ID: 900653247

View in Genome Browser
Species Human (GRCh38)
Location 1:3741720-3741742
Sequence CAGAGCACAGGTGGAGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900653247_900653253 -4 Left 900653247 1:3741720-3741742 CCATGGCCTCCACCTGTGCTCTG No data
Right 900653253 1:3741739-3741761 TCTGGAGAGCTCAGAGCAGGTGG No data
900653247_900653254 -3 Left 900653247 1:3741720-3741742 CCATGGCCTCCACCTGTGCTCTG No data
Right 900653254 1:3741740-3741762 CTGGAGAGCTCAGAGCAGGTGGG No data
900653247_900653259 25 Left 900653247 1:3741720-3741742 CCATGGCCTCCACCTGTGCTCTG No data
Right 900653259 1:3741768-3741790 GGTCCAACTGAGGTCTTACAGGG No data
900653247_900653256 15 Left 900653247 1:3741720-3741742 CCATGGCCTCCACCTGTGCTCTG No data
Right 900653256 1:3741758-3741780 GTGGGCACCTGGTCCAACTGAGG No data
900653247_900653252 -7 Left 900653247 1:3741720-3741742 CCATGGCCTCCACCTGTGCTCTG No data
Right 900653252 1:3741736-3741758 TGCTCTGGAGAGCTCAGAGCAGG No data
900653247_900653255 4 Left 900653247 1:3741720-3741742 CCATGGCCTCCACCTGTGCTCTG No data
Right 900653255 1:3741747-3741769 GCTCAGAGCAGGTGGGCACCTGG No data
900653247_900653258 24 Left 900653247 1:3741720-3741742 CCATGGCCTCCACCTGTGCTCTG No data
Right 900653258 1:3741767-3741789 TGGTCCAACTGAGGTCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900653247 Original CRISPR CAGAGCACAGGTGGAGGCCA TGG (reversed) Intergenic
No off target data available for this crispr