ID: 900655525

View in Genome Browser
Species Human (GRCh38)
Location 1:3754945-3754967
Sequence CCGTGGAGACCCTCTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900655525_900655537 15 Left 900655525 1:3754945-3754967 CCTCAGCAAGAGGGTCTCCACGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 900655537 1:3754983-3755005 GACCAGGCATTTTTGTGGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 147
900655525_900655541 24 Left 900655525 1:3754945-3754967 CCTCAGCAAGAGGGTCTCCACGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 900655541 1:3754992-3755014 TTTTTGTGGGCAGGTCTCTGGGG 0: 1
1: 1
2: 1
3: 27
4: 321
900655525_900655532 -1 Left 900655525 1:3754945-3754967 CCTCAGCAAGAGGGTCTCCACGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 900655532 1:3754967-3754989 GTGGCCAGGGCTCCAGGACCAGG 0: 1
1: 0
2: 8
3: 45
4: 443
900655525_900655540 23 Left 900655525 1:3754945-3754967 CCTCAGCAAGAGGGTCTCCACGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 900655540 1:3754991-3755013 ATTTTTGTGGGCAGGTCTCTGGG 0: 1
1: 0
2: 2
3: 13
4: 214
900655525_900655539 22 Left 900655525 1:3754945-3754967 CCTCAGCAAGAGGGTCTCCACGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 900655539 1:3754990-3755012 CATTTTTGTGGGCAGGTCTCTGG 0: 1
1: 0
2: 0
3: 17
4: 202
900655525_900655534 10 Left 900655525 1:3754945-3754967 CCTCAGCAAGAGGGTCTCCACGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 900655534 1:3754978-3755000 TCCAGGACCAGGCATTTTTGTGG 0: 1
1: 0
2: 3
3: 21
4: 187
900655525_900655530 -7 Left 900655525 1:3754945-3754967 CCTCAGCAAGAGGGTCTCCACGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 900655530 1:3754961-3754983 TCCACGGTGGCCAGGGCTCCAGG 0: 1
1: 0
2: 1
3: 31
4: 253
900655525_900655536 11 Left 900655525 1:3754945-3754967 CCTCAGCAAGAGGGTCTCCACGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 900655536 1:3754979-3755001 CCAGGACCAGGCATTTTTGTGGG 0: 1
1: 0
2: 1
3: 13
4: 157
900655525_900655542 27 Left 900655525 1:3754945-3754967 CCTCAGCAAGAGGGTCTCCACGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 900655542 1:3754995-3755017 TTGTGGGCAGGTCTCTGGGGAGG 0: 2
1: 0
2: 3
3: 27
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900655525 Original CRISPR CCGTGGAGACCCTCTTGCTG AGG (reversed) Intronic
900147534 1:1164957-1164979 CCGCAGAGAACCCCTTGCTGGGG + Intergenic
900192679 1:1358159-1358181 TCCTGCAGCCCCTCTTGCTGGGG - Intronic
900519094 1:3097047-3097069 CCTGGGGGACCCTTTTGCTGGGG + Intronic
900655525 1:3754945-3754967 CCGTGGAGACCCTCTTGCTGAGG - Intronic
900800808 1:4735879-4735901 CCGTGGAGACCCTCAGGAGGCGG - Intronic
