGAACAGGG - Intergenic
910738056 1:90484011-90484033 CTGTTGGTAGGGATGTAAAATGG + Intergenic
910764304 1:90765572-90765594 CTGTTGGAAGGGCAGGGTGAGGG - Intergenic
911340866 1:96634675-96634697 CAGTTGGCAGGGGAGGAGGGAGG - Intergenic
912021810 1:105115296-105115318 CTGCTGGATGGGGATGAAGAAGG - Intergenic
912954609 1:114145984-114146006 CTGTGATTAGGGGAGGCAGAGGG + Intronic
913108862 1:115640618-115640640 CTGGGGGTGGGGGAGGAAGATGG + Intergenic
914277479 1:146138246-146138268 CTGTTGGTTGGCCAGGAAGCCGG + Exonic
914538526 1:148589194-148589216 CTGTTGGTTGGCCAGGAAGCCGG + Exonic
914539288 1:148595553-148595575 CTGTTGGTTGGCCAGGAAGCCGG + Exonic
915121390 1:153631673-153631695 GTGGTGGGAGGAGAGGAAGAGGG - Intronic
915184233 1:154090884-154090906 CTGTTGGTAGGAAAGTAAAATGG + Intronic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
915755488 1:158255613-158255635 CTGGTTGTAGGGCAGGCAGAAGG - Intronic
916035558 1:160919364-160919386 CTGTTGGTGGGTGGGGAAAAAGG - Intergenic
917135251 1:171782884-171782906 CTGGAGGTAGGGAAGGAGGAAGG + Intronic
917428596 1:174941663-174941685 GTTTTGGTGGGGGAGGAGGAGGG - Intronic
917678374 1:177341252-177341274 CGTTGGGAAGGGGAGGAAGAAGG - Intergenic
918123019 1:181556484-181556506 CTGTGGGAGGGGGAGGCAGAGGG + Intronic
918652915 1:186987940-186987962 CTTTTCCTAGTGGAGGAAGAAGG - Intronic
919862540 1:201750377-201750399 GGGTGGGGAGGGGAGGAAGAGGG + Intronic
920264963 1:204714985-204715007 CTGTTGGGAGGTGGGAAAGAGGG - Intergenic
921016935 1:211200626-211200648 CTGTTGGTATGGGAGAGTGAAGG + Intergenic
921691677 1:218158094-218158116 CTGTAGGTAAGGTAGAAAGAAGG + Intergenic
921707862 1:218345158-218345180 CTGTGGGTAAGGGAGGAAGGAGG - Intergenic
921980759 1:221256136-221256158 CTGTTGGTAGGAGTGTAAAATGG + Intergenic
922976615 1:229789845-229789867 CTGTTTGCAGGGCAGGAGGAGGG + Intergenic
923259876 1:232258359-232258381 CTGTGGTGAGGGGAGGGAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923461843 1:234215017-234215039 CAGTTGGTAGAGGCGGGAGAGGG + Intronic
923466641 1:234253550-234253572 CTGTTAGTAGGATGGGAAGAGGG + Intronic
923642249 1:235775888-235775910 ATTTTTGTAGGGGAGGAGGAAGG + Intronic
1063377189 10:5561410-5561432 CTGCAGAGAGGGGAGGAAGAGGG + Intergenic
1063584702 10:7341459-7341481 CTTTTGTTTGGAGAGGAAGAGGG + Intronic
1064111974 10:12547307-12547329 CTAGTGGTGGTGGAGGAAGAAGG + Intronic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064225814 10:13483821-13483843 CTGGGGGTACGGGAGGAAGGGGG + Intronic
1064599062 10:16974776-16974798 GAGTGGGTTGGGGAGGAAGAGGG - Intronic
1065145222 10:22761897-22761919 CTGGAGTTAGGGGATGAAGAGGG + Intergenic
1065162123 10:22933517-22933539 CTGTTGGGAGCTGAGGAAGCAGG - Intronic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1065968357 10:30786363-30786385 CTGTGGGTAGGGGATGAATCAGG + Intergenic
1066271383 10:33827540-33827562 CTGTTGGTGGGGCAGGGGGATGG + Intergenic
1067254228 10:44619515-44619537 CACTTGGTAGGTGAGCAAGAAGG - Intergenic
1068913359 10:62402704-62402726 CTCATGGTTGTGGAGGAAGATGG - Intronic
1068947900 10:62747681-62747703 CTGTTTGTATGGGAGCAATATGG - Intergenic
1069583090 10:69578340-69578362 CGGTAGGTGGGGGTGGAAGACGG - Intergenic
1070296253 10:75163829-75163851 CTGTTTGGTGGGGAGGAAAAAGG + Intronic
1071525008 10:86353526-86353548 CTGCTGGAACGGGAGGAACATGG - Intronic
1072105216 10:92267112-92267134 CTGGTGGTAGAGGATGCAGAGGG + Intronic
1072620860 10:97078357-97078379 CTGGTGGTGGTGGAGGGAGAAGG - Intronic
1072961937 10:99937260-99937282 CTGTTGGTTGAGGAGGTACAAGG - Intronic
1073500590 10:103933320-103933342 TGGTTGGGAGGGGAGGGAGACGG + Intergenic
1074735641 10:116429803-116429825 CTGCAGGTAGAGAAGGAAGATGG + Intronic
1076185959 10:128448963-128448985 CATTTGGTGGGGGAGGAAGTGGG + Intergenic
1076936048 10:133567999-133568021 CTGTGGGCAAGGGAGGAAGGGGG + Intronic
1077238438 11:1496837-1496859 CTGTTGGGAGGGGAGGTGGCAGG + Intronic
1077284808 11:1760914-1760936 CTGTTGCGAGAGGAAGAAGATGG + Intronic
1077533390 11:3107704-3107726 CTCCTTGTAGGCGAGGAAGAGGG - Intronic
1077994830 11:7444179-7444201 ATCTTCCTAGGGGAGGAAGAAGG + Intronic
1078158291 11:8817504-8817526 CTGGTGGTAGGAGAGGCAGGGGG - Intronic
1078922959 11:15847661-15847683 CTGTTGTTAAGTGAGAAAGAAGG - Intergenic
1079383621 11:19959861-19959883 CAGATGGTGGGGGGGGAAGAAGG - Intronic
1079396604 11:20069064-20069086 CTCTTGGTGGGGGATGAAAAAGG + Intronic
1079488812 11:20964643-20964665 GTGTGGGTAGTGGAAGAAGAGGG - Intronic
1080118589 11:28648230-28648252 CTGTTTGTAGGAGATGAAGCTGG + Intergenic
1080748045 11:35126716-35126738 CTGTGGGTGGGGGAAGAAAAAGG + Intergenic
