ID: 900655305

View in Genome Browser
Species Human (GRCh38)
Location 1:3753956-3753978
Sequence CCCACACCCAGGACACCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900655305_900655312 18 Left 900655305 1:3753956-3753978 CCACACGGTGTCCTGGGTGTGGG 0: 1
1: 1
2: 1
3: 25
4: 203
Right 900655312 1:3753997-3754019 CTCATAGGCACCTGCCATTGGGG 0: 2
1: 0
2: 0
3: 10
4: 83
900655305_900655310 16 Left 900655305 1:3753956-3753978 CCACACGGTGTCCTGGGTGTGGG 0: 1
1: 1
2: 1
3: 25
4: 203
Right 900655310 1:3753995-3754017 GACTCATAGGCACCTGCCATTGG 0: 1
1: 0
2: 1
3: 9
4: 102
900655305_900655311 17 Left 900655305 1:3753956-3753978 CCACACGGTGTCCTGGGTGTGGG 0: 1
1: 1
2: 1
3: 25
4: 203
Right 900655311 1:3753996-3754018 ACTCATAGGCACCTGCCATTGGG 0: 1
1: 1
2: 0
3: 2
4: 98
900655305_900655309 3 Left 900655305 1:3753956-3753978 CCACACGGTGTCCTGGGTGTGGG 0: 1
1: 1
2: 1
3: 25
4: 203
Right 900655309 1:3753982-3754004 TGCATCTACATACGACTCATAGG 0: 1
1: 0
2: 2
3: 6
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900655305 Original CRISPR CCCACACCCAGGACACCGTG TGG (reversed) Intronic
900119448 1:1042254-1042276 CCCACTCCCAGGACCCCAAGAGG - Intronic
900251221 1:1671037-1671059 CCCACAGCGAGGACAGCGCGTGG - Intronic
900655305 1:3753956-3753978 CCCACACCCAGGACACCGTGTGG - Intronic
900655550 1:3755026-3755048 CCCACGCCCAGGACACCGTGTGG - Intronic
901089114 1:6629683-6629705 CCCACACCCAGGACGCTGCCTGG + Intronic
901641997 1:10697345-10697367 CCCAAAGCCAGGCCACAGTGAGG + Intronic
902080993 1:13820649-13820671 CCCACTCCCAGGACCCCAGGAGG - Intronic
902290055 1:15429515-15429537 CCCCCAGCCAGAACACCCTGAGG + Exonic
903287922 1:22288482-22288504 CCCATTCTAAGGACACCGTGAGG + Intergenic
903551437 1:24159684-24159706 CACACAGCCAGGACAGAGTGGGG + Intronic
904426350 1:30425885-30425907 CCCACACACAGTACACTCTGGGG - Intergenic
904800362 1:33088265-33088287 CCCACACCCAGCAGACTGAGGGG - Intronic
906548688 1:46642221-46642243 CACAAACCTAGGACACAGTGAGG - Intronic
907325961 1:53638731-53638753 CCCACACCCAGAACAAGGAGTGG + Intronic
907940507 1:59082899-59082921 CCCACACCCAGCACAGGGTCTGG + Intergenic
915565970 1:156712905-156712927 GACACACCCAGGACACCATATGG - Intergenic
917119940 1:171636582-171636604 CCTACACCCAGGAGACCACGTGG - Exonic
920246709 1:204593308-204593330 CACAAACCCAGAACACCGTTGGG - Intergenic
1062849785 10:735440-735462 TCCAGACCCAGGACAGAGTGAGG + Intergenic
1062850426 10:738153-738175 CCCAGACCCGGGACAGAGTGAGG + Intergenic
1065963189 10:30750727-30750749 CACACCCCCAGGACCCTGTGAGG - Intergenic
1067045603 10:42983559-42983581 CCCACTCCCAGGGCTCAGTGAGG + Intergenic
1067686651 10:48469832-48469854 CCCAACCCTAGGACACCCTGAGG + Intronic
1068192679 10:53672491-53672513 CCCATACCCAGGACACTATGAGG + Intergenic
1069706647 10:70462876-70462898 GCCACACCCAGGAGCCCCTGTGG + Intergenic
1071297427 10:84232454-84232476 TCCACACCAAGGACACGCTGTGG + Exonic
