ID: 900651525

View in Genome Browser
Species Human (GRCh38)
Location 1:3732390-3732412
Sequence TGCTTGGTGTGGTGCCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 196}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900651520_900651525 -7 Left 900651520 1:3732374-3732396 CCCTGAGTGATGTGTGTGCTTGG 0: 1
1: 0
2: 1
3: 23
4: 246
Right 900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 196
900651522_900651525 -8 Left 900651522 1:3732375-3732397 CCTGAGTGATGTGTGTGCTTGGT 0: 1
1: 0
2: 1
3: 18
4: 165
Right 900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 196
900651519_900651525 -6 Left 900651519 1:3732373-3732395 CCCCTGAGTGATGTGTGTGCTTG 0: 1
1: 0
2: 1
3: 27
4: 244
Right 900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 196
900651516_900651525 3 Left 900651516 1:3732364-3732386 CCCTTGCCTCCCCTGAGTGATGT 0: 1
1: 0
2: 1
3: 22
4: 214
Right 900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 196
900651517_900651525 2 Left 900651517 1:3732365-3732387 CCTTGCCTCCCCTGAGTGATGTG 0: 1
1: 0
2: 1
3: 24
4: 257
Right 900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 196
900651518_900651525 -3 Left 900651518 1:3732370-3732392 CCTCCCCTGAGTGATGTGTGTGC 0: 1
1: 0
2: 1
3: 18
4: 169
Right 900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 196
900651515_900651525 17 Left 900651515 1:3732350-3732372 CCAGGTCACGTTAACCCTTGCCT 0: 1
1: 0
2: 2
3: 1
4: 58
Right 900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 196
900651514_900651525 23 Left 900651514 1:3732344-3732366 CCAGCTCCAGGTCACGTTAACCC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900651525 Original CRISPR TGCTTGGTGTGGTGCCCAGA GGG Intronic
900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG + Intronic
900865453 1:5265775-5265797 TCCTTGGGGTGATGCCAAGAGGG + Intergenic
902506216 1:16940137-16940159 TGACTGGTGTTATGCCCAGACGG - Intronic
904995699 1:34629740-34629762 TTGCTGTTGTGGTGCCCAGAGGG - Intergenic
906261516 1:44395122-44395144 TGCTTGGGGTGGTTCCAGGAAGG + Intergenic
906781367 1:48575829-48575851 TGCATGGTGAGGTTCCCAGGTGG - Intronic
907491601 1:54812166-54812188 TGCATGGAGTAGTGCCCATAAGG - Exonic
908114658 1:60928951-60928973 TGCTTGGTGCTTTCCCCAGAAGG + Intronic
910606626 1:89092368-89092390 TGCTAGCTGTGATGCCCAGTTGG + Intergenic
914224857 1:145711979-145712001 TGCATGGGATGGTCCCCAGAGGG - Intergenic
915604458 1:156941865-156941887 TGCTGGGTGTGGGGCCCTGCTGG + Exonic
919977592 1:202623026-202623048 GGCTTGGTGGGGTGGCCTGAGGG - Intronic
920336670 1:205249617-205249639 TGCGTGGTGGTGTGCTCAGAAGG - Intronic
920630718 1:207649000-207649022 TGCTGGGTGTTGTGGCCACATGG + Intronic
920641496 1:207755934-207755956 TGCTGGGTGTTGTGGCCACATGG + Intronic