901878313 1:12179568-12179590 CCCTGGAGACCCTTTTGCCTGGG + Intronic
905655355 1:39683249-39683271 CCGTGGAGACCTTACTGATGGGG + Intronic
906153784 1:43602499-43602521 CCTGGGAGACCCTCCAGCTGTGG + Intronic
906894697 1:49758287-49758309 TCATGGAGAACCTCTTGCTAGGG + Intronic
911144250 1:94537441-94537463 TCGTGGAGAAACTCATGCTGGGG - Intronic
915171721 1:153982773-153982795 GGGTGGAGCGCCTCTTGCTGGGG - Exonic
916213096 1:162374212-162374234 CCCTGAAGCCCCTCTTGATGTGG + Exonic
921729688 1:218563497-218563519 ACGTGGAAACCGTATTGCTGGGG + Intergenic
923360022 1:233201912-233201934 CCCTGGAGATGCTCTGGCTGTGG + Intronic
924359677 1:243224616-243224638 CTATAGAGACCCTCTTCCTGAGG + Intronic
1070158783 10:73853019-73853041 ACATGGAGACCCCCTTGGTGGGG + Intronic
1075396878 10:122133959-122133981 CCGTGCTGACCCTCTTCCTTGGG + Intronic
1075556847 10:123439059-123439081 CCATGGAGACCTTCTTACTCTGG - Intergenic
1075658679 10:124178330-124178352 TGGTGGGGACCTTCTTGCTGTGG + Intergenic
1076677729 10:132156151-132156173 CTGGAGAGACCTTCTTGCTGAGG + Intronic
1077943582 11:6870615-6870637 CCTTAGAGACCGTCCTGCTGAGG - Exonic
1086072152 11:82811409-82811431 CCTTGGAGAGCCTCTCCCTGGGG + Intergenic
1086201767 11:84212164-84212186 CCCTGGAGACCGTCTTTCTTTGG + Intronic
1087738484 11:101860798-101860820 CCAATGACACCCTCTTGCTGGGG - Intronic
1088588588 11:111380831-111380853 CAGTGGAGGCCCCCATGCTGTGG + Intronic
1090190206 11:124762113-124762135 CCCTGGTGACCAACTTGCTGCGG - Exonic
1098496934 12:71147020-71147042 CGGTGAGGACCCTCTTTCTGTGG - Intronic
1104637586 12:130447763-130447785 CCGTGGGGAACGCCTTGCTGAGG - Intronic
1105383409 13:19908342-19908364 CAGTGGAGTCCCTCTTACTAGGG + Intergenic
1106838864 13:33665055-33665077 AAGTGGAGACCCTGTTACTGTGG + Intergenic
1109679588 13:65732912-65732934 CCGGGGAGACCAACTTGGTGGGG - Intergenic
1113563590 13:111303599-111303621 CGGTGGAGGCCCTGGTGCTGCGG - Intronic
1116714146 14:48406946-48406968 TCATGGAGAACCTCTTGCTTGGG - Intergenic
1118335898 14:64853345-64853367 CCCTGGAGAACCTCTTCCTCAGG + Intronic
1120854794 14:89203176-89203198 CCCTGGAGTACCTATTGCTGGGG - Intronic
1122967730 14:105139094-105139116 CCCTGGGGCCCCTCTGGCTGTGG - Intergenic
1123920464 15:25066189-25066211 CCGTGGAGAGTCTCTTGATTTGG + Intergenic
1124092600 15:26620510-26620532 CCCTTGAGACCCTCTAGCAGTGG - Intronic
1126921237 15:53527403-53527425 CAGTGGCCACTCTCTTGCTGGGG - Intronic
1128250785 15:66163075-66163097 ACGTGGAGACCCAGATGCTGAGG + Intronic
1133980222 16:10627745-10627767 CCCTGCAGACCCTCAAGCTGCGG - Exonic
1141129901 16:81429242-81429264 CCCTGGAGCCCCTCTGGCTCAGG - Intergenic
1142955466 17:3518536-3518558 CCGTGGAGGCCCCCACGCTGGGG + Intronic