1071447477 10:85762179-85762201 TGCACACCCAGGAGACAGTGGGG - Intronic
1071932456 10:90487726-90487748 CCCACACCCATGTCACAGTCTGG + Intergenic
1073428317 10:103469831-103469853 TCCACATACAGGACACGGTGAGG + Intergenic
1073444626 10:103573367-103573389 CCCACAACTAGTACAGCGTGAGG - Intronic
1073589578 10:104743669-104743691 CCCACTCTCAGGACAGCCTGTGG + Intronic
1075121704 10:119669369-119669391 CCCAAACACAGGACACAGTTTGG - Intronic
1075444915 10:122506433-122506455 CACACACCAAGGAAACCGTGGGG - Intronic
1077364757 11:2157071-2157093 CACCCACCCAGGACACACTGCGG - Intronic
1077378858 11:2218578-2218600 CCCACACCCATGACCTCGTTAGG - Intergenic
1077411536 11:2406126-2406148 CCCACACGCAGAGCACCGCGTGG - Intronic
1080040479 11:27754483-27754505 CCCACACCCACTTCACCCTGTGG + Intergenic
1083612194 11:64009642-64009664 CCCCCACCCACCACACCCTGGGG - Intronic
1083620077 11:64044888-64044910 CCCAGGCCCAGCACACAGTGGGG - Intronic
1083726352 11:64630556-64630578 CCCAGGACCAGGGCACCGTGGGG - Exonic
1083898427 11:65632014-65632036 CCCAGTCCCAGGTCACCGAGAGG + Intronic
1084593527 11:70104175-70104197 CCCACACACAGGACCCTTTGGGG - Intronic
1085729328 11:78982951-78982973 CTCAGACCCAGGCCACTGTGTGG - Intronic
1087078185 11:94144753-94144775 CCAACACCTATGACACCCTGAGG - Intronic
1089392228 11:118110036-118110058 CCAATACCCAGGACAGCCTGTGG + Intronic
1090313630 11:125765473-125765495 CCCACAACCAGGATTCAGTGAGG - Intergenic
1090704265 11:129322290-129322312 CCCACATTCAGGACACCATGAGG + Intergenic
1091356566 11:134942103-134942125 CCCACCCCCAGGCCCCAGTGTGG - Intergenic
1091792599 12:3280428-3280450 ACCACACCGAGAACAACGTGGGG + Exonic
1091840871 12:3619670-3619692 CCCTCATCCAGCACACCTTGGGG - Intronic
1092152787 12:6262541-6262563 CCCACCCCCAGGACACCCAGCGG + Intergenic
1093175748 12:15911489-15911511 CCCACAGCCAGGGCACTGGGCGG - Intronic
1094491307 12:30962700-30962722 ACCACGCCCAGGACTCCTTGAGG + Intronic
1095537801 12:43272650-43272672 CCCACATCAAGGACACTCTGAGG + Intergenic
1099729689 12:86484616-86484638 CCCACACTCAGAACACTGAGAGG + Intronic
1102042881 12:109811856-109811878 CACACACACAGGCCACCGAGAGG + Intronic
1103708509 12:122894535-122894557 CTCTCACCCAGGAGCCCGTGTGG - Intronic
1104941927 12:132399297-132399319 CCCAGCCCCCGGACCCCGTGAGG + Intergenic
1105756346 13:23467458-23467480 CCCTCACTCAGGACACCCTTGGG - Intergenic
1110033906 13:70654534-70654556 CCCACATCCAGGACACACTGAGG - Intergenic
1112781058 13:102901931-102901953 CCCACAACCAGGGCACAGTGAGG + Intergenic
1113200343 13:107860472-107860494 CCCAGACCCATGACACCGGCAGG + Intronic
1114082226 14:19211061-19211083 CCCCCAGTCAGGACCCCGTGTGG - Intergenic
1118714385 14:68548779-68548801 CCCCCACCCAGGGCACACTGGGG + Intronic
1119217112 14:72877372-72877394 CACACACCCAGGACAATGTTGGG + Intronic
1119810294 14:77512231-77512253 CCCTCACCCAGGACAGCCTGTGG - Exonic
1121916163 14:97838531-97838553 CCCACCCCCAGGCCCCCGGGAGG + Intergenic