924261085 1:242232593-242232615 AGCCAGGTGTGGTGCTCAGATGG + Intronic
924554578 1:245107715-245107737 TGCCTGGAGTGGTGCACAGGGGG - Intronic
1065694826 10:28370166-28370188 GCCTTGGTTTGTTGCCCAGAAGG - Intergenic
1066455135 10:35565831-35565853 CACTTGATCTGGTGCCCAGAAGG - Intronic
1067142645 10:43669632-43669654 GGCTTGGTGAGCAGCCCAGAGGG + Intergenic
1067199258 10:44152311-44152333 TGGTTGGGGTGGTTCCAAGATGG - Intergenic
1068106142 10:52619427-52619449 TTCCAGGTGTGGTACCCAGATGG + Intergenic
1069914244 10:71777635-71777657 TCCTTGGTCAGGTGGCCAGAGGG - Intronic
1070621584 10:78016372-78016394 GTCTTGGTGTATTGCCCAGATGG - Intronic
1071216324 10:83406685-83406707 TCCATGCTGTGATGCCCAGAAGG - Intergenic
1072403373 10:95127597-95127619 GGCTTGCTGTAGTGTCCAGAAGG + Intergenic
1074380166 10:112973033-112973055 TTCTATGTGTGTTGCCCAGAAGG - Intronic
1074708577 10:116158214-116158236 TGGTTGGTAAGCTGCCCAGAAGG + Intronic
1075086435 10:119417242-119417264 TGCTGAGTGTGGTGCCCACTGGG + Intronic
1076322768 10:129595617-129595639 TTCTTGGGGCGGGGCCCAGAGGG + Intronic
1076706733 10:132306467-132306489 TTCATGGTGTGCTGCCTAGAAGG - Intronic
1077318668 11:1930271-1930293 GGCTTGGTGTGGTCCCCCGAAGG - Intronic
1078468363 11:11567595-11567617 GGCTGGGTTTGGGGCCCAGAGGG - Intronic
1078759987 11:14244072-14244094 TGATTTGTGAGCTGCCCAGAAGG - Intronic
1079332642 11:19546390-19546412 CCCTGGGTGTGGGGCCCAGATGG + Intronic
1080030265 11:27652948-27652970 TGCTTGGTTTGGTGACAAGCGGG - Intergenic
1083410548 11:62489597-62489619 TGACTGGTGTGGTAGCCAGATGG + Intronic
1084239048 11:67806079-67806101 GGCTTGGGGTGGGGCCGAGACGG + Intergenic
1087946835 11:104172295-104172317 CCCTTGGTGTGGAGCCCAGTTGG + Intergenic
1091037850 11:132249488-132249510 TTCCTTGTGTGATGCCCAGAAGG + Intronic
1092698346 12:11199453-11199475 TGCTTGGTGAGGAGGTCAGATGG - Intergenic
1092767233 12:11863590-11863612 TTCTTGGTGAGCTGCCCAGCTGG - Intronic
1093127859 12:15352107-15352129 TGCCCAGTGTGGTGCCCTGATGG + Intronic
1095486465 12:42689787-42689809 TGCTTAGGGTGGGGCCCAGGGGG + Intergenic
1096981465 12:55729950-55729972 TGCCAGGGGTGGTCCCCAGAAGG + Intergenic
1102466695 12:113134623-113134645 TGCTTGGCATAGTGCCCAGAAGG - Intronic
1103910264 12:124348311-124348333 TGCTTTGTGTGGTTTCCAGGTGG - Exonic
1104823181 12:131690353-131690375 TGCTGGTGGTGCTGCCCAGAGGG - Intergenic
1105446956 13:20465818-20465840 TGTTGGATGTGGGGCCCAGAGGG + Intronic
1105725411 13:23158855-23158877 TGCTTGGTGTGTTTTACAGAGGG - Intergenic
1106925831 13:34612187-34612209 TGATTGTTGTTGGGCCCAGAAGG - Intergenic
1107334518 13:39339844-39339866 TGATTGGAGTGGTGTCCACATGG - Intergenic
1110513433 13:76380889-76380911 TGATCTTTGTGGTGCCCAGATGG - Intergenic
1112599506 13:100841124-100841146 AGCGTGGTGTGGTACCCAGAGGG - Intergenic
