ID: 900655256

View in Genome Browser
Species Human (GRCh38)
Location 1:3753772-3753794
Sequence CCACACATGCTGCTGGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900655256_900655269 21 Left 900655256 1:3753772-3753794 CCTGTGACCAGCAGCATGTGTGG 0: 1
1: 0
2: 3
3: 13
4: 187
Right 900655269 1:3753816-3753838 GTGAATCTCAGCCGACAGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 52
900655256_900655267 -9 Left 900655256 1:3753772-3753794 CCTGTGACCAGCAGCATGTGTGG 0: 1
1: 0
2: 3
3: 13
4: 187
Right 900655267 1:3753786-3753808 CATGTGTGGGTGGGGTCGGGGGG 0: 1
1: 0
2: 4
3: 72
4: 739
900655256_900655266 -10 Left 900655256 1:3753772-3753794 CCTGTGACCAGCAGCATGTGTGG 0: 1
1: 0
2: 3
3: 13
4: 187
Right 900655266 1:3753785-3753807 GCATGTGTGGGTGGGGTCGGGGG 0: 1
1: 0
2: 6
3: 68
4: 728

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900655256 Original CRISPR CCACACATGCTGCTGGTCAC AGG (reversed) Intronic
900373846 1:2344428-2344450 CCACACATGCTCCTGGTCGCTGG - Intronic
900494443 1:2970126-2970148 CCACAGCAGCTGCTGCTCACAGG - Intergenic
900655256 1:3753772-3753794 CCACACATGCTGCTGGTCACAGG - Intronic
901622140 1:10597263-10597285 CAGCACAGGCTGATGGTCACTGG - Intronic
906120750 1:43389098-43389120 CCACACATGCTTCTAAGCACTGG + Intronic
906945233 1:50289326-50289348 CCTCTCCTGCTGCTGATCACGGG + Intergenic
907483766 1:54762544-54762566 ACACAGATGCTGCTGGTCCAGGG + Intronic
911142703 1:94523348-94523370 ACACAAATGCTGCTGGTCTTGGG + Intergenic
913058062 1:115180120-115180142 CCACACTTCCTGGTGGTGACTGG + Intergenic
918787531 1:188782336-188782358 CCTCACATGTTGTTGGACACAGG + Intergenic
919317710 1:195996095-195996117 CTAGACATCTTGCTGGTCACAGG - Intergenic
920244054 1:204574871-204574893 CCACACCTGCTGCTGCTCCAGGG - Intergenic
923072122 1:230575419-230575441 ACATGGATGCTGCTGGTCACTGG - Intergenic
923221594 1:231899350-231899372 ACACAGATGCTGCTGGTCTGGGG + Intronic
1062834171 10:625000-625022 ACACACATGCTCCTGGGCCCTGG - Intronic
1065964542 10:30760583-30760605 ACACACATGAGGCTGGGCACAGG - Intergenic
1067408982 10:46048288-46048310 CCAGGCACCCTGCTGGTCACTGG - Intergenic
1067427961 10:46223615-46223637 CCACACAGGATGATGGTCAATGG + Intergenic
1070510029 10:77152620-77152642 CAACACCTCCTGTTGGTCACTGG + Intronic
1070769962 10:79076489-79076511 AGACACATGCTGCTGGGCAGGGG - Intronic
1071131632 10:82400486-82400508 ACACACATGCTGCTGATCCATGG + Intronic
1071262849 10:83936634-83936656 ACACAGATGATGCTGGTCCCAGG + Intergenic
1073109435 10:101052332-101052354 CCATAGATGCTGCCCGTCACAGG + Intergenic
1075210977 10:120490772-120490794 CCACCTGTGCTGCTGCTCACTGG + Intronic
1075655900 10:124161260-124161282 CAACACGTGCTGTTGGGCACGGG + Intergenic
1077560908 11:3260026-3260048 CCACCCTTGCTGCTGGTCCTCGG - Intergenic
1077566805 11:3305856-3305878 CCACCCTTGCTGCTGGTCCTCGG - Intergenic
1080397524 11:31903502-31903524 CCTCACCTGCTGCTGGGCACAGG - Intronic
1084422644 11:69068045-69068067 CCTCACATGCTGCTGCCCAGTGG - Intronic
1085063656 11:73472116-73472138 CCACACATACCCCTGGTCCCTGG + Intronic