1081914623 11:46723031-46723053 CTGCTGGTTGCAGAGGAAGAGGG + Intronic
1082770721 11:57205615-57205637 CTGGTGATAGGAGATGAAGAAGG - Intergenic
1082799741 11:57405880-57405902 CTGTTGGTAGGAGGTAAAGAGGG + Intronic
1082812595 11:57487464-57487486 CTGTTATTAGTGGAGGAAGTGGG - Intronic
1083746789 11:64741492-64741514 TTGTTGGTAGGTGAAGGAGAGGG + Exonic
1083756877 11:64796683-64796705 CTGGTGGTAGGGGCCGAGGAAGG - Exonic
1084699804 11:70779041-70779063 CTGCTGGGAGGGGACGAGGAAGG + Intronic
1085645450 11:78219458-78219480 CAGTTAGGTGGGGAGGAAGAAGG + Intronic
1086443423 11:86850329-86850351 CTGCTGGTTAGGGATGAAGAAGG - Intronic
1088577758 11:111288011-111288033 CTGGTGGAGGGGGAGGAAGTGGG - Intergenic
1088714684 11:112538564-112538586 ATGTTGGTAGGGGAGAAAGTGGG + Intergenic
1088923432 11:114278578-114278600 CTGTTGGTAGGGGTGGGAGGTGG + Intronic
1089665753 11:120017600-120017622 TTGTTGGAAGAGGAGGAATAAGG - Intergenic
1089695912 11:120216190-120216212 CTGTGGGTGGGGGAGCAACATGG + Intronic
1090028500 11:123187477-123187499 TTCTTGGTAGGGGAGGAAAGAGG - Intronic
1090299481 11:125623124-125623146 CTGTTTGTAGGGGGTGTAGATGG + Intronic
1090593229 11:128293954-128293976 CTGTTGGGAGGTGAGCAGGAGGG + Intergenic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1090834168 11:130441814-130441836 GTATGTGTAGGGGAGGAAGACGG + Intergenic
1090931370 11:131300684-131300706 ATGTTGGAAGGGGAGGAGGAGGG - Intergenic
1091354078 11:134922256-134922278 CAGGTGCTGGGGGAGGAAGAAGG + Intergenic
1091692366 12:2605811-2605833 CTGATGGGAGGGGAGGTAGGAGG - Intronic
1092174199 12:6391495-6391517 GTTTTGGAAGGGGAGGAAAATGG + Exonic
1092522941 12:9292259-9292281 CTGCAGGTAGGGGAGGCAGCTGG + Intergenic
1092544350 12:9439638-9439660 CTGCAGGTAGGGGAGGCAGCTGG - Intergenic
1092947882 12:13473707-13473729 CTCTGGGGAGAGGAGGAAGATGG + Intergenic
1094191822 12:27705887-27705909 CAGTTGGTAGAGGTGGGAGATGG - Intergenic
1094381092 12:29843715-29843737 CAGCTGGTAGGGGAGGAAATCGG + Intergenic
1095396451 12:41767658-41767680 CAGTTGTTGGGGGAGGAACATGG + Intergenic
1095837747 12:46656560-46656582 CTGAAGGTAGGGGTGGGAGAGGG + Intergenic
1096839532 12:54371716-54371738 CTGTTGTTGGGGGAGAAACATGG + Intronic
1096929358 12:55188553-55188575 CTGTTGGGAGGGCATGAGGAGGG + Intergenic
1097022310 12:56029012-56029034 CTGGTGGTGTGGGAGGAAGGAGG - Intronic
1097170491 12:57110219-57110241 CTGATGGCTGGGGAAGAAGAGGG - Intronic
1097270095 12:57768798-57768820 CTGTTGGCAGTGGAGGGACAAGG + Exonic
1097376156 12:58845431-58845453 CTGTTGGTAGGTCAAGTAGAGGG + Intergenic
1097537802 12:60895730-60895752 CTGTTGGTAGGAATGGAAAAAGG + Intergenic
1097620108 12:61929002-61929024 CTGTTGGGGGGTGAGGAACAAGG + Intronic
1098289187 12:68940204-68940226 ATGTGGGTAGGGCAGGAAAAGGG - Intronic
1100143223 12:91644239-91644261 ATGTTGGTAGTGGAGGAGGTTGG - Intergenic
1101036320 12:100710678-100710700 CTGTTGGTGGGGGAGGGGGAGGG + Intergenic
1101651878 12:106684675-106684697 CTGTGGGTGGGGGAGGAGCATGG - Intronic
1103957207 12:124583865-124583887 CTGTAGGCCGGGGAGCAAGAGGG + Intergenic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1104711478 12:130989875-130989897 CTTTCTGTAGAGGAGGAAGAAGG + Intronic
1104897192 12:132170152-132170174 CTTTTGCTAGTGCAGGAAGAGGG - Intergenic
1105831652 13:24167499-24167521 CTGTTGAGAGGTGAGGAAAATGG - Intronic
1106194594 13:27482385-27482407 CTGTTGGCTGGGGAAGAAGTGGG - Intergenic
1108131943 13:47310831-47310853 CTGGTGGCAGGGGAGTAAAATGG - Intergenic
1108290154 13:48951395-48951417 CTGATGTTTGGGGATGAAGAGGG - Intergenic
1110290370 13:73798804-73798826 CTGTTGGTAGGAGTGTAAAATGG + Intronic
1111809826 13:93085983-93086005 TTGTTGGTAGGGATGTAAGATGG + Intergenic
1112205021 13:97316253-97316275 CTGCTGGCAGTGGAGGAAGGTGG - Intronic
1113572045 13:111365188-111365210 CTCTTGCTAGGGGAGTGAGAAGG - Intergenic
1114154378 14:20084265-20084287 CTGTTGGTAGGGATGTAAGTTGG + Intergenic
1114345747 14:21792808-21792830 ATGTGGGTAGGGGAAGAAAATGG + Intergenic
1115460838 14:33658789-33658811 CTATTAGTGGGGGATGAAGATGG - Intronic
1115673618 14:35644762-35644784 CTGTTGGTGGGGGAAGGTGAGGG + Intronic
1115872093 14:37816272-37816294 CTGTTATTGGGGGTGGAAGAGGG - Intronic
1116616509 14:47147502-47147524 CTGTTGATAGGGGAGGTGGTCGG - Intronic
1118472824 14:66090875-66090897 CTTCTGGGAGGGGATGAAGAAGG - Intergenic
1118474952 14:66108140-66108162 CTTCTGGAAGGGGTGGAAGAAGG - Intergenic
1118820062 14:69339213-69339235 AGGTTGGCAGGGGAGGATGAGGG + Intronic
1120025866 14:79583530-79583552 CTTTTGTTGGTGGAGGAAGAAGG + Intronic
1120077319 14:80173296-80173318 CTCTTGGCAGGGAAGGAAGCAGG + Intergenic
