ID: 900653249

View in Genome Browser
Species Human (GRCh38)
Location 1:3741726-3741748
Sequence GCTCTCCAGAGCACAGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900653249_900653259 19 Left 900653249 1:3741726-3741748 CCTCCACCTGTGCTCTGGAGAGC No data
Right 900653259 1:3741768-3741790 GGTCCAACTGAGGTCTTACAGGG No data
900653249_900653254 -9 Left 900653249 1:3741726-3741748 CCTCCACCTGTGCTCTGGAGAGC No data
Right 900653254 1:3741740-3741762 CTGGAGAGCTCAGAGCAGGTGGG No data
900653249_900653253 -10 Left 900653249 1:3741726-3741748 CCTCCACCTGTGCTCTGGAGAGC No data
Right 900653253 1:3741739-3741761 TCTGGAGAGCTCAGAGCAGGTGG No data
900653249_900653258 18 Left 900653249 1:3741726-3741748 CCTCCACCTGTGCTCTGGAGAGC No data
Right 900653258 1:3741767-3741789 TGGTCCAACTGAGGTCTTACAGG No data
900653249_900653256 9 Left 900653249 1:3741726-3741748 CCTCCACCTGTGCTCTGGAGAGC No data
Right 900653256 1:3741758-3741780 GTGGGCACCTGGTCCAACTGAGG No data
900653249_900653255 -2 Left 900653249 1:3741726-3741748 CCTCCACCTGTGCTCTGGAGAGC No data
Right 900653255 1:3741747-3741769 GCTCAGAGCAGGTGGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900653249 Original CRISPR GCTCTCCAGAGCACAGGTGG AGG (reversed) Intergenic