ID: 900656853

View in Genome Browser
Species Human (GRCh38)
Location 1:3762833-3762855
Sequence CCTCACCTGCTCCCCTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 305}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900656853_900656861 10 Left 900656853 1:3762833-3762855 CCACTCCAGGGGAGCAGGTGAGG 0: 1
1: 0
2: 2
3: 35
4: 305
Right 900656861 1:3762866-3762888 GTTAGCCCCCTTGAAGGCACAGG 0: 1
1: 0
2: 0
3: 2
4: 72
900656853_900656863 15 Left 900656853 1:3762833-3762855 CCACTCCAGGGGAGCAGGTGAGG 0: 1
1: 0
2: 2
3: 35
4: 305
Right 900656863 1:3762871-3762893 CCCCCTTGAAGGCACAGGTCAGG 0: 1
1: 0
2: 2
3: 6
4: 158
900656853_900656860 4 Left 900656853 1:3762833-3762855 CCACTCCAGGGGAGCAGGTGAGG 0: 1
1: 0
2: 2
3: 35
4: 305
Right 900656860 1:3762860-3762882 TGGGTCGTTAGCCCCCTTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900656853 Original CRISPR CCTCACCTGCTCCCCTGGAG TGG (reversed) Intronic
900151257 1:1180232-1180254 CCTCAGCTGCCCTCCTGGAGGGG + Exonic
900329147 1:2125525-2125547 CCACCCCTGCTCCCCTGAGGAGG + Intronic
900361795 1:2292731-2292753 CCTCACGTCCTCCCCAGCAGGGG - Intronic
900362866 1:2298399-2298421 CCACACCTGCTCCAAGGGAGAGG - Intronic
900456769 1:2778678-2778700 CCTCCTCTGATCCCCAGGAGGGG + Intronic
900556870 1:3285034-3285056 CTTCACCTGGTGCCCTGGACGGG + Intronic
900656853 1:3762833-3762855 CCTCACCTGCTCCCCTGGAGTGG - Intronic
900974391 1:6008078-6008100 CCTCACCTGCACCAATGGGGAGG + Intronic
901636315 1:10671886-10671908 CCACACCTGCTCCCGTGAAAAGG - Intronic
902190054 1:14756006-14756028 CCTCTTCTCCTCCCCTGCAGTGG - Intronic
902223288 1:14980502-14980524 GCCCACCTGCCCCCCTGGACAGG + Intronic
902388882 1:16091383-16091405 CATCACCTGCTCACCTGGCCAGG - Intergenic
902569170 1:17335916-17335938 CCACACCTGTTCCCCTTCAGCGG - Intronic
902632186 1:17711585-17711607 CCTCACCTGCTAACCTGGTGGGG + Intergenic
902816076 1:18917542-18917564 CCTCCCCTGCTTCCCGGCAGAGG + Intronic
904606597 1:31701287-31701309 CCTCACTGGGTCCCCTGGGGGGG - Intronic
906204955 1:43981713-43981735 CCTCACCCATGCCCCTGGAGCGG + Exonic
908787429 1:67749037-67749059 CCCCACCTCCTCCCCTCCAGGGG - Intronic
910412655 1:86963794-86963816 CCCCACCTCCCCCCCTGGACGGG + Intronic
912591331 1:110824182-110824204 CAGCACCTGCTGCACTGGAGGGG + Intergenic
913074747 1:115332558-115332580 CCTCACGTTCTCCCTTGGAAGGG - Intronic
914916453 1:151822280-151822302 CCGCTCCTGCTCCCCTGTGGTGG - Intronic
918292617 1:183123333-183123355 CCTCACCTGCTCCCCTACAATGG + Intronic
919378098 1:196818735-196818757 ACTCTGCTGCTCCACTGGAGGGG - Intergenic
920052529 1:203172391-203172413 CAGCACCTGCTCCCCAGCAGGGG - Intronic
920314429 1:205067234-205067256 TCTCACCTGCTTCCCTGGTCCGG - Exonic
922698882 1:227746336-227746358 CCACACCTCCTTCCCTGCAGTGG + Intronic