1120434420 14:84462856-84462878 ATGCTTGTAAGGGAGGAAGATGG - Intergenic
1121101920 14:91255128-91255150 CTGCAGGCAGGGGAGGTAGAAGG + Intergenic
1121556157 14:94839364-94839386 CTGATGGGAGGGAAGGAGGAAGG - Intergenic
1122178241 14:99936765-99936787 AGGTTGGGAGGGGAGGAGGAGGG - Intronic
1122781929 14:104147402-104147424 CTGCTGGGAGGGGAGGGAGCGGG - Intronic
1123499752 15:20868921-20868943 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123593225 15:21879884-21879906 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1124136740 15:27042167-27042189 CTGCTGAGAGGGGAGGCAGATGG - Intronic
1125411614 15:39411925-39411947 CTGATGGTAAGGTAGGAGGAAGG + Intergenic
1126172704 15:45707564-45707586 CTGCTGGTAGGAGTGGAAAATGG + Intergenic
1126463991 15:48943957-48943979 CTGTTAGTAAGGTAGAAAGAGGG + Intronic
1126842773 15:52733543-52733565 CTGTTGGGTGGGAAGGCAGAGGG + Intergenic
1126980559 15:54238021-54238043 CAGCTGGAAGGGGAGGAAGATGG - Intronic
1127162657 15:56205983-56206005 CTGCTGGTAGGGATGGAAAATGG + Intronic
1127232693 15:57014352-57014374 CTGATGGTAGGGAATGAGGAAGG - Intronic
1128368396 15:67021349-67021371 GAGTTGGGAGGGGAGGCAGAGGG + Intergenic
1128506452 15:68276493-68276515 CTTTGGGGAAGGGAGGAAGAGGG + Intergenic
1128514116 15:68331611-68331633 TTGTTGTTGGGGGAGGATGAGGG + Intronic
1128530860 15:68446603-68446625 CTGTTGGGAAGGAAGAAAGAAGG + Intergenic
1128548299 15:68581783-68581805 CGGTAGGTAGGGGAGGAAATGGG + Intronic
1128667453 15:69548835-69548857 CTTTTGGGAGGGGAGGCAGAGGG - Intergenic
1129119035 15:73383888-73383910 CTTGTGGCAGAGGAGGAAGAGGG + Intergenic
1129191280 15:73939127-73939149 ATGTTGGAAGGGGATAAAGAAGG - Intronic
1130391256 15:83457379-83457401 CTGCTTGTAGGGCAGAAAGAAGG + Intronic
1130577287 15:85103947-85103969 CTCTCAGTAGGGGAGGGAGAAGG - Intronic
1130940095 15:88500625-88500647 CTGTTGGTGGGAGAGTAAGTTGG - Intergenic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1131249029 15:90818970-90818992 CTGTTGGCAGGAGACGAAGGAGG + Intergenic
1131333413 15:91523740-91523762 CTGTTGGTCTGGGAAGCAGATGG + Intergenic
1131465855 15:92654630-92654652 CTGTTGGTGGGGGACACAGACGG - Intronic
1131819180 15:96254753-96254775 CTGTTGCTACTGGTGGAAGAGGG + Intergenic
1132367899 15:101270894-101270916 CTTTTGGTAGGGGTGGAAGGAGG - Exonic
1202965344 15_KI270727v1_random:169808-169830 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1133208777 16:4250743-4250765 CTGTTGGTAGGAGAGAAAATTGG + Intergenic
1133255813 16:4514897-4514919 CTGGTGGGAGGGGAGGCAGAGGG - Exonic
1133484326 16:6204167-6204189 GTGAGGGTAGGGGAGGAAAAGGG - Intronic
1133758520 16:8780187-8780209 CGGTTGGGAGGGGATGAAGCTGG + Intronic
1133812787 16:9174113-9174135 CTGTTGGGAAGGGAGGCAGCTGG - Intergenic
1133985367 16:10664264-10664286 CTGCAGGGAGGGAAGGAAGAGGG + Intronic
1134024630 16:10944573-10944595 CTGTGGGCCGGGGAGGAAGGCGG + Exonic
1134185198 16:12079532-12079554 TTGTTGCTAAGGAAGGAAGAAGG + Intronic
1136575388 16:31120942-31120964 TTTTTGGTAGGTGAGGAAGCAGG + Intronic
1138696909 16:58822685-58822707 CTTTTGGCAGGGTAGGAGGAGGG - Intergenic
1139029828 16:62866522-62866544 CTGTTAATAGGGAAGAAAGAAGG + Intergenic
1139579195 16:67862132-67862154 GTGTTTGTAGGGGAGGAGCATGG + Intronic
1140512360 16:75517344-75517366 CCGTTGGGATTGGAGGAAGAGGG - Intergenic
1141484375 16:84329079-84329101 CTGATGGTAGGGGAGGAGTTAGG + Intronic
1141749709 16:85950138-85950160 CTGTGGGTGAGGGAGGAAGTAGG + Intergenic
1142880423 17:2879060-2879082 CAGTGGGTAGGGCAGGAAGGAGG - Intronic
1143389634 17:6552634-6552656 CTATGGGTAGGGGTGGAAGGTGG - Intronic
1144125050 17:12195711-12195733 CTGGTGGCAGGGCAGGAGGAAGG - Intergenic
1144728305 17:17512655-17512677 CTGTGGGCAGGGGATGGAGAGGG + Intronic
1145043614 17:19595209-19595231 ATGGTGGGAGGGGAGGCAGAAGG - Intergenic
1146646156 17:34578901-34578923 CTGTTGCTGGGGAAGGAAGACGG - Exonic
1146916759 17:36682905-36682927 CAGTTGGGAGGGAAGGAGGAAGG - Intergenic
1146919704 17:36702533-36702555 CTGTGGGAAGGGGATGATGAGGG - Intergenic
1147133655 17:38423016-38423038 CAGTGACTAGGGGAGGAAGAAGG - Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147444469 17:40466522-40466544 CTTTTGGGAGGGGAGGTGGATGG + Intergenic
1147636614 17:41967894-41967916 CTGGTCGTGGAGGAGGAAGAGGG - Intronic
1147675183 17:42200371-42200393 CAGCAGGTAGTGGAGGAAGAGGG - Exonic
1148123647 17:45226047-45226069 CTCTTGGTAGTGGAGGTGGAGGG - Intronic
1148393673 17:47291554-47291576 TTGGTGGGAGGGGAGGAAGGAGG + Intronic
1148837868 17:50475881-50475903 AGGTTGGTTGGGGAGGAAGGGGG - Intergenic
1150602016 17:66659367-66659389 CTGGTGGAGGAGGAGGAAGAAGG - Intronic
