ID: 900653251

View in Genome Browser
Species Human (GRCh38)
Location 1:3741732-3741754
Sequence CTCTGAGCTCTCCAGAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900653251_900653258 12 Left 900653251 1:3741732-3741754 CCTGTGCTCTGGAGAGCTCAGAG No data
Right 900653258 1:3741767-3741789 TGGTCCAACTGAGGTCTTACAGG No data
900653251_900653261 26 Left 900653251 1:3741732-3741754 CCTGTGCTCTGGAGAGCTCAGAG No data
Right 900653261 1:3741781-3741803 TCTTACAGGGAAGAGATTGCAGG No data
900653251_900653259 13 Left 900653251 1:3741732-3741754 CCTGTGCTCTGGAGAGCTCAGAG No data
Right 900653259 1:3741768-3741790 GGTCCAACTGAGGTCTTACAGGG No data
900653251_900653256 3 Left 900653251 1:3741732-3741754 CCTGTGCTCTGGAGAGCTCAGAG No data
Right 900653256 1:3741758-3741780 GTGGGCACCTGGTCCAACTGAGG No data
900653251_900653255 -8 Left 900653251 1:3741732-3741754 CCTGTGCTCTGGAGAGCTCAGAG No data
Right 900653255 1:3741747-3741769 GCTCAGAGCAGGTGGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900653251 Original CRISPR CTCTGAGCTCTCCAGAGCAC AGG (reversed) Intergenic
No off target data available for this crispr