ID: 900653250

View in Genome Browser
Species Human (GRCh38)
Location 1:3741729-3741751
Sequence TGAGCTCTCCAGAGCACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900653250_900653259 16 Left 900653250 1:3741729-3741751 CCACCTGTGCTCTGGAGAGCTCA No data
Right 900653259 1:3741768-3741790 GGTCCAACTGAGGTCTTACAGGG No data
900653250_900653261 29 Left 900653250 1:3741729-3741751 CCACCTGTGCTCTGGAGAGCTCA No data
Right 900653261 1:3741781-3741803 TCTTACAGGGAAGAGATTGCAGG No data
900653250_900653256 6 Left 900653250 1:3741729-3741751 CCACCTGTGCTCTGGAGAGCTCA No data
Right 900653256 1:3741758-3741780 GTGGGCACCTGGTCCAACTGAGG No data
900653250_900653258 15 Left 900653250 1:3741729-3741751 CCACCTGTGCTCTGGAGAGCTCA No data
Right 900653258 1:3741767-3741789 TGGTCCAACTGAGGTCTTACAGG No data
900653250_900653255 -5 Left 900653250 1:3741729-3741751 CCACCTGTGCTCTGGAGAGCTCA No data
Right 900653255 1:3741747-3741769 GCTCAGAGCAGGTGGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900653250 Original CRISPR TGAGCTCTCCAGAGCACAGG TGG (reversed) Intergenic