ID: 900653716

View in Genome Browser
Species Human (GRCh38)
Location 1:3744731-3744753
Sequence GCCTGACCTGTGAGCAGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900653714_900653716 -8 Left 900653714 1:3744716-3744738 CCAAAGGTGAGCCAGGCCTGACC No data
Right 900653716 1:3744731-3744753 GCCTGACCTGTGAGCAGCACCGG No data
900653711_900653716 7 Left 900653711 1:3744701-3744723 CCAAACCTGGACACACCAAAGGT No data
Right 900653716 1:3744731-3744753 GCCTGACCTGTGAGCAGCACCGG No data
900653712_900653716 2 Left 900653712 1:3744706-3744728 CCTGGACACACCAAAGGTGAGCC No data
Right 900653716 1:3744731-3744753 GCCTGACCTGTGAGCAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900653716 Original CRISPR GCCTGACCTGTGAGCAGCAC CGG Intergenic
No off target data available for this crispr