1145005396 17:19334550-19334572 TCCTGGAGACCCTCGGGCTGAGG - Exonic
1145263085 17:21366257-21366279 CATTCGAGACCCCCTTGCTGTGG + Intergenic
1153019180 18:611299-611321 CCTTAAAGACCCTCTTTCTGTGG + Intronic
1156250445 18:35347067-35347089 CTGTGGACACCTTGTTGCTGAGG - Intergenic
1157440663 18:47709099-47709121 GGGTGGAGTCCCTCTTCCTGTGG - Intergenic
1161407070 19:4096547-4096569 CGGTGGAAACCCTCATACTGTGG + Intronic
1162045015 19:7993361-7993383 CCCTGGACACCCTGCTGCTGAGG + Intronic
1162663988 19:12194668-12194690 CCTGGGTGACCCTCTTGCTGTGG + Intergenic
1162918334 19:13885977-13885999 CAATGGAGACCCTGTTGCAGTGG - Exonic
1163830355 19:19544569-19544591 ACGTGGAGGCCCTCAAGCTGTGG + Exonic
1164951153 19:32338265-32338287 TCGTGGAGACCCCTCTGCTGGGG - Intergenic
929762980 2:44821281-44821303 CCTTGGACACCCTCTGCCTGGGG + Intergenic
940484108 2:154275629-154275651 TCATGGAGACCCTCTTGCTAGGG + Intronic
944580680 2:201130098-201130120 CTGTGGAGACCCACCTGCTCAGG + Exonic
948518121 2:238519102-238519124 CTGTGGAGACCCTGCTGCTCAGG + Intergenic
1169279362 20:4253997-4254019 CCCTGGAGACCCTGTTGGTCTGG + Intergenic
1174500588 20:50981247-50981269 CCGAGGAGGCCCTCCTGCTCTGG - Intergenic
1176047449 20:63100230-63100252 CCGTTGAGAGCCCCTTCCTGCGG - Intergenic
1176149586 20:63583072-63583094 CCAGGGAGCCCCTCCTGCTGGGG + Intergenic
1181235400 22:21445375-21445397 CCGTGGACAGCCGCTGGCTGCGG - Exonic
1181311251 22:21946080-21946102 GCCTGGAGACCCTCTTGCCCTGG - Exonic
1184943531 22:47785161-47785183 CTGAGGAGCCCCTCTTGCTAAGG + Intergenic
950041152 3:9920279-9920301 CCCTGGTGACACTCTTACTGAGG + Intronic
950098309 3:10342858-10342880 CCACGGAGACCCTGCTGCTGAGG - Exonic
951889793 3:27557722-27557744 CCGTGAAGTCCCTTCTGCTGAGG + Intergenic
953848881 3:46450145-46450167 CGGTTGAGACCCTCCTGCAGAGG + Intronic
955503613 3:59609360-59609382 TTGTTGAGACCCTCTTGCTTTGG - Intergenic
958666010 3:97138898-97138920 CAGTGGAGACCCTCTGGATTTGG + Intronic
960242817 3:115365721-115365743 CCAAGGAAACCCTCTTGGTGTGG - Intergenic
960807180 3:121595296-121595318 CCTTGGAGACCTTGGTGCTGTGG - Intronic
961217031 3:125167524-125167546 CCGTGGAGATCCTTTGGGTGAGG - Intronic
962011080 3:131391596-131391618 CCCTGAAGACCCTGATGCTGGGG + Intergenic
969310705 4:6351699-6351721 CCGTGGGGACCCTGTTGTGGAGG - Intronic
975657467 4:76656006-76656028 TCGTGGAGACCATTCTGCTGTGG + Intronic
977585630 4:98772784-98772806 TTGTGGAAAGCCTCTTGCTGGGG + Intergenic
977886039 4:102252605-102252627 CCCTGGAGTCCCTCTTCCTTGGG - Intronic
997640426 5:135445323-135445345 CAGCGCAGACCCTCTAGCTGGGG - Exonic
999851120 5:155540609-155540631 ACATAGAGACACTCTTGCTGAGG - Intergenic