1113454133 13:110435734-110435756 TTTTTGATGTGGTGCACAGATGG - Intronic
1113802382 13:113093299-113093321 GGCCTGGTGTGGTGCCTGGAAGG + Intronic
1116064558 14:39966424-39966446 TGATTGGTGTGGGGTTCAGAGGG + Intergenic
1118854411 14:69610344-69610366 AGGTTGCTGTGGGGCCCAGAAGG + Intergenic
1119388666 14:74275570-74275592 TGCCTGGTGGGGTGCAGAGAGGG + Intergenic
1120562563 14:86014061-86014083 TGCTTGGATTGGTGGTCAGAAGG + Intergenic
1121015227 14:90545006-90545028 TGCCTAGCGTGGTGCCCAGTGGG - Intronic
1127473324 15:59309781-59309803 TGCTTTATGTGCTGCCAAGAAGG - Intronic
1129332814 15:74836515-74836537 TGGCTAGTGTGGGGCCCAGAGGG + Exonic
1130744660 15:86638244-86638266 TGTTTTGTGTAGTGACCAGATGG + Intronic
1130829796 15:87587529-87587551 AGATAGGGGTGGTGCCCAGAAGG + Intergenic
1131164486 15:90132578-90132600 GTCTTGCTGTGTTGCCCAGATGG + Intergenic
1132470856 16:102142-102164 TGTTTTGTGTGGTTCCCCGAGGG - Intronic
1132512352 16:350272-350294 TGCTTGGTGTGCTTCCCTGTGGG - Intronic
1132563394 16:609252-609274 TGCCTGGTGTGGTTCCCAGCAGG + Intronic
1136317039 16:29460528-29460550 TGTTTGTTCTGGAGCCCAGATGG + Intronic
1136319058 16:29470773-29470795 TGCTTGTCCTGGAGCCCAGATGG + Intergenic
1136431614 16:30199870-30199892 TGTTTGTTCTGGAGCCCAGATGG + Exonic
1136433629 16:30210117-30210139 TGCTTGTCCTGGAGCCCAGATGG + Intergenic
1138293778 16:55869722-55869744 GTCTTGGTGTGGTTCCCAGGAGG - Exonic
1140084943 16:71786916-71786938 AGCCGGGTGTGGTTCCCAGAAGG + Intronic
1141110331 16:81266320-81266342 TCCTGGGTGTGGTTCCCAGGAGG - Intronic
1144099856 17:11933790-11933812 GGCTTTCTGTGCTGCCCAGATGG + Intronic
1144291986 17:13835361-13835383 TGCTGAGTCTTGTGCCCAGAAGG + Intergenic
1145923881 17:28631631-28631653 TGATTGGAGTGTTACCCAGATGG - Exonic
1149272477 17:54995251-54995273 ACCTTGGTGTGGAGCCCAAATGG - Intronic
1149780262 17:59391932-59391954 TGTGTTGTGTGGTGCCAAGATGG + Intronic
1151743633 17:76000516-76000538 TGCTTGGTGTGGGGCCATGGAGG + Exonic
1152582099 17:81170720-81170742 TGCCTACTGTGGTGCCCAGCAGG - Intergenic
1152942429 17:83179878-83179900 AGCTCTGTGAGGTGCCCAGAGGG - Intergenic
1155401240 18:25441851-25441873 TGCTTGGTTTGCTTCCCAGTGGG + Intergenic
1160338914 18:78069814-78069836 TTCTTGGTGTGGTCACCAGACGG + Intergenic
1163580526 19:18136038-18136060 AGCTGGGTCTGGTGCCCATATGG + Intronic
1163708833 19:18833128-18833150 TGAAAGGTGGGGTGCCCAGATGG - Intronic
1163888175 19:19988027-19988049 TGGTGGGGGTGGGGCCCAGATGG + Intergenic
1164313089 19:24063413-24063435 TGCTTGGTGTTGCACCCAGGTGG + Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1166231192 19:41426646-41426668 GGCTTGGCGGGGTGCCCCGAGGG + Exonic
1167031324 19:46963124-46963146 TGCATGGTGTGCTACCCTGATGG + Intronic
