ID: 900653255

View in Genome Browser
Species Human (GRCh38)
Location 1:3741747-3741769
Sequence GCTCAGAGCAGGTGGGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900653250_900653255 -5 Left 900653250 1:3741729-3741751 CCACCTGTGCTCTGGAGAGCTCA No data
Right 900653255 1:3741747-3741769 GCTCAGAGCAGGTGGGCACCTGG No data
900653245_900653255 22 Left 900653245 1:3741702-3741724 CCGCGGGGTCTGCGGAGACCATG No data
Right 900653255 1:3741747-3741769 GCTCAGAGCAGGTGGGCACCTGG No data
900653249_900653255 -2 Left 900653249 1:3741726-3741748 CCTCCACCTGTGCTCTGGAGAGC No data
Right 900653255 1:3741747-3741769 GCTCAGAGCAGGTGGGCACCTGG No data
900653251_900653255 -8 Left 900653251 1:3741732-3741754 CCTGTGCTCTGGAGAGCTCAGAG No data
Right 900653255 1:3741747-3741769 GCTCAGAGCAGGTGGGCACCTGG No data
900653244_900653255 23 Left 900653244 1:3741701-3741723 CCCGCGGGGTCTGCGGAGACCAT No data
Right 900653255 1:3741747-3741769 GCTCAGAGCAGGTGGGCACCTGG No data
900653247_900653255 4 Left 900653247 1:3741720-3741742 CCATGGCCTCCACCTGTGCTCTG No data
Right 900653255 1:3741747-3741769 GCTCAGAGCAGGTGGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900653255 Original CRISPR GCTCAGAGCAGGTGGGCACC TGG Intergenic
No off target data available for this crispr