1086478430 11:87205837-87205859 CCCAACATGCTACTGGTCAGAGG + Intronic
1087822378 11:102726978-102727000 CCTCACCTGCTTCTGGTCCCTGG + Intronic
1089492827 11:118894445-118894467 TCACACATGGTGATGGCCACGGG - Exonic
1089635454 11:119808796-119808818 CCACAGATACTCCTGGCCACAGG + Intergenic
1090239336 11:125171021-125171043 CCACAGAAGCAGCAGGTCACAGG + Intronic
1092131216 12:6114555-6114577 CCACACAGGCTGCGGGGCTCGGG + Intronic
1093633430 12:21436970-21436992 TCACACATGCTGCTATTGACTGG + Intergenic
1096485503 12:51978022-51978044 CCAGACATTCTGCTTGACACGGG + Intronic
1098391603 12:69975414-69975436 CCTCACATTCTGCTGCTCAATGG - Intergenic
1098547119 12:71723577-71723599 CCACCCATGCTGGTGTGCACTGG + Intergenic
1099932045 12:89086181-89086203 CCACCCATCCTGCTGGAAACTGG - Intergenic
1101061442 12:100976647-100976669 CAGCTAATGCTGCTGGTCACGGG + Intronic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1102537439 12:113591768-113591790 CCACACACGCTGCCGCTCGCCGG - Intergenic
1103764949 12:123272970-123272992 CCACCCATGTGGCTGGTCCCGGG + Intergenic
1105805125 13:23948014-23948036 CCACACATATTGCTGCTCCCTGG - Intergenic
1105925099 13:25000907-25000929 CCACACATTTTGCTGGACCCTGG + Intergenic
1106039505 13:26076146-26076168 CCACACATTTTGCTGGGCCCTGG - Intergenic
1115301159 14:31887030-31887052 CCACAGATGCTGCTGGTTTGGGG + Intergenic
1115918389 14:38343046-38343068 CCAGTCATGGTGCTGGCCACTGG + Intergenic
1117073293 14:52075440-52075462 CCACACAAGCGGCTGGACCCTGG + Intergenic
1121571439 14:94949589-94949611 CCCCAGCTGCTGGTGGTCACTGG + Intergenic
1121571984 14:94953078-94953100 CCCCAGCTGCTGGTGGTCACTGG + Intergenic
1125027539 15:35045623-35045645 CCACACATGCTCAAGGTCAGGGG - Intergenic
1131315777 15:91335808-91335830 CCATCCATGCTGCTGGTAAAGGG + Intergenic
1133463316 16:6006251-6006273 CCACAGATGTGGCTGGTCAGAGG + Intergenic
1136118138 16:28108738-28108760 CCACAGAGGCTGCTGAGCACTGG - Intronic
1139532630 16:67550170-67550192 CCCCACATCCAGCTGCTCACTGG + Intergenic
1144523508 17:15970190-15970212 CCACACATTCTGCTAGGCACTGG - Intronic
1144738863 17:17570124-17570146 CCAGGCATGGTGCTGGGCACAGG + Intronic
1148750364 17:49942033-49942055 CCCCACATGGTCCTGGGCACTGG + Intergenic
1149272813 17:55000032-55000054 CCAATCATGCTCCTGGACACAGG - Intronic
1149311547 17:55399097-55399119 CCACCCAGGCTGCTGTTCTCTGG + Intronic
1149508385 17:57215432-57215454 CCACCCACCCTGCTAGTCACTGG - Intergenic
1151433288 17:74079459-74079481 CCACTCATGTTCCTGGTCACGGG + Intergenic
1152033729 17:77859124-77859146 GCAGCCATGCTGCTGGCCACAGG + Intergenic
1152035944 17:77872898-77872920 CCACACCTGCTGCTGCACCCAGG + Intergenic
1152236247 17:79140432-79140454 CCACACATGCACCTGGAGACAGG - Intronic
1152526323 17:80890105-80890127 ACACACATCCTGCTGCGCACGGG - Intronic
1153308312 18:3652828-3652850 GAACACATGCTGCTTATCACTGG + Intronic
1153989782 18:10386019-10386041 CCAGACATTCTGCAGGTAACTGG + Intergenic
1154314692 18:13295356-13295378 CCACACATGCAGCTGATCAGCGG - Intronic
1157271259 18:46278069-46278091 CCACAGCTGCAGCTGGTCAGAGG - Intergenic