924218361 1:241848318-241848340 ACTCTCCTCCTCCCCTTGAGCGG - Exonic
924508500 1:244709257-244709279 CCACACCTGCTCACAGGGAGGGG + Intergenic
1063393533 10:5666072-5666094 CCTCACCCGCGCCAGTGGAGGGG + Intronic
1063667109 10:8069265-8069287 CCTGACATGCTCCAGTGGAGTGG + Intronic
1064221869 10:13447968-13447990 CCTAAGCTGCCCCCCAGGAGTGG - Intronic
1065526716 10:26629751-26629773 CCTCCCCAACTCCCCTGGAATGG + Intergenic
1065759795 10:28971502-28971524 CCTCACCTCCTCCCCTAAAAAGG - Intergenic
1067523698 10:47026287-47026309 CCTCACCTTCTTCACGGGAGGGG - Intergenic
1067763957 10:49071274-49071296 CCTGACCTGCTGCCTTGGAGTGG - Intronic
1068771674 10:60828437-60828459 CCTCACTTGCACCCCTGTAGAGG - Intergenic
1069595254 10:69666061-69666083 CCTCAGCTGCACTCCTGGTGCGG - Intergenic
1069651462 10:70052933-70052955 CCAAACCTGCGCCCGTGGAGGGG + Exonic
1069756066 10:70775081-70775103 CCTCAGCTCCCACCCTGGAGGGG - Intronic
1070545794 10:77451445-77451467 TCTCACCTACTCGCCTGGACTGG - Intronic
1070660291 10:78300797-78300819 GCTCAGCTGCTCCCTGGGAGAGG - Intergenic
1070789429 10:79180618-79180640 CCTGAGCTGCCCCTCTGGAGTGG + Intronic
1070796365 10:79219233-79219255 TCTCTCCTGCTCCTCTGGGGAGG - Intronic
1071358207 10:84818934-84818956 ACTCACCTCTTCCCCAGGAGTGG + Intergenic
1072152274 10:92692325-92692347 GCTCACCCACTGCCCTGGAGCGG - Intronic
1074246485 10:111698837-111698859 CCTCCCCTTCTCCCCTGCAGTGG + Intergenic
1074859257 10:117497899-117497921 GCTCACCCTCACCCCTGGAGGGG + Intergenic
1075129352 10:119725614-119725636 CCACACCCGCTCTCCCGGAGCGG - Intergenic
1075213332 10:120510522-120510544 CTTCATCTGCTCCCCTGGCTCGG + Intronic
1076016209 10:127029337-127029359 CCCCACTTGCTACCCTGAAGAGG + Intronic
1076259792 10:129056119-129056141 CTGCACGTGCTCCGCTGGAGCGG + Intergenic
1076352419 10:129826147-129826169 CACCACCTGCTCCCCAGGAGGGG - Intergenic
1076999507 11:315702-315724 TCTTCCCTGCTCCCCTGGGGTGG + Intergenic
1077986377 11:7355328-7355350 CCTTACCTTCTCACCTGGTGGGG + Intronic
1078985137 11:16586607-16586629 TCTCACCTTGTCCTCTGGAGTGG - Intronic
1079099274 11:17530858-17530880 CCTCCCCTACTCCCCAAGAGAGG - Intronic
1079102726 11:17551837-17551859 CCTCGCCTGGCCCCCTCGAGAGG - Intronic
1079340217 11:19605592-19605614 CCTCACATGCTCCCTTGCACAGG - Intronic
1081657806 11:44868774-44868796 CCTCACTTTCTGCCCTGGTGTGG - Intronic
1081671037 11:44942873-44942895 CCTCACCTGCCCCACTGGCGAGG + Intronic
1083629806 11:64089644-64089666 CATCACCTCCACCCCAGGAGTGG - Intronic
1084901622 11:72314318-72314340 GCTGACCTGCTGCCCAGGAGAGG + Intronic
1084980662 11:72826892-72826914 CCTCACCTGCTCTCTGGGAGTGG + Intronic
1085982720 11:81744465-81744487 CTTCACCTGCGGCCCTGGTGGGG - Intergenic
1089160775 11:116435403-116435425 CTCCTGCTGCTCCCCTGGAGTGG + Intergenic