1150631489 17:66883642-66883664 CTTTAGGTAGGGGAGGTAAAGGG - Intronic
1151118552 17:71766612-71766634 CTGCTGGCAGTGGAGCAAGAAGG + Intergenic
1152010126 17:77707777-77707799 CTGATGGGAGGGGAGGAAGAGGG + Intergenic
1152337593 17:79707237-79707259 ACGTGGGCAGGGGAGGAAGAAGG - Intergenic
1152982452 18:291237-291259 CTGGTGGTAAGTGAGGAAGCTGG + Intergenic
1153590886 18:6673271-6673293 CTGGTGGCCAGGGAGGAAGATGG + Intergenic
1153596258 18:6728711-6728733 CTGTTGGTGGGGGACGATGTAGG - Intergenic
1153683315 18:7521745-7521767 CTGGGGGTAGGGGAGGAACCGGG - Intergenic
1153778679 18:8475949-8475971 CTGTTGGTTGGGGAGCAGGTGGG + Intergenic
1153951807 18:10064148-10064170 CAGTGGGTAGGTGAGGAGGAAGG - Intergenic
1154305977 18:13231197-13231219 CAGGTGGTATGGGAGGAAGCGGG + Intronic
1155208392 18:23580286-23580308 CTGGGGGTAGGGGAGGCAGGAGG - Intronic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157302019 18:46485969-46485991 CTATGGGTGGGGGAGGGAGAGGG - Intronic
1157452318 18:47798261-47798283 CTGTGGGGAGGAGAGAAAGAAGG - Intergenic
1157618732 18:49003220-49003242 CAGGTAGAAGGGGAGGAAGAGGG - Intergenic
1158522610 18:58184179-58184201 CTGTTGGTAGGAGGGAATGAGGG + Intronic
1158876995 18:61743290-61743312 CTGTCTGTAAGGGAGGAAGGAGG - Intergenic
1159134138 18:64317194-64317216 CTGTTGTCAGGGGAGGGGGAGGG - Intergenic
1159953037 18:74498825-74498847 GTGTTTGAAGAGGAGGAAGAGGG + Intronic
1160344643 18:78123325-78123347 CTGTTGTAAGGGGAGGGAGGCGG - Intergenic
1161303744 19:3555978-3556000 CTGTTGGGAGGGCAGGAGGCTGG - Intronic
1161366256 19:3881428-3881450 CTGTGGGGTGGGGAGGAAGGGGG + Intronic
1161392717 19:4029473-4029495 CAGTTGCTGTGGGAGGAAGACGG + Intronic
1161422640 19:4184302-4184324 CAGGAGGTAGGGGAGGAAGGAGG + Intronic
1162666907 19:12221007-12221029 CTGTTGCTGGGGGTGGGAGAGGG + Intergenic
1162782439 19:13013275-13013297 CTGTTGGTGGAGGAGGAAGCTGG + Intronic
1163369867 19:16896103-16896125 AGGTTGGTAGGGGAGGGAGGTGG + Intronic
1165854621 19:38871871-38871893 CTGTGGTGGGGGGAGGAAGAAGG + Intronic
1166330828 19:42077050-42077072 TTATTGGAAGGGGAGGAAGTAGG + Intronic
1166694514 19:44844979-44845001 GTGTTGGGAGGGGAGGACCAGGG + Intergenic
1167163316 19:47781269-47781291 TTCTAGGGAGGGGAGGAAGAGGG - Exonic
1167415084 19:49365724-49365746 CTGTTGGGAGGGAAGGAGGGCGG + Intronic
1167597005 19:50433042-50433064 CTGTTTGTAGGGTTGGGAGAAGG + Intronic
1168148083 19:54430583-54430605 CTGTTGGAAGGGGTTGGAGACGG - Exonic
1168243455 19:55098549-55098571 CTGGTGGTGGGGGCGGCAGAAGG - Intronic
924994349 2:343216-343238 GTGTTGGTAAAGGAGGAAGAAGG + Intergenic
925658883 2:6181467-6181489 CTCTTGGGAAGAGAGGAAGAAGG - Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927702101 2:25275362-25275384 CTGTGGGAAGGAGAGGAAGTGGG - Intronic
927770610 2:25857806-25857828 TTGTAGGTAGGGGTGAAAGATGG - Intronic
928396908 2:30949620-30949642 CTGATGGCAGGGGTGGTAGATGG - Intronic
928458549 2:31448249-31448271 CTTTGGTGAGGGGAGGAAGATGG + Intergenic
929533075 2:42764338-42764360 CTGCTGGTAGAGGAGGAAGCAGG + Intergenic
930067069 2:47335797-47335819 CTGTTGGTGGGGTGGGAGGAGGG - Intergenic
930202624 2:48559719-48559741 CTGGTGGTATGGTAGGAAAAGGG - Intronic
930804214 2:55473919-55473941 CTGTGGGTAGAGGAGGAAGGGGG + Intergenic
930865723 2:56120430-56120452 CTTTTGGAAGGGAAGGAGGAGGG - Intergenic
931532577 2:63232875-63232897 CTGGTTGTACGGGAGGAATATGG + Intronic
932818804 2:74882202-74882224 CTGCTGGCAGGGGAAGGAGAAGG - Exonic
933277170 2:80296246-80296268 GTTTTGGTTGGGGAAGAAGAAGG + Intronic
933743143 2:85550696-85550718 CTGTTGGAAGGGGAAGTAAAAGG - Exonic
934680331 2:96278999-96279021 CTGTGGGTTGGAGAGGGAGAAGG + Intronic
934987795 2:98900150-98900172 CAGTGGGAAGGGGAGGCAGATGG + Intronic
935178901 2:100673272-100673294 CTGTCTGTAGGGGACGTAGATGG - Intergenic
935313642 2:101809730-101809752 TTGTTTGTTTGGGAGGAAGATGG + Intronic
935830899 2:106999850-106999872 CAGTTGGTAGGGGAGAGAGTTGG + Intergenic
936969987 2:118168117-118168139 TGGATGGTAGAGGAGGAAGAGGG - Intergenic
937833020 2:126444433-126444455 CTATCTGTAGGGGAGAAAGATGG + Intergenic
937941516 2:127289825-127289847 CTGCAAGCAGGGGAGGAAGAAGG + Intronic
938607962 2:132915785-132915807 CTGTTGGGAGTGGGGAAAGATGG + Intronic
939570414 2:143833651-143833673 CAGTTGGTGGAGGAGGCAGAGGG - Intergenic
941108056 2:161383811-161383833 ATGTTGGCAAAGGAGGAAGAAGG - Intronic
941133151 2:161679517-161679539 CTGTAAGTAGTGTAGGAAGAAGG + Intronic
941640658 2:167984278-167984300 CTGTTGGAGGGGCAGGAACAAGG + Intronic
941669673 2:168278918-168278940 TTTTTGGTGGGGGAGGAATACGG - Intergenic
