ID: 900653261

View in Genome Browser
Species Human (GRCh38)
Location 1:3741781-3741803
Sequence TCTTACAGGGAAGAGATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900653250_900653261 29 Left 900653250 1:3741729-3741751 CCACCTGTGCTCTGGAGAGCTCA No data
Right 900653261 1:3741781-3741803 TCTTACAGGGAAGAGATTGCAGG No data
900653257_900653261 -7 Left 900653257 1:3741765-3741787 CCTGGTCCAACTGAGGTCTTACA No data
Right 900653261 1:3741781-3741803 TCTTACAGGGAAGAGATTGCAGG No data
900653251_900653261 26 Left 900653251 1:3741732-3741754 CCTGTGCTCTGGAGAGCTCAGAG No data
Right 900653261 1:3741781-3741803 TCTTACAGGGAAGAGATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900653261 Original CRISPR TCTTACAGGGAAGAGATTGC AGG Intergenic
No off target data available for this crispr