1089396993 11:118142720-118142742 CCTCACCAGCTCCCTTGAGGTGG - Intronic
1090390971 11:126386976-126386998 CCTCACTTGCTGCCCTGGCCAGG + Intronic
1092226707 12:6752811-6752833 CCTCTCCTGCTCGCCTGGCGGGG - Intronic
1092398017 12:8145859-8145881 CCTCACCTCCTCCCTTGGCTGGG - Intronic
1092505187 12:9091416-9091438 CCACACCTGCTGAGCTGGAGAGG + Exonic
1094008646 12:25783141-25783163 CCTCATCTCATGCCCTGGAGAGG - Intergenic
1096868824 12:54580623-54580645 CCTCACCTGCCCAGCTGAAGTGG - Intronic
1098723781 12:73936122-73936144 CCTCACATCCTCTTCTGGAGTGG + Intergenic
1102109137 12:110351173-110351195 CCTCCCCTGCTTCCCTGTAGAGG - Intergenic
1102133443 12:110552458-110552480 CCTCTCCTTCTACCCTGTAGAGG + Intronic
1102299465 12:111760463-111760485 CCTAACCTGATCCCCAGGGGAGG + Intronic
1102554339 12:113717009-113717031 CTTGACCTTCTCCCATGGAGTGG + Intergenic
1102590257 12:113951218-113951240 CCTCCCCAGCTCTCCTGCAGGGG + Intronic
1103078551 12:118005019-118005041 TCTCACCTCCTCCCCTTGAAGGG - Intergenic
1103086643 12:118066537-118066559 CTCCACCTGCACCCCTGGCGGGG - Exonic
1103213058 12:119180471-119180493 CCTACCCTGCTACCCTGGAGTGG - Intronic
1103527625 12:121578679-121578701 CGTCACCGGATCCCCTGGAATGG + Intronic
1104610524 12:130223645-130223667 CATCACATGCTCTTCTGGAGAGG - Intergenic
1104657681 12:130585754-130585776 CGTCACCTACTTCCCTGCAGGGG - Intronic
1104736919 12:131140717-131140739 CTTCCCCTGGTCGCCTGGAGTGG + Exonic
1104808591 12:131605642-131605664 CCTCACCTTTAACCCTGGAGAGG + Intergenic
1105418516 13:20232686-20232708 CCACACCTGCACCCGTGCAGAGG - Intergenic
1114479335 14:23022417-23022439 CCTCCCGTGCTCCCCAGGCGTGG - Intronic
1114640380 14:24215731-24215753 CCTCACCTGCTCTTATGGAACGG + Exonic
1118602763 14:67482140-67482162 CATCACCTGTTCCCTTGAAGGGG - Intronic
1119212804 14:72845491-72845513 CCTCACCTGTGCCTGTGGAGAGG - Intronic
1119735368 14:76978040-76978062 CCGCCACTGCTCTCCTGGAGGGG + Intergenic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1122023252 14:98856790-98856812 GCTCCCCTGCTCCCCTGGCCAGG - Intergenic
1122379052 14:101288416-101288438 CCTCTTCTGCTCCCCTGGAGAGG + Intergenic
1122834432 14:104423995-104424017 CTGCACCTGCTCCCCAGGCGTGG + Intergenic
1122854051 14:104551694-104551716 CCTCACCTGCACACCTGGACTGG - Intronic
1124633531 15:31350777-31350799 CCTCACCTTCTCCACTGGCATGG - Intronic
1127832949 15:62766909-62766931 GCTGAACGGCTCCCCTGGAGTGG - Intronic
1128513953 15:68330633-68330655 CCTTTCCTTCTCCCCTGGCGTGG - Intronic
1128640389 15:69331691-69331713 CCTCCCCTCCCCACCTGGAGTGG + Intronic
1129797378 15:78388485-78388507 TCGTCCCTGCTCCCCTGGAGGGG + Intergenic
1130653795 15:85777707-85777729 CCTGACCCGTTCCTCTGGAGTGG - Intronic
1130780118 15:87027875-87027897 CCTCACCTACACCCCTCGAGAGG - Intronic