941695406 2:168545887-168545909 GTGTGGGAAGGGGAGGATGAGGG + Intronic
942772959 2:179545014-179545036 CTGTAGGTTTGGGAGGGAGATGG - Intronic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
943524767 2:189002971-189002993 CTGGTGGTAAAGGAGAAAGAGGG + Exonic
943678568 2:190742977-190742999 GTGTTCCTAGGGAAGGAAGAAGG + Intergenic
943834659 2:192503626-192503648 CTGGAGATAAGGGAGGAAGAAGG + Intergenic
944442001 2:199752222-199752244 CTGTGGGGTGGGGAGGGAGAGGG - Intergenic
944689849 2:202149137-202149159 CTGGGGGTAGGGGAGAAGGAGGG - Intronic
944923887 2:204443246-204443268 CTGATGGGAGGGGAGACAGACGG + Intergenic
945183253 2:207113473-207113495 CAGTGGGGAGGGGAGGAAAAGGG - Intronic
945216174 2:207436477-207436499 TTGTTGGGAGGAGAGGAAGTGGG + Intergenic
948254927 2:236560247-236560269 CTGTTGGCAGGGGTGCAAAATGG - Intergenic
948329884 2:237156459-237156481 CTGCAGGTAGGGGAGGAGGCTGG + Intergenic
948723017 2:239913158-239913180 CAGCTGGCAGAGGAGGAAGAAGG - Intronic
1168866737 20:1092994-1093016 CTGCTGTTAGGGCAGGAAGGTGG + Intergenic
1170075998 20:12419779-12419801 CTGTTGTGGGGGCAGGAAGAAGG - Intergenic
1170432867 20:16293297-16293319 TTTTTGGTAGGGGAGGAGGAAGG + Intronic
1170993296 20:21325561-21325583 GTGTTGACAAGGGAGGAAGAAGG + Intronic
1173249500 20:41357204-41357226 CTGTGGGAAGGGGAGGGAGAGGG + Intronic
1173279671 20:41617815-41617837 CTGTTTGCAGGGGTGGAGGAGGG - Intronic
1173749007 20:45461575-45461597 CTGCTGCTAGGAGAGGAAAAGGG + Intergenic
1173805580 20:45922780-45922802 CTGCTGGAAGGTGAGGTAGAAGG - Intergenic
1174803966 20:53591034-53591056 CAGGTAGTAGGGGAGGAAGGAGG - Intronic
1175174709 20:57104241-57104263 CTGTTGGAATGGGAGCAACAAGG - Intergenic
1175359110 20:58393546-58393568 CTCATGGAAGGGGAGGGAGAAGG - Intronic
1175754988 20:61523727-61523749 CTGATGGTCGGGGACGCAGACGG - Intronic
1175764068 20:61581074-61581096 CTGTAGGCAGGGGAGGGAGCAGG + Intronic
1175825925 20:61936481-61936503 CTGTGGGCAGGGGAGGCGGAGGG - Intronic
1176054348 20:63135771-63135793 CCCTGGGTAGGGGAGGATGAAGG + Intergenic
1176548881 21:8213184-8213206 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1176556776 21:8257397-8257419 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1176567812 21:8396219-8396241 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1176575715 21:8440438-8440460 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1177239869 21:18443032-18443054 TTGGAGGTTGGGGAGGAAGATGG - Intronic
1178121498 21:29474337-29474359 CTGTTGGTTGGGGATAAACAAGG + Intronic
1178493266 21:33067719-33067741 CTGTGTGCAGGGGAGGAAGCCGG + Intergenic
1178808561 21:35860075-35860097 CTGTTGGATGGATAGGAAGAAGG + Intronic
1179566922 21:42254754-42254776 CTCTTGGGGAGGGAGGAAGAGGG + Intronic
1180612891 22:17109128-17109150 CCGCTGGTCGGGGAGGAAGGAGG + Exonic
1181360131 22:22327854-22327876 CTCCTGGTAGAGGAGGAAGGGGG - Intergenic
1181582849 22:23837516-23837538 CAGCTGGGAGGGCAGGAAGATGG + Intronic
1182527270 22:30928208-30928230 CTGTTGGGAGCAGAGCAAGAGGG + Intronic
1182585908 22:31344296-31344318 CGTGTGGCAGGGGAGGAAGAGGG + Intronic
1183418619 22:37697298-37697320 TTGTGGGTAGGGGAGGAAACGGG + Intronic
1183804734 22:40198844-40198866 CTGTTGGTAGTAGAGGGGGAGGG + Intronic
1184753404 22:46502294-46502316 GGGTGGGGAGGGGAGGAAGAGGG + Intronic
1184883965 22:47330837-47330859 CTGATGTTTGGGGAAGAAGAGGG - Intergenic
1185285769 22:49999455-49999477 CTGGCTGTAGGGCAGGAAGACGG + Exonic
1203253766 22_KI270733v1_random:129492-129514 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1203261822 22_KI270733v1_random:174571-174593 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
949200843 3:1377805-1377827 GTGTTGGTAGGGGAGGAGAAAGG + Intronic
950432381 3:12958298-12958320 TTGTAGGTAGGGGAGGTTGAGGG - Intronic
951432101 3:22620455-22620477 ATGTTGGCAGGGGAGGATAAAGG - Intergenic
951553016 3:23894544-23894566 CAGTTGGGAGGAGAGGGAGATGG - Intronic
951826123 3:26871048-26871070 CTATTGGTAGAGGAGGTAGGAGG + Intergenic
952212868 3:31247119-31247141 CTGAGGGTAGCGGAGGAGGAAGG - Intergenic
954067755 3:48120346-48120368 CTCTTGACAGGGGAGGAAGGAGG - Intergenic
954680802 3:52344962-52344984 CTCTTGCTACTGGAGGAAGAAGG - Intronic
954797808 3:53170401-53170423 ATGTTGGTAGGGCAGCAAGCCGG - Intronic
954903914 3:54043661-54043683 TTGGTGGCAGGGGTGGAAGAAGG + Intergenic
955887279 3:63614027-63614049 CTGTGGGTAGTGGTGGCAGAGGG - Intronic
956882859 3:73528811-73528833 CTTTTTGGAGTGGAGGAAGAAGG + Intronic
961173280 3:124814285-124814307 CTGAAGGGAGGGGTGGAAGAAGG + Intronic
961842620 3:129729165-129729187 CTGCTGGTAGGAAAGGAAAATGG - Intronic
