ID: 900653714

View in Genome Browser
Species Human (GRCh38)
Location 1:3744716-3744738
Sequence GGTCAGGCCTGGCTCACCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900653714_900653720 13 Left 900653714 1:3744716-3744738 CCAAAGGTGAGCCAGGCCTGACC No data
Right 900653720 1:3744752-3744774 GGCCAGCTCTGCGAAACACCAGG No data
900653714_900653716 -8 Left 900653714 1:3744716-3744738 CCAAAGGTGAGCCAGGCCTGACC No data
Right 900653716 1:3744731-3744753 GCCTGACCTGTGAGCAGCACCGG No data
900653714_900653722 29 Left 900653714 1:3744716-3744738 CCAAAGGTGAGCCAGGCCTGACC No data
Right 900653722 1:3744768-3744790 CACCAGGCAGTGCCCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900653714 Original CRISPR GGTCAGGCCTGGCTCACCTT TGG (reversed) Intergenic