1121945723 14:98119809-98119831 GCCACAGCCAGCCCACCGTGAGG + Intergenic
1122906783 14:104805288-104805310 CCCAGGCCCAGGACAGGGTGGGG + Intergenic
1127587173 15:60389533-60389555 CCCACAGCCACAACACCTTGAGG + Intronic
1128894414 15:71359173-71359195 TACACACCCAGGACAGTGTGAGG + Intronic
1129332698 15:74835892-74835914 CCCACACCCAGGCGACCGGTGGG - Intergenic
1131111651 15:89768210-89768232 CCCCTACTCAGGACACCCTGAGG + Intronic
1132208401 15:100002479-100002501 GCCACATCCAGGACACACTGGGG + Intronic
1132514342 16:359339-359361 CCCAGCCCCTGGACACCCTGGGG - Intergenic
1132618447 16:853375-853397 CCCCCACCCAGGACGCTGTGAGG - Intergenic
1132860792 16:2070791-2070813 CCCCAACCCATGTCACCGTGCGG - Intronic
1132937018 16:2486332-2486354 CCCACTCCCAGGAAATGGTGAGG + Intronic
1136266353 16:29121707-29121729 CGCACATCCAGGACACAGGGCGG + Intergenic
1136266366 16:29121759-29121781 CGCACATCCAGGACACAGGGCGG + Intergenic
1136409342 16:30067100-30067122 CCCACACCCAGCAGGCCCTGGGG - Intronic
1136648978 16:31649115-31649137 TGCACACTCAGGACAACGTGTGG - Intergenic
1143036808 17:4004168-4004190 TCCACACACAGGGCGCCGTGGGG - Intergenic
1143362446 17:6382927-6382949 CCCACCACCAGGCCTCCGTGTGG + Intergenic
1144075962 17:11719499-11719521 CCCACCCCCAGGAAGCCGGGTGG - Intronic
1144850644 17:18242312-18242334 CCCTCCCCCAGGGCACCGTGGGG - Intronic
1145005426 17:19334642-19334664 TCCACACCCAGGACTGCCTGGGG - Exonic
1146944353 17:36863873-36863895 GGCACTCCCACGACACCGTGTGG + Intergenic
1147210722 17:38871032-38871054 CTCAGAGCCAGGAGACCGTGTGG + Intronic
1149491666 17:57089375-57089397 CCCACACCCAGGACAAATTTAGG - Intronic
1150334509 17:64320717-64320739 CCAACACCCAGCACAGCGTCAGG + Exonic
1150538437 17:66070978-66071000 ACCATACCCAGGACAATGTGTGG + Intronic
1151195183 17:72426149-72426171 CCCACAGCCATGGCACCATGGGG - Intergenic
1152261881 17:79271809-79271831 CCTACTCCCAGGACACCATGAGG + Intronic
1152535967 17:80950556-80950578 TCCACACCCCGCACTCCGTGGGG + Intronic
1152631546 17:81412892-81412914 CCCACACCCACGACAGCCGGAGG - Intronic
1152750525 17:82060506-82060528 CCTCCACCAAGGACACCGAGGGG + Intronic
1153774102 18:8437646-8437668 GCCAAACCCAGGCCAGCGTGAGG - Intergenic
1155522562 18:26683813-26683835 CACACACCCATGACACCCTGAGG - Intergenic
1155636589 18:27963371-27963393 CCCACACCCTGGAGACATTGGGG - Exonic
1156416379 18:36895868-36895890 GCCTCACACAGGACAACGTGGGG - Intronic
1159935496 18:74363574-74363596 TCCACCCGCAGGACACCATGGGG + Intergenic
1160042894 18:75361315-75361337 CCCACACTCAGGACACCATCAGG - Intergenic
1162101673 19:8342879-8342901 CCCACACCCAGCCCAGCGCGAGG + Intronic
1162112143 19:8405033-8405055 CCCACACCCTGAAGACCCTGGGG + Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1166396442 19:42444679-42444701 TCCACACCCAGGCCACCGCAGGG + Intergenic
924970486 2:122402-122424 CCCACACCTAGAACACTGTGTGG + Intergenic