1130910232 15:88265785-88265807 CCTCACCAAGTCCCCTGCAGAGG - Intergenic
1131103976 15:89717568-89717590 CCTCACTTGGGCCCCTGGAAGGG + Intronic
1132599436 16:767359-767381 CCCCACCTGCCCGCCGGGAGAGG - Exonic
1132745898 16:1436212-1436234 CCCCACCTTCCCCACTGGAGGGG - Intronic
1132760642 16:1507115-1507137 CCTCACCTGCGCCCAGGGATGGG + Intronic
1134106590 16:11489700-11489722 CCTCAGCTGATCCCCTGAGGAGG + Intronic
1134265708 16:12690918-12690940 CTTCACCTGCTCCTCTACAGGGG - Intronic
1135881644 16:26263442-26263464 CCTCACCCCATCCCTTGGAGAGG + Intergenic
1136640159 16:31557366-31557388 CCACTCCTGCTCACCTGGATCGG + Intergenic
1137058212 16:35755378-35755400 GCTCACCTGCACCCCTGCTGTGG + Intergenic
1137556424 16:49473210-49473232 CCTCCCCTGGTCTCCTGCAGAGG - Intergenic
1138245032 16:55461023-55461045 CCTCAGCTTGTCCTCTGGAGTGG - Intronic
1138376050 16:56564840-56564862 CCTCACCTGCCCGCCTGGCAAGG - Intergenic
1138483362 16:57318730-57318752 CCTCACGTCCTTCCCTGGGGTGG + Intergenic
1138558575 16:57786910-57786932 CCCCTCCTGCTCTCCTAGAGCGG - Intronic
1139911232 16:70398808-70398830 CCTCTCCTGCCACCCTGGTGAGG + Exonic
1140928175 16:79601820-79601842 CCTCACCAGCTACCCTCGAAGGG + Intergenic
1141827151 16:86488599-86488621 TCTTACCTACTCCCCTGGAGAGG + Intergenic
1142035375 16:87859284-87859306 CTTCACCTGCTACCGTGTAGGGG - Intronic
1142765476 17:2061788-2061810 CCTCCCCTGCTGGCCTAGAGAGG + Intronic
1143732009 17:8886709-8886731 CCTCACCAGCTCCCCCTGACTGG - Intronic
1144950331 17:18990442-18990464 CCTCACGTGCCACCCTGGAAAGG + Intronic
1145933095 17:28699963-28699985 CCTCACCTGGTCCCCTAGGCTGG - Intronic
1146295814 17:31649554-31649576 CCTCCCCAGCCTCCCTGGAGGGG + Intergenic
1146629640 17:34460538-34460560 CCGCACCTGCACTCCTGGATGGG - Intergenic
1146740388 17:35278862-35278884 CTCCACCTGCTGCCCTGGTGGGG - Intergenic
1148757224 17:49979829-49979851 CCCCTCCTGCTTCCCTGGATTGG - Intergenic
1149639673 17:58194688-58194710 CCTCACCAGCTCTCCCAGAGGGG - Intronic
1151031214 17:70742230-70742252 CCTCATATGCTCCCCTCGTGGGG + Intergenic
1151274040 17:73020613-73020635 TCTCACATGGTCCCCTGGGGAGG - Intronic
1151413529 17:73946868-73946890 CCTCACCTGCCCTGTTGGAGGGG + Intergenic
1151951223 17:77355278-77355300 CCCCAGCTGCTCCCCTGCTGCGG - Intronic
1152091747 17:78251149-78251171 CCTTCCTTCCTCCCCTGGAGAGG + Intergenic
1152538052 17:80961656-80961678 CCACAGCTGCTCCCCTGCTGGGG + Intronic
1152756768 17:82090289-82090311 CCTCACCTGCAGCCCTGGCCTGG - Intronic
1152901155 17:82941816-82941838 CCTCATCTGCTTCCCATGAGTGG + Intronic
1154350611 18:13580250-13580272 CCTTCCCTGCTGCTCTGGAGAGG + Intronic
1156874055 18:41984704-41984726 ACACACCTGCTCCCTTGCAGTGG + Intronic
1157862306 18:51152245-51152267 CCTCACCTGCTCCACTGCCTTGG - Intergenic
