ID: 900653712

View in Genome Browser
Species Human (GRCh38)
Location 1:3744706-3744728
Sequence GGCTCACCTTTGGTGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900653712_900653716 2 Left 900653712 1:3744706-3744728 CCTGGACACACCAAAGGTGAGCC No data
Right 900653716 1:3744731-3744753 GCCTGACCTGTGAGCAGCACCGG No data
900653712_900653720 23 Left 900653712 1:3744706-3744728 CCTGGACACACCAAAGGTGAGCC No data
Right 900653720 1:3744752-3744774 GGCCAGCTCTGCGAAACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900653712 Original CRISPR GGCTCACCTTTGGTGTGTCC AGG (reversed) Intergenic
No off target data available for this crispr