ID: 900655634

View in Genome Browser
Species Human (GRCh38)
Location 1:3755462-3755484
Sequence CCGGACAAATCGGCCTCAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900655634_900655639 -3 Left 900655634 1:3755462-3755484 CCCACTGAGGCCGATTTGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 900655639 1:3755482-3755504 CGGAGAGATTGACAACAGCTCGG 0: 1
1: 0
2: 1
3: 4
4: 126
900655634_900655640 5 Left 900655634 1:3755462-3755484 CCCACTGAGGCCGATTTGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 900655640 1:3755490-3755512 TTGACAACAGCTCGGAGACCTGG 0: 1
1: 0
2: 0
3: 6
4: 84
900655634_900655644 30 Left 900655634 1:3755462-3755484 CCCACTGAGGCCGATTTGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 900655644 1:3755515-3755537 AGGCACCCAGGACCTGTTCTTGG 0: 1
1: 0
2: 0
3: 20
4: 192
900655634_900655642 18 Left 900655634 1:3755462-3755484 CCCACTGAGGCCGATTTGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 900655642 1:3755503-3755525 GGAGACCTGGAGAGGCACCCAGG 0: 1
1: 0
2: 7
3: 38
4: 455
900655634_900655641 10 Left 900655634 1:3755462-3755484 CCCACTGAGGCCGATTTGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 900655641 1:3755495-3755517 AACAGCTCGGAGACCTGGAGAGG 0: 1
1: 1
2: 1
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900655634 Original CRISPR CCGGACAAATCGGCCTCAGT GGG (reversed) Exonic
900655634 1:3755462-3755484 CCGGACAAATCGGCCTCAGTGGG - Exonic
904818094 1:33220587-33220609 CAGGACAAATCAGCCACAGATGG - Intergenic
1069640282 10:69950485-69950507 CCGGGCAAATCTGCCAGAGTGGG - Intronic
1076724948 10:132408913-132408935 ACGGGCACATCGGCCTCAGCAGG + Intronic
1113611367 13:111646911-111646933 TTGGAAAAAACGGCCTCAGTTGG + Intronic
1114669840 14:24404019-24404041 CCGCACAAAGGGGCCTCACTGGG - Intronic
1134785838 16:16942545-16942567 CATGACAACTCAGCCTCAGTAGG + Intergenic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1154374938 18:13801181-13801203 CCGCAGAAACCGGCCTCAGCGGG - Intergenic
1155226907 18:23737136-23737158 CCAGACAGATCTGCCTCAGAAGG - Intronic
1155249287 18:23939962-23939984 CCGGGCAATTCTGCCTCTGTGGG - Intronic
1165390466 19:35535730-35535752 CTAGAAAAATCGGACTCAGTGGG - Intronic
1179068945 21:38053805-38053827 CCAGACAAAGCGGCCACAGATGG + Intronic
952819657 3:37475159-37475181 CTGGACAAATGGGCCCCAGAGGG + Intronic
952877621 3:37960100-37960122 CCGCCCACCTCGGCCTCAGTGGG - Intronic
954238886 3:49277769-49277791 ACGGAGAAATGGGCTTCAGTGGG + Exonic
968902667 4:3438821-3438843 CCGGAAAGAGGGGCCTCAGTAGG + Intronic
1019994440 7:4714860-4714882 CTGGAGAAATCGGACTCAGGTGG - Intronic
1029870589 7:103687934-103687956 CTGTACAAATAGGCCTCATTGGG + Intronic
1030975494 7:116117127-116117149 CAGGACAAATCAGACTCAATAGG - Intronic
1037616782 8:20526377-20526399 CCAGACAACTCAGCATCAGTGGG + Intergenic
1039685919 8:39801746-39801768 CCTGACACATCCTCCTCAGTGGG - Intronic
1039828599 8:41195234-41195256 CCTGATAAAGCAGCCTCAGTAGG - Intergenic
1058058062 9:100469104-100469126 ACTGACAAATTGGCCCCAGTAGG - Intronic
1059312060 9:113395341-113395363 CTGGACAAGACAGCCTCAGTGGG - Intronic
1187518246 X:19991227-19991249 CTGGACAGAGCGGCCGCAGTGGG - Intergenic