ID: 900653259

View in Genome Browser
Species Human (GRCh38)
Location 1:3741768-3741790
Sequence GGTCCAACTGAGGTCTTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900653250_900653259 16 Left 900653250 1:3741729-3741751 CCACCTGTGCTCTGGAGAGCTCA No data
Right 900653259 1:3741768-3741790 GGTCCAACTGAGGTCTTACAGGG No data
900653249_900653259 19 Left 900653249 1:3741726-3741748 CCTCCACCTGTGCTCTGGAGAGC No data
Right 900653259 1:3741768-3741790 GGTCCAACTGAGGTCTTACAGGG No data
900653251_900653259 13 Left 900653251 1:3741732-3741754 CCTGTGCTCTGGAGAGCTCAGAG No data
Right 900653259 1:3741768-3741790 GGTCCAACTGAGGTCTTACAGGG No data
900653247_900653259 25 Left 900653247 1:3741720-3741742 CCATGGCCTCCACCTGTGCTCTG No data
Right 900653259 1:3741768-3741790 GGTCCAACTGAGGTCTTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900653259 Original CRISPR GGTCCAACTGAGGTCTTACA GGG Intergenic
No off target data available for this crispr