925084405 2:1096551-1096573 TCCACATGCAGGAGACCGTGTGG + Intronic
925087206 2:1117533-1117555 GCCACACACAGGACTCCGTGAGG - Intronic
925169240 2:1740770-1740792 CCAACACCCAGCACACGGCGTGG + Intronic
927151601 2:20199478-20199500 CCCACACCCAGGCCAGACTGTGG + Intergenic
928100889 2:28436897-28436919 CCCACCCTCGGGGCACCGTGTGG - Intergenic
929822416 2:45284119-45284141 CACACACCCAGGACAGAGTTTGG - Intergenic
933759690 2:85665121-85665143 CCCCCACCCAGGGGACCCTGGGG - Intronic
934710277 2:96509744-96509766 CCCACCCCCAAGGCCCCGTGGGG - Intergenic
935071415 2:99697328-99697350 CCCACACCCAGGACAGTGATGGG - Intronic
935592680 2:104856044-104856066 CCCACACCAGGGCCACCCTGGGG + Exonic
937152621 2:119696369-119696391 CCCACACCGTGGTCACCATGAGG - Intergenic
937224529 2:120360531-120360553 CCCACAGCTAGGACAGGGTGGGG - Intergenic
938119250 2:128622335-128622357 ACCTCACACAGGACACTGTGGGG + Intergenic
938385728 2:130865590-130865612 CACACACTCAGGACCCCCTGCGG + Intronic
938678049 2:133658499-133658521 CCCACTCCCAGGACAGCAGGGGG - Intergenic
940913262 2:159227738-159227760 CCCACACCTGGAACACCGTGGGG - Intronic
942766211 2:179460309-179460331 CCTACACCCAGGACTGAGTGAGG - Intronic
945328732 2:208514972-208514994 CCCACATCCAGGGCACTCTGAGG + Intronic
948437349 2:237962494-237962516 CCCTCAGCCAGCACACCTTGAGG - Intergenic
948588444 2:239035486-239035508 CCCACACCCAGGCCCCGCTGGGG - Intergenic
948980664 2:241492874-241492896 CCAGCACCCAGGACCCCTTGTGG - Exonic
948988530 2:241540424-241540446 CCCAAACCAGGGACACCCTGGGG + Intergenic
1170575045 20:17656054-17656076 GCCACTCCCCAGACACCGTGAGG - Intronic
1172149480 20:32780064-32780086 CCAGCACCCAGGACAGAGTGGGG - Intronic
1172846835 20:37934683-37934705 CCCAAACCGAGGTCACCATGTGG + Intronic
1173014379 20:39211545-39211567 CACACACCCAGGACTTGGTGTGG + Intergenic
1173498506 20:43535790-43535812 CCCACCCCCAGGACTCCATGAGG + Intronic
1175487541 20:59356277-59356299 CCCACCCCCAGGACACCACGTGG - Intergenic
1178114904 21:29407157-29407179 CCCCCACCCAGGACTCCTCGGGG - Intronic
1178301890 21:31460015-31460037 CCCACACCCAGATTACAGTGTGG + Intronic
1179556860 21:42184549-42184571 CGCACACCAATGACACTGTGAGG - Intergenic
1179584240 21:42364911-42364933 CCCACCCCCGGGACACTGTGGGG + Intronic
1179923964 21:44522381-44522403 CCCACCTCCAGGACACGGGGAGG - Intronic
1180007053 21:45027665-45027687 CCCACACCCAGGAGGGCATGTGG + Intergenic
1180498549 22:15911609-15911631 CCCCCAGTCAGGACCCCGTGTGG + Intergenic
1181486801 22:23236679-23236701 CCCACACCCAGGCCAACGTCAGG - Intronic
1182008263 22:26979398-26979420 ACCACATCCAGGAAACCGGGAGG + Intergenic
1183370030 22:37427126-37427148 CCCAGACCCAGGAGACACTGGGG + Intronic
1184968320 22:47997254-47997276 CCCACACCCAGGACACTCACAGG + Intergenic
1185163683 22:49244689-49244711 GCCACACCCAGGACACTGAGGGG + Intergenic
1185270425 22:49927031-49927053 TCCACACCCACGGCAGCGTGGGG + Intronic