925277506 2:2660961-2660983 TGCTTGGTCTGCTGCCCTCAGGG - Intergenic
926213864 2:10891489-10891511 CACTTGGTGTGGTGTGCAGATGG + Intergenic
926412180 2:12615880-12615902 GGCTTGGTGGGGTGCCAAGTAGG + Intergenic
926712454 2:15892280-15892302 TGCTGGGAGGGGTGCCAAGAAGG - Intergenic
931221543 2:60292720-60292742 TCTTTGGTCTGCTGCCCAGAAGG - Intergenic
931477559 2:62605233-62605255 TGCCTGGGGTGGAGCCAAGATGG + Intergenic
933547202 2:83729690-83729712 GGCTAGGTGTGGAGGCCAGAAGG + Intergenic
934119140 2:88823598-88823620 GACTTGGAGTGCTGCCCAGAGGG - Intergenic
936875980 2:117190067-117190089 TGCTTTGGTTGGAGCCCAGATGG + Intergenic
937209994 2:120262335-120262357 TGCTTGATGTGGTGTCCCCAGGG + Intronic
937569105 2:123334358-123334380 TAGTTGATGTGGAGCCCAGAGGG + Intergenic
937829461 2:126403674-126403696 TGATTTGTGTGGTTTCCAGATGG - Intergenic
938306398 2:130259177-130259199 GGCTTTGTGTGGAGCCAAGATGG + Intergenic
938795366 2:134714458-134714480 GGCTTAGTGTGGTACCCAGTTGG - Intronic
940809102 2:158222828-158222850 TACTTGGAGTGGAGCCAAGATGG + Intronic
941732332 2:168932574-168932596 TGGTTGGTGTGATGACCTGAAGG + Intronic
946311749 2:218885772-218885794 GGATTGGGGTGGTGCTCAGATGG + Intronic
947617277 2:231566329-231566351 TGGTTGGTCTGGGTCCCAGATGG + Intergenic
948861347 2:240754172-240754194 TGCTGGGGGTGGGGCCCCGAGGG + Intronic
1170579346 20:17686228-17686250 TGCTAGGTTTGGGGCCCACAGGG + Intergenic
1172776966 20:37413524-37413546 TGATGGGTGTGGGGCCCAGGAGG - Intergenic
1173374693 20:42472880-42472902 TGCTGTGTGTGGTACCAAGAAGG - Intronic
1173425707 20:42941636-42941658 TGGTTGATCTGGGGCCCAGAAGG - Intronic
1174285679 20:49471313-49471335 TGCTGTGTGTGGAGACCAGACGG + Intronic
1176385029 21:6134908-6134930 TGCCCGGTGTGGGGGCCAGAGGG - Intergenic
1179738444 21:43403344-43403366 TGCCCGGTGTGGGGGCCAGAGGG + Intergenic
1182129420 22:27840104-27840126 TGCTTGGTGTGTTGGACAGCCGG + Intergenic
1182662463 22:31934635-31934657 TGCATAGTGAGGTGCCCAGTGGG + Intronic
1184176221 22:42790750-42790772 TGTGTGGTGTGGTGGCCAGGAGG + Intergenic
1184688221 22:46105847-46105869 TGCTGGGTGGGGTGACCACAGGG + Exonic
950106998 3:10394664-10394686 TGCTTGGTGGGGTGGGCAGCAGG + Intronic
950425565 3:12923172-12923194 TGCCTGGTGTGGTGGCCCGGGGG + Intronic
950483605 3:13259834-13259856 TGCTTGTTGTGGCGCTCAGCGGG + Intergenic
951269090 3:20603186-20603208 TGCTTGGTGAGGTGCAGAGGAGG + Intergenic
952869189 3:37882930-37882952 TGCTTGGTTTGGAGCCAAGTTGG + Intronic
954146838 3:48638753-48638775 TGCTGGGGGTGGGGACCAGAGGG - Intronic
954198833 3:49012372-49012394 TGCTTGGTGTGGAGCCATGAAGG + Exonic
957325440 3:78686732-78686754 TGCTTATTGTGGTGCCAAAATGG - Intronic
958736203 3:98012005-98012027 TGCTTGGTGGGGTGCCAGGGTGG + Intronic