1158749512 18:60242710-60242732 CCTCACTTGCTCCTCTCCAGAGG + Intergenic
1160241074 18:77123710-77123732 CCTGACCTGCTCACCAGGAGAGG - Intronic
1160333622 18:78017915-78017937 CCTCACCTCCTTCCCTGGGTGGG + Intergenic
1160781729 19:880421-880443 CCTCCCCTGCGCTCCTTGAGGGG - Intronic
1161139084 19:2637348-2637370 GCGCACCTGCTCTCCTGGAGAGG + Intronic
1161170639 19:2810808-2810830 CCTCAGCTGCTTCCCTGGGAAGG + Intronic
1161284748 19:3463440-3463462 CCTCACTTCCTCCCCTGGCCAGG - Intronic
1161567455 19:5011630-5011652 TCTCACCTGCACGCCTGGCGAGG - Intronic
1161683436 19:5691802-5691824 CCTCACCTGCTGCCCCGGGAAGG - Intronic
1162987168 19:14278018-14278040 CTCCACCTGCTGCCCTGGTGCGG + Intergenic
1163226405 19:15964449-15964471 CCTCACCTGCTCCCATGGCCTGG + Intergenic
1164485854 19:28655105-28655127 CAGCACCTCCGCCCCTGGAGGGG - Intergenic
1164796341 19:31035870-31035892 GCTCACCTGCACCACAGGAGGGG + Intergenic
1165192513 19:34077037-34077059 CCTCCTCTGCTCCCCTGTAGTGG - Intergenic
1165326916 19:35119264-35119286 CCTCCCCTGCTCCCCAGGCAGGG - Intronic
1165356101 19:35305106-35305128 CCTCACCTGCTAGACTTGAGGGG + Intronic
1166365865 19:42278204-42278226 TCCCGCCTGCTCCCCAGGAGAGG + Intronic
1167436252 19:49480460-49480482 GCTCACCTGCTCCCCAGGGCGGG - Exonic
1167561341 19:50227644-50227666 CCTGAGATGCTCCCCTGGAAAGG - Intronic
1167780430 19:51595309-51595331 CCTCACCTGCATCACTGCAGGGG + Intergenic
1167799362 19:51730211-51730233 CCTCTCTTGCTTCCCTGGAGAGG - Intergenic
925144898 2:1574718-1574740 CCTCACCTGCCCCATTGGTGAGG - Intergenic
925231151 2:2235152-2235174 CCTCACATCCTCCCTTAGAGGGG + Intronic
925877672 2:8326949-8326971 CCTCACCAGCTTCTGTGGAGGGG - Intergenic
926853745 2:17229366-17229388 CCACACATGCTCTCCTGGAAAGG + Intergenic
927154503 2:20213707-20213729 CCCCACCAGGTCCCCTGGAATGG + Intronic
928126695 2:28621267-28621289 CGCCTCCTGCTGCCCTGGAGAGG - Intronic
928179971 2:29062146-29062168 CCTCCCCATCTTCCCTGGAGTGG + Exonic
929000717 2:37344835-37344857 CCTCACCTTCTCCTCTGGCCAGG - Exonic
929109933 2:38397674-38397696 CCCCACCTGCAACCCTGGTGTGG + Intergenic
929920516 2:46168131-46168153 CCTCACACTCTTCCCTGGAGTGG - Intronic
931801473 2:65762285-65762307 CCTCCCCCGCTGCCCTGGAATGG - Intergenic
934915071 2:98295022-98295044 CCTCGCCTCCTCTCCTGGGGAGG + Intronic
935413320 2:102788408-102788430 GCTCACCTGGTCCCCTGGGGTGG + Intronic
936428343 2:112437305-112437327 CCTCCCATGCACCCCTGGAAAGG + Intergenic
937659573 2:124415077-124415099 CCTTCCCTGCTCACCTGGAAAGG - Intronic
937970718 2:127546740-127546762 CCTCACCTGCTTTCCTGGGTAGG + Intronic
940517410 2:154698583-154698605 CCTCTCCTTCTCCCCTGGGACGG - Exonic
944141837 2:196465077-196465099 CCTAATATGCTCTCCTGGAGAGG + Intronic
945251633 2:207769718-207769740 GCTCGCCTCCTCCCCTGCAGGGG + Intergenic