961865504 3:129950788-129950810 CAGTTGGTGGGGGAGGGTGAAGG + Intergenic
962841676 3:139238405-139238427 CTGGAGGAAGAGGAGGAAGAAGG - Intronic
963237617 3:142971190-142971212 ATGTGGGTAGGGAAGGAAAATGG + Intronic
963286374 3:143438262-143438284 CGGTTGGTAGGGGAGGCAGTGGG + Intronic
963843569 3:150132334-150132356 GTGTTGGAGAGGGAGGAAGAAGG - Intergenic
963873371 3:150444507-150444529 CTGTTGGCAAGAAAGGAAGAAGG + Intronic
965090615 3:164158060-164158082 CTGTTGGTAGGAGTGTAAGTTGG - Intergenic
965142940 3:164863015-164863037 CTGCTGGAAGTGGAGGCAGATGG + Intergenic
965841006 3:172905491-172905513 CAGTTGGTTGAGGAGGTAGAGGG - Intronic
966377315 3:179309647-179309669 GTGTTTGGAGGTGAGGAAGAGGG - Intergenic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967039966 3:185682834-185682856 CTGTTGGTGGGGTTGGAAAATGG + Intronic
967320520 3:188190425-188190447 CTGCTGGTAAGTGAGGGAGAAGG + Intronic
967681218 3:192366153-192366175 CTGAGGGTTGGGGAGCAAGAAGG + Intronic
968615139 4:1574388-1574410 CTGGTGGGAGGGGATGAGGAGGG - Intergenic
969202027 4:5614173-5614195 CTGTAGGTAGGAGAGGAGGCAGG - Intronic
969872164 4:10111405-10111427 CTGATGGCAGGGGAAGCAGAGGG - Intronic
969957075 4:10902000-10902022 CTGTCGGTAGGGCATGGAGAGGG - Intergenic
970923160 4:21418636-21418658 CTTTTGGGAGGGAAGAAAGAAGG + Intronic
971115034 4:23635815-23635837 CTGTTGGTGGGGAAGTAAAATGG + Intergenic
973152068 4:46900487-46900509 CTGGTGGCAGGGGAGGAGGGGGG + Intronic
974769193 4:66388565-66388587 CTGTTGGGGGTGGAGGATGAGGG + Intergenic
975636678 4:76457186-76457208 CTGTTGGAAGTGGAGGGAGGTGG + Intronic
975802453 4:78075295-78075317 AAGTTGATAGGGGAGAAAGATGG + Intronic
976152781 4:82108794-82108816 CTGTTGCTCTGGGAGGCAGATGG - Intergenic
976349047 4:84039863-84039885 CTATTGACTGGGGAGGAAGAGGG + Intergenic
976786469 4:88826986-88827008 CTGTAAGTGGGGAAGGAAGAGGG - Intronic
978339560 4:107707575-107707597 CTTTGCTTAGGGGAGGAAGAGGG - Intronic
978845777 4:113271168-113271190 TTGTTCGGATGGGAGGAAGAGGG - Intronic
979173530 4:117632751-117632773 CTGTTGGTAGGAATGGAAGCAGG + Intergenic
979199930 4:117965038-117965060 CTGTTGGTTGGGGAAGAAGTGGG + Intergenic
979830437 4:125293855-125293877 TTGTTGGGAGGTGAGGCAGAGGG + Intergenic
982077455 4:151751909-151751931 CCGTTGGAAGAGGAGGAAGGTGG - Intronic
984621306 4:181955603-181955625 TTGTGGGGAGGGGAGGAACAAGG + Intergenic
984771819 4:183443400-183443422 CTTTTGGTATGGCAGGAAAATGG + Intergenic
984823139 4:183901512-183901534 CTGTTGGTAGGCAAGCAAAATGG - Intronic
985040225 4:185884026-185884048 CAGGAGGTGGGGGAGGAAGAAGG + Intronic
986192142 5:5507476-5507498 CTGCTGGCAGGGGTGGAAAATGG + Intergenic
986441574 5:7787189-7787211 CTGTGTGCAGGGGAGGAACAGGG - Intronic
987250185 5:16092577-16092599 CTGTTGGTGGGTGGGGAAAAAGG + Intronic
987415124 5:17654528-17654550 GTCTTGGTAGGGGAGGTAGTAGG - Intergenic
987698479 5:21363425-21363447 CTTTTGGGAAGGTAGGAAGATGG - Intergenic
989563498 5:42877348-42877370 GTGTAGGTTGGGGAGGAAGGAGG - Intronic
992125098 5:73631809-73631831 TTGTTGGCAAGGGAGGAAAAGGG - Intronic
993087843 5:83385804-83385826 CTGTTGGTGGGGGTGCAAAATGG + Intergenic
993248267 5:85480397-85480419 CTGTTAAAAGTGGAGGAAGAAGG - Intergenic
993392006 5:87330038-87330060 CTGTTAGTACTAGAGGAAGAAGG - Intronic
994264504 5:97699450-97699472 TTGCTGCTGGGGGAGGAAGAAGG - Intergenic
994434014 5:99705953-99705975 CAGTTGGTAGAGGAGAGAGATGG + Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
995438454 5:112163428-112163450 CTGCTGGTGGTAGAGGAAGAGGG + Exonic
997104477 5:131003653-131003675 TTTTTCATAGGGGAGGAAGATGG + Intergenic
997266130 5:132496380-132496402 CTGGGGGTAGGGGTGGAAGTGGG - Intergenic
997826610 5:137112211-137112233 CTGGTTGGAGGGGAAGAAGAAGG - Intronic
998374817 5:141683200-141683222 CTGTTTGTATGAGAGGAAGTTGG + Intergenic
998899145 5:146833746-146833768 CTGGGGGTGGGGGAGGAGGATGG - Intronic
999361506 5:150990040-150990062 GTGTTGGAAGGGGGAGAAGAGGG + Intergenic
999378124 5:151101165-151101187 CTGTAGCAAGGGGAGGAAGCTGG + Exonic
999977571 5:156927105-156927127 CTGCTGGAAGGGCAGGTAGAGGG + Intronic
1000281984 5:159790063-159790085 CTGTTTGCTGGGGAGGAAGGCGG + Intergenic
1000458067 5:161477349-161477371 CTGTTGGTAGGAAAGTAAAATGG + Intronic
1001121160 5:168981316-168981338 ATGGGGGTAGGGGAGAAAGAGGG + Intronic
1001735658 5:173997245-173997267 GTGGTGGTAGGGCAGGAACAAGG + Intronic
1001903789 5:175453895-175453917 GTGTGGGGAGGGGAGAAAGAGGG + Intergenic
1002201344 5:177530427-177530449 CTGATGGCAGGAGAGGGAGATGG - Intronic
1002272271 5:178080332-178080354 ATGCGGGCAGGGGAGGAAGAAGG - Intergenic
1002561772 5:180087378-180087400 AGAGTGGTAGGGGAGGAAGAGGG - Intergenic