961378112 3:126480448-126480470 GGCTTGGTATGGAGCCCAGAGGG + Intergenic
961481423 3:127183297-127183319 TCCTTGGTGCTGTGCCCAGAAGG - Intergenic
963055384 3:141182236-141182258 TGCAGGGTGTGTTGACCAGAAGG - Intergenic
964454033 3:156841137-156841159 TGCATGGTGGGATGGCCAGAGGG + Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967723241 3:192837422-192837444 TGCTTGGTGGGAAGCCCAGGTGG - Intronic
968553455 4:1236023-1236045 TGCTGGGTGTGGGGCCCTGCCGG - Intronic
972403052 4:38723181-38723203 TGCTTAGTGTGAGGTCCAGATGG + Intergenic
973386245 4:49516080-49516102 GGCTTGGTGTGGAGCCCTCACGG - Intergenic
974253415 4:59419683-59419705 TTGTGGGGGTGGTGCCCAGATGG + Intergenic
975481850 4:74889640-74889662 GGCTTGGTGAGGTGCACAGGAGG + Intergenic
979213234 4:118132331-118132353 TGCTGGTGGTGGTGCTCAGAGGG - Intronic
981454132 4:144933839-144933861 TAGTTGATGTGGAGCCCAGAGGG - Intergenic
982584850 4:157222829-157222851 GGATTGGTGTGGAGGCCAGAGGG + Intronic
985569993 5:639624-639646 TGGTTGGTGTGGGACCCAGGAGG + Intronic
986364520 5:7017224-7017246 TCCGTGGTGTGATGGCCAGATGG + Intergenic
986678866 5:10215495-10215517 TGCTCAGCGTGGTCCCCAGAGGG + Intergenic
988922254 5:35954235-35954257 TGCTGGGTGTGGTGGCCAGGTGG - Exonic
990954242 5:61328181-61328203 TGCTAGATGTGGTGCTCAGGTGG + Intergenic
992280873 5:75175744-75175766 TGGTTGGGGTGGAGCCAAGATGG + Intronic
994590204 5:101761925-101761947 TGCTTGGTCTGATACCCAGGAGG - Intergenic
997408922 5:133675413-133675435 GGCCTAGTGTGGTGGCCAGAAGG + Intergenic
999517623 5:152316889-152316911 GGCTTGCTGTGTTGCCCAGGTGG + Intergenic
1001450111 5:171818065-171818087 TTATTGGTGTAGTGGCCAGAAGG - Intergenic
1001758151 5:174186472-174186494 AGCTTCCTGTGGTGCCCAGAAGG + Intronic
1003172006 6:3727279-3727301 TGGTTCGTGTGGGGCCCTGAGGG - Intronic
1003501501 6:6706919-6706941 TCCTTGCTCTGTTGCCCAGATGG - Intergenic
1004402858 6:15304873-15304895 TGCTTGGTGAGGTGCAGGGAGGG + Intronic
1007221166 6:40280050-40280072 TGCTTGGTGGGGTGGGCAGCAGG - Intergenic
1007697734 6:43744382-43744404 TGCCTGGTGTGGTGCCCAGTTGG + Intergenic
1007933950 6:45716742-45716764 TGTTGGAGGTGGTGCCCAGAGGG - Intergenic
1010083830 6:71892579-71892601 TGCTTGCTGTTTTGCCCACAGGG + Intronic
1012373984 6:98538831-98538853 TGCTTGGAGTGGCACCCAGCGGG - Intergenic
1012868571 6:104646319-104646341 TGTTTGGTGTGTTGCCCAGGTGG - Intergenic
1014532588 6:122576602-122576624 TGCTTGCAGTGAAGCCCAGATGG + Intronic
1015346831 6:132170457-132170479 TGCCTGGTCTGGTTCCCTGATGG - Intergenic
1018602694 6:165562074-165562096 TTCTTGCTGTGTTGCACAGATGG - Intronic
1018766574 6:166938316-166938338 GGCTCGGTGTGGCGCTCAGAAGG + Intronic
1019268361 7:131773-131795 GGCTTGGTGAGCTGCCCACATGG - Intergenic
1020003274 7:4767798-4767820 TGCTACGTTTGGTGACCAGAGGG + Exonic