946650395 2:221886979-221887001 CATCACCTGTTCCCCTCCAGAGG - Intergenic
947707111 2:232285290-232285312 TCTCACCTGCTCTCCCTGAGTGG + Intronic
947971492 2:234328849-234328871 CCTCACCTGCGTCTCTGCAGCGG + Intergenic
1168803963 20:662202-662224 TCTGGCCTGCTCCCCGGGAGGGG - Exonic
1168964666 20:1892195-1892217 CCTCACCTCTCCCCCTGGAGGGG - Intergenic
1168982814 20:2022290-2022312 GCCCACCTTCTCCCCAGGAGAGG - Intergenic
1169142728 20:3235388-3235410 CCCCACCTGCCCTCCTGGGGAGG - Intronic
1172162025 20:32875420-32875442 CCTCAGCTGGTCCACTGCAGGGG - Intronic
1172275289 20:33675921-33675943 CCTGAACTGGCCCCCTGGAGAGG + Exonic
1175720329 20:61281743-61281765 CGCCACCTCCTCCCCTGGAGGGG + Intronic
1176373906 21:6077906-6077928 CCTCCCATGCACCCCTGGAAAGG - Intergenic
1178154169 21:29832211-29832233 CCTCAGCTGCTTTCCTGGACTGG + Intronic
1179183259 21:39062688-39062710 CCGCTCCAGATCCCCTGGAGAGG - Intergenic
1179552394 21:42151363-42151385 TCTCACCTGCTCAACTGCAGAGG - Intergenic
1179623846 21:42636368-42636390 CCTCACATCATCCCCTGGGGCGG + Intergenic
1179626477 21:42652435-42652457 CCCCACCTGCTCTCATGGCGGGG - Intergenic
1179749571 21:43460337-43460359 CCTCCCATGCACCCCTGGAAAGG + Intergenic
1181478084 22:23180798-23180820 CCTCACCTGCCACCAGGGAGTGG + Exonic
1181580301 22:23824511-23824533 CTACACCTGCCCCCCTGGGGAGG - Intronic
1181802325 22:25355761-25355783 CCTGACCTGCTCCCATGGGTAGG + Intronic
1181843828 22:25689824-25689846 ACTCACCTCCTGCCCTTGAGAGG + Intronic
1183353344 22:37345489-37345511 GCACACCTGCTCCCCTGCAAAGG + Intergenic
1183687514 22:39369718-39369740 CCTCACCATCACCCCTAGAGTGG - Intronic
1183708996 22:39491508-39491530 CCTGAGCTGGTGCCCTGGAGGGG - Exonic
1184080349 22:42214926-42214948 CCAAAGCTGCTCCCCTGGGGGGG + Exonic
1184309784 22:43633800-43633822 CCTCACCTGCCTCACTGCAGAGG + Intronic
1184685573 22:46095263-46095285 CCTCACCTGCCGCCCTGGGCTGG - Intronic
1184685588 22:46095304-46095326 CCTCACCTGCCGCCCTGGGCTGG - Intronic
1184685603 22:46095345-46095367 CCTCACCTGCCGCCCTGGGCTGG - Intronic
1184685631 22:46095424-46095446 CCTCACCTGCCGCCCTGGGCTGG - Intronic
1184685662 22:46095506-46095528 CCTCACCTGCCGCCCTGGGCTGG - Intronic
1184685677 22:46095547-46095569 CCTCACCTGCCGCCCTGGGCTGG - Intronic
1184685691 22:46095584-46095606 CCTCACCTGCCGCCCTGGGCTGG - Intronic
1184685721 22:46095666-46095688 CCTCACCTGCCGCCCTGGGCTGG - Intronic
1184685736 22:46095707-46095729 CCTCACCTGCCGCCCTGGGCTGG - Intronic
1184685750 22:46095744-46095766 CCTCACCTGCCGCCCTGGGCTGG - Intronic
1184685765 22:46095785-46095807 CCTCACCTGCCGCCCTGGGCTGG - Intronic
1184685780 22:46095826-46095848 CCTCACCTGCCGCCCTGGGCTGG - Intronic
1184685795 22:46095867-46095889 CCTCACCTGCCGCCCTGGGCTGG - Intronic