1002864966 6:1113560-1113582 CTGTTGGTAGGAATGGAAAATGG + Intergenic
1004015151 6:11725574-11725596 TTGTTGGTAGGAATGGAAGATGG + Intronic
1004017981 6:11749676-11749698 CTGCTGAGAGGTGAGGAAGATGG + Intronic
1004329147 6:14705744-14705766 ATGTAGGAAGGGGAGGAAAAGGG - Intergenic
1004436553 6:15600713-15600735 CAGGTGGTAGGAGAGGAAGGAGG + Intronic
1004959791 6:20774088-20774110 CTGGTGGTAGTGGAGGTGGATGG + Intronic
1005492782 6:26361920-26361942 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005496947 6:26396041-26396063 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005944583 6:30586033-30586055 CTCCTGGCAGTGGAGGAAGAAGG + Intronic
1006091636 6:31632078-31632100 CTGGTGGTGGGGGAGCGAGAGGG - Exonic
1007342761 6:41201996-41202018 CTGGAGGCAGGGGAGGAAGGGGG - Intergenic
1007487879 6:42194899-42194921 CTCCTGGAAAGGGAGGAAGAGGG - Exonic
1008453150 6:51676038-51676060 CTGGTGGCAGAGGAGGAGGAAGG + Intronic
1008717351 6:54305284-54305306 CTGGGAGTAGGGGAGGGAGAAGG + Intergenic
1010356414 6:74939043-74939065 CTGTCAGTCGGGGAGGAAGAGGG + Intergenic
1011650713 6:89503873-89503895 GTGTTGGTAGAGGAGCAAGGAGG + Intronic
1011954740 6:93012896-93012918 TGGGTGGTGGGGGAGGAAGAAGG - Intergenic
1013307296 6:108861160-108861182 CTTTTGGTAGCAGAGGTAGAAGG - Intronic
1015582038 6:134736166-134736188 CAGCTGGGAGGGGAGAAAGAGGG - Intergenic
1017480589 6:154850557-154850579 CTGCTGGGAGGGGAGTAAGATGG - Intronic
1017774723 6:157672003-157672025 CTGCTGGGGCGGGAGGAAGAGGG - Intronic
1018595802 6:165479232-165479254 GTGTAGGCAGGGGAGGATGATGG - Intronic
1018873573 6:167801477-167801499 TTGTTGGTAGAGGAAGGAGAGGG - Intergenic
1019713056 7:2526089-2526111 CTGTGGCCAGGGGAGGCAGAGGG + Intronic
1019924184 7:4181543-4181565 ATGTTGGGAGGGGAGGGAGATGG - Intronic
1020869753 7:13612902-13612924 CTGTTGGGAGTGGAGGGTGAGGG + Intergenic
1021464767 7:20929785-20929807 CTGGGGGTGGGGGAGGAGGAGGG - Intergenic
1022383780 7:29884065-29884087 GTTTTGATGGGGGAGGAAGAGGG - Exonic
1023606506 7:41936282-41936304 CAGGTGGTAGGGGAGAGAGATGG + Intergenic
1023865085 7:44234677-44234699 CTGCTGCATGGGGAGGAAGAAGG + Intronic
1024386801 7:48761462-48761484 CTGAAGGCAGGTGAGGAAGATGG + Intergenic
1026888510 7:73968568-73968590 CTGTTGATAGATGAGGAAGCTGG - Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1028245647 7:88473517-88473539 ATGTTGGAAGGGCAGGAACAAGG + Intergenic
1029222606 7:99002384-99002406 ATGCTGGTGTGGGAGGAAGAGGG + Intronic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029540841 7:101180986-101181008 CTGGTGGCTGGGGAGGAAGAGGG + Intergenic
1029643926 7:101839444-101839466 CTGTGGGTGGGGGAGTAAGTGGG - Intronic
1029970767 7:104786582-104786604 CTGTAGGCAGAGGAGTAAGATGG + Intronic
1032201444 7:129825548-129825570 CTGTCGGGAAAGGAGGAAGAAGG - Intergenic
1032625157 7:133583975-133583997 GTGTGGGTCGGGGAAGAAGAAGG + Intronic
1032999126 7:137483593-137483615 CTGTTGTAAGGGTGGGAAGAAGG - Intronic
1033201159 7:139371526-139371548 TTGTTTGTATGGGAGGGAGAGGG + Intronic
1033257506 7:139814927-139814949 CAGGTGCTAGGGGAGGATGATGG - Intronic
1033837993 7:145338714-145338736 GTGTGTGTAGGGGAGGTAGATGG + Intergenic
1033973338 7:147069575-147069597 CAGTTGGTAGGGGAGGGAAGAGG + Intronic
1035158082 7:156930336-156930358 CTGGGAGAAGGGGAGGAAGACGG - Intergenic
1035213556 7:157347563-157347585 CTGTTTGTAGGTGAGGAAACGGG - Intronic
1035487157 7:159234890-159234912 CTCTTGTTAGGGGAGGAAGGGGG + Intergenic
1036176779 8:6546766-6546788 TTGGGGGAAGGGGAGGAAGAGGG - Intronic
1036397036 8:8378395-8378417 CTGGTTGCAAGGGAGGAAGAAGG - Intronic
1038269373 8:26062764-26062786 CAGTTGATTGGGGAGGAAAAAGG - Intergenic
1038425359 8:27461009-27461031 CTTCTGGAAGGGGAGGAAGCGGG - Exonic
1038704501 8:29880952-29880974 CTGGTGGTAGGGGTGGGAGTGGG + Intergenic
1038888932 8:31696544-31696566 CTGATACTAGGGGAGAAAGAGGG + Intronic
1039219466 8:35312906-35312928 CCGCTGGTAGTGGAGGAAGTTGG - Intronic
1039822843 8:41148870-41148892 GTGATGGTAGGGGCAGAAGAGGG + Intergenic
1040698237 8:50028556-50028578 TTGTTGGTAGAGGAGTAAAACGG - Intronic
1041119028 8:54567840-54567862 TTGTGGTTAGGGGAGGTAGAGGG + Intergenic
1041124648 8:54622860-54622882 CTTTGGATAGGGGAGGAAGAGGG + Intronic
1041125664 8:54635974-54635996 CAGTGGGGAGGAGAGGAAGAGGG - Intergenic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1041700960 8:60788530-60788552 CTGTTAGCAGGAAAGGAAGAGGG - Intronic
1043796395 8:84547113-84547135 CTGTTGGGAGGGCAAGAGGAGGG - Intronic
1044413369 8:91909746-91909768 CTGCTGGAAGAGGAGGAGGAAGG + Intergenic
1044440186 8:92215057-92215079 CTGTTGGTAGTGGGGGTCGAGGG - Intergenic