1022405541 7:30086458-30086480 TGCTTGGACTGCTGTCCAGAGGG + Intronic
1024118913 7:46217789-46217811 TGATAGCTGAGGTGCCCAGAGGG + Intergenic
1024656495 7:51455192-51455214 TGCGTGGAGTCGTGCCCAGCTGG + Intergenic
1025261984 7:57425850-57425872 GGCTCGGTGTGGGGGCCAGACGG - Intergenic
1026004552 7:66590877-66590899 TGTTGGGTGTGGAGCCTAGAAGG - Intergenic
1027117483 7:75492822-75492844 ATCTTGCTGTGTTGCCCAGACGG + Intergenic
1037509188 8:19564295-19564317 TGTTTTGTTTTGTGCCCAGAGGG - Intronic
1038106687 8:24442976-24442998 TGCTTGGTCTGTTGCTCAGAAGG + Intronic
1038336788 8:26652112-26652134 TGCCTGCTGGGGTGCCCAGTTGG + Intronic
1042394436 8:68276299-68276321 TTCTTGGGGTGGTCCCAAGATGG + Intergenic
1042877071 8:73449343-73449365 AGCCAGGTGTGCTGCCCAGAAGG - Intronic
1043039830 8:75249115-75249137 GGCATAGTGAGGTGCCCAGAAGG + Intergenic
1043301993 8:78744918-78744940 GGCTGGGTGTCGTGCCCAGGTGG + Intronic
1043530023 8:81139463-81139485 TGCTTTATGTGATGCCCTGAGGG - Intergenic
1044305714 8:90638327-90638349 TGCTTGTTGTACTCCCCAGAAGG - Intronic
1045186360 8:99842410-99842432 TTCTTGCTATGTTGCCCAGATGG - Intronic
1045476257 8:102555346-102555368 TGCTTGGTGTCCTGGCCACATGG - Intronic
1047773491 8:128049566-128049588 TGCCTTGTTTTGTGCCCAGAAGG + Intergenic
1049404635 8:142446945-142446967 AGCTGGGTGTGGTCCCCAGCAGG + Intergenic
1049526204 8:143127997-143128019 AGCTTGCTTTGCTGCCCAGAGGG + Intergenic
1049805371 8:144536406-144536428 TGCCTGGAGTGGAGCCCAGTGGG - Intronic
1050898850 9:10918959-10918981 TGGTTGGTCTGGTGAACAGATGG - Intergenic
1051263316 9:15287181-15287203 TGCTTGGAGGGGAGCCCAAAGGG + Intronic
1051681589 9:19612986-19613008 AGCTTGGTGACCTGCCCAGATGG - Intronic
1054333864 9:63785300-63785322 TGCTTTGTGCGGGGCCCTGAGGG - Intergenic
1060230377 9:121821328-121821350 TGCCTGGTGTGGTGCACTGTAGG - Intergenic
1060815464 9:126632837-126632859 TTCTGGGTGTGGGGCCCAGTGGG - Intronic
1061209842 9:129184746-129184768 GGCTTGGGGTGGGGCCTAGAGGG + Intergenic
1185525448 X:774884-774906 TGCTTGTTGAGGAGGCCAGAAGG + Intergenic
1185600724 X:1337061-1337083 TGTGTGGTGTGGTGCCCACACGG - Intronic
1186584035 X:10852338-10852360 TGTTTAGTGTTGTGCCCAGGAGG - Intergenic
1194112747 X:89854796-89854818 TCCTAGGTGTGGTGACCACAGGG + Intergenic
1197840260 X:130738813-130738835 TGCTTGCTGTGCTGCCCATGGGG - Intronic
1198172078 X:134117176-134117198 TGCTGGAGGTGGAGCCCAGATGG + Intergenic
1198315732 X:135464360-135464382 TTCTTGGTTTGGGGCCCAGGTGG + Intergenic
1198541258 X:137642395-137642417 TTCTTGGGCTGGTCCCCAGATGG - Intergenic
1199217820 X:145281723-145281745 TCCTAGGGGTGGTGACCAGAGGG - Intergenic
1200465400 Y:3509607-3509629 TCCTAGGTGTGGTGACCACAGGG + Intergenic
1200833581 Y:7711250-7711272 TTCTTGGGGTGGAGCCAAGATGG - Intergenic