1157701623 18:49764488-49764510 GCACACATGCTGCAGGTGACGGG - Intergenic
1159952641 18:74496381-74496403 CCGCGCTTGCTGCTGGTAACAGG + Exonic
1160401162 18:78612456-78612478 CCACACCTGCTGCTGGCAAGAGG + Intergenic
1160908768 19:1465271-1465293 CCACAGCAGCTCCTGGTCACGGG - Exonic
1161013568 19:1971629-1971651 CCCCGCAGGCTGCAGGTCACGGG - Intronic
1163797686 19:19346767-19346789 CCAGAAATGCTGCTGATGACAGG - Intronic
1166566287 19:43767470-43767492 CCACATAGGGTGCTGGCCACAGG + Intronic
925720137 2:6819558-6819580 ACACACATGCTGGTGTTCATTGG + Intergenic
927245414 2:20953411-20953433 GCACACACGCTGCTGGGAACTGG - Intergenic
931066584 2:58594568-58594590 TCACTGATGCTGCTGGTCAGTGG + Intergenic
931410841 2:62029815-62029837 CCACACATTCTGCAAGGCACAGG - Intronic
931412443 2:62045877-62045899 CCAGGCATGGTGGTGGTCACTGG - Intronic
931829673 2:66037765-66037787 CCACAACTGCTGATGGTCAGTGG + Intergenic
932825184 2:74932685-74932707 AAACACATGCTGCTGGTCACCGG - Intergenic
936227154 2:110666215-110666237 CCATTCCTGCTGCTGGGCACAGG + Intronic
936911259 2:117596563-117596585 CCACAGATGCTGCACATCACAGG - Intergenic
937330266 2:121022260-121022282 CCAAACATGCTGCAGTGCACAGG + Intergenic
938487188 2:131723425-131723447 ACCCACCTGCAGCTGGTCACTGG + Intronic
940537887 2:154969443-154969465 CCCCACAGGCTGCTGGTGTCTGG - Intergenic
942118870 2:172756651-172756673 CCACACCTGGAGGTGGTCACAGG + Intronic
942802652 2:179893232-179893254 CATCACATTCTGTTGGTCACAGG + Intergenic
944260571 2:197671486-197671508 CCAAACATCGTGCTGGACACAGG + Intronic
944300386 2:198117618-198117640 CCACACATGTTGCAGGAAACAGG + Intronic
945316388 2:208375646-208375668 CCTCACAGGCTGCTGGGCTCTGG - Intronic
948013431 2:234668844-234668866 CCAAACATGCTGCTGGGGAATGG + Intergenic
1169422217 20:5469948-5469970 CCACTGGTGCTGATGGTCACTGG - Intergenic
1170052606 20:12163029-12163051 CCTCACATTCTGCTTGTCCCTGG - Intergenic
1170455996 20:16533298-16533320 CCACTGATGTTGCTGGTCTCTGG - Intronic
1170502557 20:16989650-16989672 GCACACATGCTGATGGCCAAGGG - Intergenic
1170552903 20:17492184-17492206 CCAGGCATGGTCCTGGTCACTGG - Intergenic
1172869913 20:38129601-38129623 CCACACTTGCTGGGGCTCACGGG - Exonic
1174396175 20:50248156-50248178 CCACAGATGCGGCTGGTCCTGGG - Intergenic
1177060455 21:16367543-16367565 CCATTCATGTTGCTGGTCATTGG + Intergenic
1178974316 21:37208587-37208609 CCACACATTCACCTGTTCACTGG + Intergenic
1179313920 21:40223939-40223961 CCCCACATGCTGTGGGTCCCTGG + Intronic
1179412464 21:41172719-41172741 ACACACTTGCTCCTGGTCACAGG - Intronic
1181273827 22:21676231-21676253 ACACACACACTGCTGATCACAGG - Intronic
1181864264 22:25842853-25842875 CCAAGCATGATGCTGGGCACTGG + Intronic
1182350326 22:29695703-29695725 CCACAGGTGCTGCTTCTCACTGG + Exonic
1184237178 22:43189048-43189070 CCTCACATTCTCCTGGTCAAAGG - Intergenic
1184524698 22:45014972-45014994 GCACACATGGTGATGGGCACTGG - Intergenic
1185233794 22:49699633-49699655 CCTCACATGTTGCTGGTCAGTGG + Intergenic
949097796 3:106661-106683 ACTCACATGCTGCTGGTTGCTGG - Intergenic
951268385 3:20597230-20597252 CCAGACAAGCTGCTGGGCTCTGG + Intergenic
953080016 3:39608283-39608305 CCACTCCTGCTGCTGGTACCAGG - Intergenic
953882728 3:46700048-46700070 TTCCTCATGCTGCTGGTCACAGG - Intergenic
954286870 3:49625486-49625508 ACACAAATGCTGGTGGTCAAGGG - Intronic
954971645 3:54656405-54656427 CAACAGAGGCTGCTGGTCTCTGG + Intronic
956259057 3:67317051-67317073 ACACTCAATCTGCTGGTCACTGG - Intergenic
957684804 3:83488356-83488378 TGACACCTGCTGCTGGTCCCTGG + Intergenic
961051822 3:123753026-123753048 CTACTGATGCTGCTGGTCCCTGG + Intronic
961565171 3:127758382-127758404 CCAGGCATGGTGCTGGGCACAGG - Intronic
964477272 3:157108419-157108441 CCAAACATTGTGCTAGTCACTGG + Intergenic
966169787 3:177066448-177066470 CCACACCTGCTGCAGCTCATGGG - Intronic
966820099 3:183917480-183917502 CCATACCTTCTGCTGGGCACAGG - Intergenic
968431338 4:560931-560953 CCACACATGCTGCTGCTGGAAGG - Intergenic
968869195 4:3232930-3232952 CCACACAAGCAGCTGAGCACAGG + Intronic
969993971 4:11292803-11292825 CCAAATATGGTGCTAGTCACTGG - Intergenic
971341035 4:25769312-25769334 TCAGACATGCTGCAGGTCACAGG + Intronic
972835140 4:42861656-42861678 CCACATATGCCGCAGATCACAGG - Intergenic
975891925 4:79039896-79039918 CCACACATGCTTTTAGTAACAGG + Intergenic
977919036 4:102623937-102623959 GCACACATGATGCTTGGCACCGG + Intergenic
981934786 4:150228021-150228043 CCAAGAATACTGCTGGTCACTGG - Intronic
985517552 5:354714-354736 TGCCACATGCTGCTGGTCACGGG - Intronic
985770587 5:1807790-1807812 ACACACACACTGTTGGTCACAGG + Intronic
987111181 5:14688492-14688514 CCAGACCTGCTGCTGGACACAGG - Intronic
992183851 5:74224794-74224816 CCCCACCAGCTGCTGGTTACTGG + Intergenic
996916653 5:128720315-128720337 CCACCCAAGCTGCTGGACAGAGG - Intronic
997639417 5:135438921-135438943 CCACACAGGCTGCAGAGCACAGG + Intergenic
999326232 5:150645379-150645401 CCACTGATGTTGCTGGTCACAGG + Intronic
999331390 5:150675917-150675939 TCACACATGCTGCTGGTTAGAGG - Intronic
999585804 5:153088360-153088382 CCACACATGGTGTTAGTCTCTGG + Intergenic
999809364 5:155113358-155113380 TCCCAAATGCTACTGGTCACAGG + Intergenic
1004268843 6:14175837-14175859 CAACACATGCAGCTGGCCTCTGG + Intergenic
1004536715 6:16510229-16510251 CCTGAGATGCTGCTGGTCCCAGG - Intronic
1004775228 6:18836723-18836745 CCACACATGCTGTTCATCATTGG - Intergenic
1004881018 6:20008588-20008610 CCACACATTCTTCTGGGAACTGG - Intergenic
1005812390 6:29527709-29527731 GCTCACAGGCTGCTGGGCACAGG - Intergenic
1010208136 6:73341395-73341417 CCTCAGATGATGCTGGTCAAGGG + Intergenic
1011157886 6:84354080-84354102 CCACTCATTCTGCTGCTCAATGG - Intergenic
1011752085 6:90463592-90463614 CCACACATCCTGTTCCTCACTGG - Intergenic
1013185123 6:107750826-107750848 CCACTGATGCTGCTGGTCCATGG + Intronic
1013591365 6:111621879-111621901 CTACTGATGCTGCTGGTCTCTGG + Intergenic
1017834273 6:158163018-158163040 CTTTACATGGTGCTGGTCACAGG - Intronic
1019455407 7:1124290-1124312 CCACACAGGCCGCTGGTCACTGG - Intronic
1019866045 7:3711567-3711589 CCAGAGATGCTGCTGGTACCAGG + Intronic
1022053441 7:26703065-26703087 CAGCCCATGCTGCTGGTCCCAGG + Intronic
1022500911 7:30881968-30881990 CCCCACCTGCTGCTGCTCGCAGG - Intronic