1184685809 22:46095908-46095930 CCTCACCTGCCACCCTGGGCTGG - Intronic
1184685823 22:46095945-46095967 CCTCACCTGCCGCCCTGGGCTGG - Intronic
1185085736 22:48740125-48740147 CCTCTCCTCCAACCCTGGAGAGG + Intronic
1185335349 22:50268788-50268810 CCGCTCCTGCTCCCCTTGTGTGG - Intronic
950554064 3:13684631-13684653 CGTCTCCTGGTCCCCCGGAGAGG + Intergenic
950662965 3:14478008-14478030 CCTCCCCTGTTCCCCAGGAACGG + Intronic
950866386 3:16192656-16192678 TCTCCCCTTCTCCCCTGGTGGGG - Intronic
951551850 3:23882620-23882642 CCTCCCCTCCACCCCTGCAGTGG - Intronic
952867095 3:37861726-37861748 GCTCGCCTGCTCGCCTGGTGGGG - Intergenic
953117583 3:40008507-40008529 ACTCTCCTGTTTCCCTGGAGAGG - Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954304201 3:49716951-49716973 CCTTCCCTGCCCCCCTGCAGTGG + Exonic
954706442 3:52483262-52483284 GCTCAGCTGCTCCCCGGGACAGG - Intronic
956878818 3:73490149-73490171 GCACACCTGCACCCCTGGTGGGG + Intronic
959165231 3:102768670-102768692 CCTCACCCTCTCCCCTTGATAGG + Intergenic
963364187 3:144313636-144313658 CTTCCCCTGCTCCCATGGGGTGG - Intergenic
963855462 3:150248825-150248847 CCTCGGCTGGGCCCCTGGAGAGG - Intergenic
968089915 3:195893339-195893361 CCTCACCCCCTCCCCTGGGGTGG + Intronic
968520436 4:1032568-1032590 CCTCACCTGGGGCCCCGGAGTGG - Intergenic
968887581 4:3343154-3343176 CCTCCCCTCCTCCTCTGTAGTGG + Intronic
968890267 4:3365022-3365044 CCCCTTCTGCTCCCCTGGAAAGG - Intronic
969398470 4:6938335-6938357 CCTCACATGCTCCTCTGGAGAGG + Intronic
969629318 4:8326405-8326427 CCTCACCAGAACCCCTGGACAGG + Intergenic
969654907 4:8491358-8491380 CTCCACCTGCTGCCCTGGTGCGG - Intronic
969979642 4:11141515-11141537 CCTCACCTCCTCACCTGCTGAGG + Intergenic
971264487 4:25085823-25085845 CCAGCCCTGCTCCCCAGGAGTGG + Intergenic
971922103 4:32954074-32954096 TCTCACCTGCTCCACTGGCAAGG - Intergenic
972706082 4:41544447-41544469 ACTCAACTGCTCCCCTCGACAGG - Intronic
974486227 4:62509661-62509683 CCCCACCTCAGCCCCTGGAGTGG + Intergenic
974906429 4:68064138-68064160 CCTCAACTGCTCAACTAGAGCGG - Intronic
976078033 4:81321390-81321412 CCTCACCTCCTCCCTTGGCTTGG - Intergenic
981545467 4:145888589-145888611 CCTCACCTGTCCCCCTAGTGGGG - Intronic
985109933 4:186538456-186538478 TCTCATCTGCTGCCCTGCAGGGG + Intronic
985124593 4:186680479-186680501 CCTCCCCTGCCCCTCTGGAAGGG + Intronic
985660755 5:1155629-1155651 GCCCACCTGCGCCCCTCGAGGGG + Intergenic
985697120 5:1346863-1346885 TCTCATCTGCTCAGCTGGAGAGG - Intergenic
985763094 5:1761660-1761682 CATCGCCTGCTCTCCTGGAGGGG + Intergenic
986430827 5:7679464-7679486 CCTCACCTTCTCTTCTGCAGTGG - Intronic
986457161 5:7931229-7931251 CATCTCCTGCTCCCCTGGCTTGG - Intergenic
986558988 5:9041711-9041733 CATCTCCTGCTCCCCTGGCCTGG + Exonic
987079097 5:14410333-14410355 CCTCAACTGTTCTACTGGAGAGG - Intronic