1185377067 22:50487564-50487586 CCCACCCCCATCACACCCTGTGG + Intronic
949581553 3:5393402-5393424 CCCACATCCTGGGCACTGTGTGG + Intergenic
950124068 3:10500916-10500938 CCCTCACCAAGGACACTGGGGGG + Intronic
953263909 3:41367469-41367491 CCCACCCACAGGACACCTTGGGG + Intronic
953377999 3:42444907-42444929 TCCACATCCAGGACACGCTGAGG - Intergenic
953564195 3:44017005-44017027 CCCACATCCTGGCCACCATGAGG - Intergenic
953880288 3:46687797-46687819 CCCAGAGCCAGGCCACTGTGTGG - Intronic
961580711 3:127879683-127879705 CCCTCACCAAGGACTCAGTGTGG - Intergenic
962756665 3:138470067-138470089 CCCACAACAAGGACCCTGTGTGG + Exonic
964392316 3:156210736-156210758 CCCACTCCCAGGGAACCCTGTGG - Intronic
965730330 3:171764661-171764683 CTCACACTCAGGACACTGTTGGG + Intronic
966095500 3:176196445-176196467 CCCACACCCAGGTCATTGTCTGG + Intergenic
967875756 3:194267561-194267583 CCCACTGCCAGGAGACTGTGAGG + Intergenic
968229636 3:196997657-196997679 CCCAAGCCCTGGACACCTTGGGG + Intronic
970345998 4:15152690-15152712 CTCACACCCAGGACATCATTTGG + Intergenic
971502725 4:27333945-27333967 TCCAGACACAGGACACAGTGTGG + Intergenic
974540382 4:63225917-63225939 CCCACATCCAGGGCACACTGGGG - Intergenic
975024500 4:69531918-69531940 CCCACACCCATGGCCTCGTGGGG + Intergenic
978255171 4:106684488-106684510 CCCAAACCCATGACCCCATGAGG - Intergenic
981993318 4:150950802-150950824 CTCACACCCAGGTCACAGAGAGG + Intronic
985515735 5:343776-343798 CCCACACCCGCGACCCCGCGAGG - Intronic
985546795 5:514001-514023 CCCACACCCAGCACACAGTGGGG - Intronic
985791017 5:1926776-1926798 GCCACACCCAGAACGCCCTGAGG - Intergenic
986306981 5:6523250-6523272 CCCCCACCCGGGCCAGCGTGAGG - Intergenic
992625709 5:78634295-78634317 CCAACACCAATGCCACCGTGAGG + Intronic
997159695 5:131594725-131594747 CTCACATCCAGGGCACCCTGAGG - Intronic
998227855 5:140340798-140340820 CCAACACCCAGTACAGCTTGAGG + Intronic
998406240 5:141876289-141876311 CCCGCACCCAGGCCACCGCGGGG + Intronic
999122924 5:149223757-149223779 CCCACACTCAGGCCAGGGTGGGG + Intronic
1001166534 5:169374110-169374132 CCCACCCCAAGGACCCCGTGAGG - Intergenic
1003561570 6:7185020-7185042 CCCACACCCATGCCCCCATGGGG + Intronic
1003700801 6:8462690-8462712 CCCACTCCCAGAACACTGAGAGG - Intergenic
1007637162 6:43306462-43306484 CCCACAGCCAGGGCACAGCGAGG + Exonic
1007764084 6:44150782-44150804 TACACACCCAAGACACCTTGTGG - Intronic
1010087531 6:71938193-71938215 CCCACATCCAGGTCACACTGAGG + Intronic
1012761558 6:103309391-103309413 CCCAGAGCCAGGAGACTGTGGGG + Intergenic
1013599232 6:111688849-111688871 CCCTCACCCCGGACACAGCGGGG - Intronic
1015914958 6:138206688-138206710 CTCACACCCAGCACACCTGGGGG - Intronic
1017002011 6:150003692-150003714 CCGATCCCCAGGACACCATGTGG + Intergenic
1018868952 6:167767027-167767049 CCCTCACCCAGGACAGTGTGTGG - Intergenic
1019512906 7:1426915-1426937 CTCAGACCCAGGAAATCGTGTGG + Intergenic
1020125144 7:5529441-5529463 CCCCCACCCCGGAAACCGGGAGG + Intronic
1024974490 7:55100681-55100703 CCCACCCCAAGGACGGCGTGTGG - Intronic
1026184321 7:68070313-68070335 CCAACACCCAGAACAGCATGTGG - Intergenic
1029170903 7:98628391-98628413 CCATTCCCCAGGACACCGTGGGG + Exonic
1029544519 7:101203199-101203221 CCCACGACCAGGACCCTGTGAGG + Intergenic
1029620079 7:101684862-101684884 CCCACACCAAGGGGACGGTGGGG - Intergenic
1035072840 7:156157550-156157572 ACCTCCCCCAGGACACCCTGTGG - Intergenic
1035275638 7:157746410-157746432 TCCACACTCAGGGCTCCGTGTGG - Intronic
1035395822 7:158534157-158534179 CCCACACCCCGGGCTCCGTCAGG + Intronic
1040306389 8:46214076-46214098 CACCCACCCACGACACCCTGCGG - Intergenic
1040311288 8:46238137-46238159 AGCCCACCCAGGACACCCTGGGG - Intergenic
1040342183 8:46446664-46446686 CACCCACCCACGACACCCTGGGG + Intergenic
1040610283 8:48976915-48976937 CCCACACCGGGGACCCCCTGAGG - Intergenic
1041209121 8:55529625-55529647 CCCACAGCTAGGAAACAGTGGGG + Exonic
1042229278 8:66540482-66540504 CCCACCCCCGGTACCCCGTGTGG - Intergenic
1042518547 8:69684995-69685017 CACAGACCCAGGTCACCCTGGGG + Intronic
1045354858 8:101376580-101376602 CCAACACTCAGGCCACAGTGTGG - Intergenic
1047421202 8:124709776-124709798 CCCACACACACCACACCCTGTGG + Intronic
1047628597 8:126681617-126681639 CCCATACCCAGGAAATGGTGGGG + Intergenic
1048272960 8:133044027-133044049 CCCCTCCCAAGGACACCGTGAGG - Intronic
1049441557 8:142612021-142612043 CCCAGACCCCAGACACCCTGCGG - Intronic
1049619161 8:143590040-143590062 CCTGCACCCTGGAGACCGTGTGG - Exonic
1049709478 8:144057191-144057213 CCCACACCCAGGCCCACCTGTGG + Exonic
1050648283 9:7746027-7746049 CCCACCCCCAGGACCCATTGGGG - Intergenic
1050696761 9:8287989-8288011 CCCACACCTATGAAACCTTGAGG - Intergenic
1051194307 9:14546825-14546847 CCCACATCCAGGCCACACTGGGG + Intergenic
1052990133 9:34514223-34514245 CCCACCCTCAGCACACCCTGGGG - Intronic
1056527212 9:87454710-87454732 CCCACATCCAGGGCACACTGAGG + Intergenic
1057303936 9:93901822-93901844 CCCACCCCCAGGGCACACTGGGG - Intergenic
1059363643 9:113768148-113768170 ACCAGCCCTAGGACACCGTGGGG + Intergenic
1061160902 9:128893149-128893171 CCCAGGCTCAGGACCCCGTGTGG - Intronic
1062041985 9:134408442-134408464 CCCACTCCCAGGGCTCCGCGAGG + Intronic
1062204964 9:135331250-135331272 GCCACACCTAGGACACCGTCAGG + Intergenic
1062267495 9:135693978-135694000 CCCAGACCCAGGACACCTGTTGG + Intronic
1062295831 9:135826007-135826029 CCTGCAGCCTGGACACCGTGGGG + Intronic
1062344023 9:136106647-136106669 CCCAGCCCCAGGAACCCGTGGGG + Intergenic
1062577888 9:137217043-137217065 CCAGCACCCAGGGCACCGGGAGG - Intergenic
1062577903 9:137217094-137217116 CCAGCACCCAGGGCACCGGGAGG - Intergenic
1062577919 9:137217145-137217167 CCAGCACCCAGGGCACCGGGAGG - Intergenic
1192195839 X:69027556-69027578 CACACACTCAGGGCAACGTGAGG + Intergenic
1196278617 X:113797100-113797122 CCCACATCCAGGTCACGCTGAGG - Intergenic