1024352821 7:48384513-48384535 CCTGACATGTTGGTGGTCACAGG + Intronic
1024397758 7:48888782-48888804 CCACAGCTGCTGCTGGGGACTGG + Intergenic
1029261920 7:99308569-99308591 ACACTGATGCTGCTGGTCCCGGG - Intergenic
1029533860 7:101144104-101144126 ACACACAAGCTGCTGATGACTGG - Intergenic
1030348874 7:108461241-108461263 CCTCACAGGCTGTTGGCCACAGG - Intergenic
1031565925 7:123296830-123296852 CCTGACATGGTGGTGGTCACAGG + Intergenic
1033431513 7:141293797-141293819 CCAGGCATGGTGCTGGTTACAGG - Intronic
1033434573 7:141321414-141321436 CCACACACTGTGCTGGTCACTGG + Intronic
1036908753 8:12733122-12733144 TGACAGATGCTGCTGGTCAGGGG + Intronic
1038435733 8:27534773-27534795 CCACAGATGCTGCTGAGAACAGG + Intronic
1038795143 8:30703131-30703153 CCACACATCCTGATCGCCACAGG - Exonic
1039475753 8:37838655-37838677 GCAGGCCTGCTGCTGGTCACAGG + Intronic
1039956213 8:42208930-42208952 CCACAGCTGCTGCTGCTCATGGG - Intergenic
1042588059 8:70364633-70364655 CCACAGATGATTATGGTCACAGG + Intronic
1044828859 8:96225467-96225489 CCAAACACTCTGCTGCTCACAGG + Intergenic
1046070466 8:109246922-109246944 CAACACAGGCTATTGGTCACAGG + Intronic
1046617555 8:116494298-116494320 CCACACACACTTCTGGGCACAGG - Intergenic
1046759009 8:118001306-118001328 CCTCTCATGCAGCTGGTTACAGG + Intronic
1046796649 8:118380773-118380795 CAACACAAGCTGCTGCTAACTGG - Intronic
1047636835 8:126772947-126772969 TCACTGATGTTGCTGGTCACTGG + Intergenic
1048971824 8:139649466-139649488 GCACACATGCTGCCCCTCACTGG + Intronic
1050296305 9:4208822-4208844 GCACACAAGGTGTTGGTCACTGG - Intronic
1051438964 9:17062618-17062640 CCTCAAATGCTGCTGGTGTCTGG + Intergenic
1053354362 9:37433670-37433692 CCACTGATGCTGCTGGTCCAGGG + Intronic
1056602074 9:88054259-88054281 CCACACGTGCTTCTGGGAACTGG + Intergenic
1059103932 9:111495196-111495218 CTATATATGCTGATGGTCACTGG + Intergenic
1059281117 9:113135064-113135086 GCACTGATGCTGCTGGTCCCTGG - Intergenic
1059451314 9:114372933-114372955 CCACACCTGCTGCCTGGCACAGG - Intronic
1060483937 9:124035403-124035425 GCACACATGCAGATGCTCACAGG + Intergenic
1061310943 9:129762078-129762100 CCACAAATGCTGCTTCCCACGGG + Intergenic
1061395791 9:130342723-130342745 CCCCAGATGCTGATGGGCACAGG - Intronic
1061791620 9:133062032-133062054 CCTCACCTGCTGCTGGGCAGTGG + Exonic
1061795294 9:133082590-133082612 CCTCACCTGCTGCTGGGCAGTGG + Intronic
1062035855 9:134382225-134382247 CCCCACATGCGGCCGGCCACAGG - Intronic
1062533765 9:137012790-137012812 CCCCAGATGCGGGTGGTCACAGG - Exonic
1190124369 X:47690340-47690362 TGCCACATGCTGCTGGCCACTGG + Intergenic
1190595537 X:52049957-52049979 CCAAACATTCTGATGGACACAGG + Intergenic
1190613287 X:52204116-52204138 CCAAACATTCTGATGGACACAGG - Intergenic
1191703109 X:64064281-64064303 CCACTCCTGCTGGTGTTCACTGG + Intergenic
1194493193 X:94577157-94577179 ACACAGTTGCTGCTGGGCACTGG - Intergenic
1195697378 X:107676935-107676957 CGACATGTGCTGCCGGTCACAGG + Intergenic
1199983353 X:152933240-152933262 CCTCACATGGTGCTGGTCTTGGG + Intronic
1200835756 Y:7729645-7729667 CCACACATGTTCCTAGTCCCTGG + Intergenic