1001315934 5:170641368-170641390 CCGAGCAGCCCCTCATGCTGAGG - Intronic
1002170537 5:177371839-177371861 CTGGGGGGACCCTCATGCTGTGG + Intronic
1006958566 6:37901864-37901886 CTGGAGAGACCTTCTTGCTGAGG + Intronic
1007391343 6:41551266-41551288 CCGTGGAGTCACTGTTGCTGTGG + Intronic
1008542064 6:52554085-52554107 CCTGGGAGAGCCTCTTGCTCAGG - Intronic
1008940407 6:57040282-57040304 GGGTGAATACCCTCTTGCTGTGG - Intergenic
1013831903 6:114282564-114282586 CCCTGGAAAGCCTCTTCCTGTGG + Intronic
1017552146 6:155520460-155520482 GCAGGGAGAACCTCTTGCTGAGG - Intergenic
1018858052 6:167689506-167689528 CTGGGGAGACCCTGCTGCTGGGG + Intergenic
1018943632 6:168329220-168329242 CCCTTGAGACCCTCTTCCTTCGG + Intergenic
1019020666 6:168914955-168914977 CCGTGGACACCCACGTGGTGTGG + Intergenic
1023074919 7:36473048-36473070 CCGAGGGGATCCTCTTGGTGGGG + Intergenic
1023271618 7:38469488-38469510 TCCTGCAGACCCTCTTGCAGTGG + Intronic
1024279681 7:47709220-47709242 CCGTGGAGACACTCTGGCCCTGG - Intronic
1026150478 7:67784032-67784054 CCCTGGAGACCCTCTGACTGGGG + Intergenic
1029596201 7:101538737-101538759 CCCTGGAGACACCCCTGCTGGGG + Intronic
1031951911 7:127901392-127901414 TCGTGGAGAATCTCTTGCTGTGG + Intronic
1032858810 7:135858810-135858832 CCATGCAGAGCCTCTTCCTGAGG + Intergenic
1044973922 8:97644931-97644953 GCGTGGAGACCCTCGAGCTTGGG + Intronic
1047944223 8:129858839-129858861 CCTTGGAGCCCCTCCTGTTGAGG - Intronic
1048897260 8:139003232-139003254 CACTCGAGACACTCTTGCTGGGG + Intergenic
1049023492 8:139973281-139973303 CCGTGGCCACCCTGCTGCTGGGG - Intronic
1049519816 8:143082368-143082390 CTGTGGATACCTCCTTGCTGGGG + Intronic
1049685495 8:143937678-143937700 CCGTGGAGCCCGGCTTTCTGGGG - Intronic
1050232425 9:3541176-3541198 CTCTGGAGACCCTCTTGTGGAGG + Intergenic
1051151241 9:14081405-14081427 CCGGGGACACCCTGTGGCTGTGG - Intergenic
1053623166 9:39841589-39841611 CCGGGGAGAGCCACTTGCTCAGG - Intergenic
1053881705 9:42601639-42601661 CCGGGGAGAGCCACTTGCTCAGG + Intergenic
1053890963 9:42692653-42692675 CCGGGGAGAGCCGCTTGCTCAGG - Intergenic
1054220736 9:62409106-62409128 CCGGGGAGAGCCGCTTGCTCAGG + Intergenic
1054229978 9:62500066-62500088 CCGGGGAGAGCCGCTTGCTCAGG - Intergenic
1056223251 9:84470292-84470314 CCCTGGAGGTCCTCTTGTTGCGG - Intergenic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1061451223 9:130667869-130667891 CCTTGGAGACCCTCTTCTTCTGG + Intronic
1061537976 9:131261214-131261236 ACTTGGAGTCCCTCTTGGTGGGG + Exonic
1062044223 9:134417726-134417748 ACCTGCAGAGCCTCTTGCTGGGG - Intronic
1187786473 X:22893281-22893303 CAGTGTATAACCTCTTGCTGAGG - Intergenic
1188537790 X:31216588-31216610 CTCTCGAGACCCCCTTGCTGTGG + Intronic