990149483 5:52800326-52800348 CCTCACCTCCGCCCCGGGAGAGG - Exonic
990384076 5:55242558-55242580 CCTCACCTGCTCCCCCCAACTGG + Intergenic
990622563 5:57576495-57576517 CATGGGCTGCTCCCCTGGAGGGG + Intergenic
992230060 5:74655039-74655061 GCTCACCTGCTCCCATGGCCTGG - Intronic
994042907 5:95277628-95277650 CCTCGCCAGCTCTGCTGGAGTGG - Intronic
996134981 5:119830637-119830659 CCTCAACTGCTATCCTGGAATGG + Intergenic
997582033 5:135024256-135024278 CCTGACCTGCTCCTCAGCAGTGG + Intergenic
998907456 5:146921762-146921784 CCACACCTCCTCCCCTAGAAAGG + Intronic
999364023 5:151009676-151009698 CCTAACCTGGTCCCCAGGATAGG - Intergenic
999980342 5:156951884-156951906 CCTCACCTGGTCCACTGGCCTGG + Intronic
1000125016 5:158235643-158235665 CCACAGCAGCTCCCCTGGAGTGG + Intergenic
1000933426 5:167280346-167280368 CCTCCCCTTCTCCACTGGAGTGG - Intergenic
1003325061 6:5085083-5085105 CCTCACCCGCACCCCCGGCGGGG - Exonic
1003604675 6:7548373-7548395 CCTCACCTCAGCCCCAGGAGGGG + Intronic
1005931779 6:30490005-30490027 CGTGACCTGCTCCCCTGGCCGGG - Intronic
1006028373 6:31161775-31161797 CCTCACCTTCTCCCCTAGTTGGG + Exonic
1006133672 6:31883252-31883274 CCTCACCTCCTACCCTGTGGGGG - Intronic
1006460544 6:34155178-34155200 GCTCACCTGCTCTCCTGGCAGGG + Intronic
1006788637 6:36684391-36684413 CCTCACCTGCTCTGCTGCAGGGG + Exonic
1007228552 6:40331840-40331862 CCCCTCCTGCTCCCCAAGAGTGG + Intergenic
1007640697 6:43337248-43337270 AATTACCTGCTCCCTTGGAGGGG + Exonic
1007739850 6:44003652-44003674 CCTCACCAGCTCCCCTATGGCGG - Exonic
1011304435 6:85910915-85910937 CCTCACCTCCTCCCTTGGCTGGG - Intergenic
1018060020 6:160082896-160082918 CCGCCTCTGCTCCCCTGAAGGGG + Intronic
1018209326 6:161465024-161465046 CCTCTGCAGCTCACCTGGAGAGG - Intronic
1018744304 6:166750258-166750280 CCTCAGCTTCTCCCCTGGGGGGG + Intronic
1018955996 6:168410922-168410944 CCCCACCTCCTTTCCTGGAGTGG + Intergenic
1019808246 7:3144772-3144794 TCTGACCTGGTCCCCGGGAGAGG - Intronic
1021400402 7:20203611-20203633 CCTCACCTACCCCTCTGGATTGG + Intronic
1023840994 7:44097352-44097374 CCTCCCCCGCTTCCCTGGTGGGG - Intergenic
1023878902 7:44307568-44307590 CCTCCCCTGCCCACATGGAGAGG + Intronic
1024265334 7:47602002-47602024 CCCCACCTGCTCCTGTGCAGAGG + Intergenic
1027245534 7:76364638-76364660 TCTCCCCTGCACCACTGGAGGGG - Intergenic
1029109519 7:98205519-98205541 CCGAGGCTGCTCCCCTGGAGCGG + Exonic
1029280544 7:99432762-99432784 CCGCATCTGCTCCTCTGAAGGGG - Intronic
1029283812 7:99452913-99452935 CCGCCCCTGCTCCTGTGGAGTGG + Intronic
1029576570 7:101407357-101407379 CCTCACCTGTTCTTCTAGAGAGG + Intronic
1030082272 7:105788305-105788327 CCTCCCCTGGTCACCTGCAGAGG + Intronic
1030111403 7:106030128-106030150 CCTCACATGCTGCCCTCTAGAGG - Intronic
1031608933 7:123802025-123802047 TCACTCCTCCTCCCCTGGAGAGG - