ID: 900653711

View in Genome Browser
Species Human (GRCh38)
Location 1:3744701-3744723
Sequence ACCTTTGGTGTGTCCAGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900653711_900653716 7 Left 900653711 1:3744701-3744723 CCAAACCTGGACACACCAAAGGT No data
Right 900653716 1:3744731-3744753 GCCTGACCTGTGAGCAGCACCGG No data
900653711_900653720 28 Left 900653711 1:3744701-3744723 CCAAACCTGGACACACCAAAGGT No data
Right 900653720 1:3744752-3744774 GGCCAGCTCTGCGAAACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900653711 Original CRISPR ACCTTTGGTGTGTCCAGGTT TGG (reversed) Intergenic