ID: 900653720

View in Genome Browser
Species Human (GRCh38)
Location 1:3744752-3744774
Sequence GGCCAGCTCTGCGAAACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900653712_900653720 23 Left 900653712 1:3744706-3744728 CCTGGACACACCAAAGGTGAGCC No data
Right 900653720 1:3744752-3744774 GGCCAGCTCTGCGAAACACCAGG No data
900653715_900653720 2 Left 900653715 1:3744727-3744749 CCAGGCCTGACCTGTGAGCAGCA No data
Right 900653720 1:3744752-3744774 GGCCAGCTCTGCGAAACACCAGG No data
900653711_900653720 28 Left 900653711 1:3744701-3744723 CCAAACCTGGACACACCAAAGGT No data
Right 900653720 1:3744752-3744774 GGCCAGCTCTGCGAAACACCAGG No data
900653714_900653720 13 Left 900653714 1:3744716-3744738 CCAAAGGTGAGCCAGGCCTGACC No data
Right 900653720 1:3744752-3744774 GGCCAGCTCTGCGAAACACCAGG No data
900653717_900653720 -3 Left 900653717 1:3744732-3744754 CCTGACCTGTGAGCAGCACCGGC No data
Right 900653720 1:3744752-3744774 GGCCAGCTCTGCGAAACACCAGG No data
900653718_900653720 -8 Left 900653718 1:3744737-3744759 CCTGTGAGCAGCACCGGCCAGCT No data
Right 900653720 1:3744752-3744774 GGCCAGCTCTGCGAAACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900653720 Original CRISPR GGCCAGCTCTGCGAAACACC AGG Intergenic
No off target data available for this crispr