1044690011 8:94868152-94868174 CTTTTTTTAGGGGAGGAAAAAGG + Intronic
1044826505 8:96203463-96203485 GGGTTGGTAGGGAAGAAAGATGG - Intergenic
1045266313 8:100621635-100621657 CACTTGGTAGGGGAGGAGAATGG - Intronic
1045486766 8:102637522-102637544 CTGTTGGTAGGAGCTGAAGCTGG - Intergenic
1046893441 8:119448116-119448138 CAGTTAATAGGGGAAGAAGAGGG + Intergenic
1047188985 8:122661019-122661041 CTGAATGTAGGGGAGGAAGGTGG - Intergenic
1048277830 8:133080588-133080610 CTGTGGGAAAGGGATGAAGATGG - Intronic
1048599649 8:135906237-135906259 CTGTGGGCAGGCGAGGAAAAAGG - Intergenic
1049565386 8:143335310-143335332 CTGTTTGTAGGGGATGAGGTAGG - Intronic
1049734690 8:144198787-144198809 CTGCTGGTAGGAGAGGTGGAAGG + Intronic
1051591769 9:18783374-18783396 CTAATGGTAGGGGAGGATGTGGG - Intronic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052502848 9:29314876-29314898 CAGTTTGTAGAGGTGGAAGAAGG - Intergenic
1053167026 9:35852326-35852348 TTGTTGGGAAGGGATGAAGAGGG + Intronic
1053209937 9:36219156-36219178 CTGTTGGCAGTGGGGGTAGAAGG - Intronic
1053273066 9:36763202-36763224 CTGCTGGGAGTGGAGGAACAGGG + Intergenic
1054743925 9:68835294-68835316 CTGCTGGTGAGGAAGGAAGACGG - Intronic
1055497153 9:76867150-76867172 CAGTTGGTGGGGGAGGAGAAAGG - Intronic
1055562750 9:77537215-77537237 TGGTTGGGAGGGGAGGATGAAGG - Intronic
1055644695 9:78352019-78352041 GGGTTGGGAGGGAAGGAAGAAGG - Intergenic
1056526257 9:87445748-87445770 CAGTTCGTTAGGGAGGAAGAAGG - Intergenic
1057217375 9:93236549-93236571 GTGTTGGAAGTGGAGTAAGACGG - Intronic
1058179459 9:101779139-101779161 GTGTGGGTGGGGGAGGAAGCTGG - Intergenic
1058438858 9:104989336-104989358 GTGTTGGGAGTGGGGGAAGATGG - Intergenic
1059060737 9:111033350-111033372 TTTTTGGTAGGAGAGGAGGAGGG - Intronic
1059226444 9:112677474-112677496 CTGTTGGTAGGGATGTAAAATGG - Intergenic
1059249120 9:112872447-112872469 CTGGTGAGAGAGGAGGAAGAGGG + Exonic
1059627596 9:116084045-116084067 TTGTTTCTAGGGGAGGAAAATGG + Intergenic
1060228405 9:121809849-121809871 TTGTTGGTGGGGGAGGGAGGAGG + Intergenic
1060408128 9:123382626-123382648 CTGTTGGGAGGGAAGGAGGGCGG + Intronic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1060990322 9:127845271-127845293 CTGTGGGAAGGTGAGGAAGGAGG - Intronic
1061185817 9:129052590-129052612 CTTTTGGCAGCGGAGGTAGAAGG + Intronic
1062034332 9:134376144-134376166 CCGCTGGTTGGGGCGGAAGAAGG + Intronic
1062130463 9:134889897-134889919 CTGTCGGGAGGGCTGGAAGAAGG + Intergenic
1203470166 Un_GL000220v1:112640-112662 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1203477987 Un_GL000220v1:156612-156634 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1203376994 Un_KI270442v1:384372-384394 CTGTTGGTTCTGGAGGCAGAAGG + Intergenic
1186473916 X:9842640-9842662 CTTGTGGTGGGAGAGGAAGAGGG - Intronic
1187178247 X:16916624-16916646 CTGTTGGGGGGGGAGGGGGAGGG - Intergenic
1187312470 X:18158422-18158444 CTGTTGGTAGGAGTGTAAGGTGG - Intergenic
1187482845 X:19673826-19673848 GTGGTGGTAGTGGAGGAAGTGGG - Intronic
1187507410 X:19888172-19888194 CTGTTGGAGGGGAAGGAAAAGGG + Intergenic
1188024457 X:25194185-25194207 CTGTTGGGAGTGGAGGGACAAGG + Intergenic
1188744314 X:33823907-33823929 CTGTTGGTAGGTGAGGTTGAGGG - Intergenic
1188878977 X:35468670-35468692 GTGTGGGGAGGGGAGGAGGATGG + Intergenic
1189700940 X:43715962-43715984 CGGTTGGTGGCGGGGGAAGATGG + Intronic
1189904946 X:45748624-45748646 CTCTTGGTGGGGGAGGATAAGGG + Intergenic
1190740946 X:53288393-53288415 CTGTTGCTAGGGAAGGAGGGAGG - Intronic
1193360294 X:80572784-80572806 CTGCTGGCAGGGGAAGGAGAAGG + Intergenic
1194525966 X:94977922-94977944 CTGTTGGTATGGCAGGGGGAGGG + Intergenic
1195711090 X:107774592-107774614 CTGGTGGTAGGAGAGGGAGATGG - Intronic
1195923175 X:110002639-110002661 CTGCTGCAGGGGGAGGAAGACGG + Intronic
1195997863 X:110749373-110749395 CTGCAGGAGGGGGAGGAAGAGGG - Intronic
1196118215 X:112019850-112019872 CTGTTGGAAGGGCTGGAAAATGG + Intronic
1197444987 X:126542426-126542448 CTGTTGGTAGGGATGTAAAATGG + Intergenic
1197463388 X:126771469-126771491 TTGTTGGTAGGGGAGCATGGTGG + Intergenic
1197699557 X:129588568-129588590 CTGTTGACAGGGCAGGGAGAAGG + Intronic
1197776459 X:130121546-130121568 CTGTCGGGACGGGAGGAAGAGGG - Intergenic
1198435149 X:136609811-136609833 GTGTTGGTGGGGCAGGAAGGTGG + Intergenic
1198830362 X:140744018-140744040 CTGTTGGGAAATGAGGAAGAGGG + Intergenic
1199411478 X:147528621-147528643 CTGATGGGGGGGGAGGAGGAGGG - Intergenic
1200103672 X:153700911-153700933 CTGCAGGCAGGGGAGGAAGGAGG + Exonic
1200749120 Y:6928882-6928904 CAGTTGGTAGGGGAGCAAGGTGG + Intronic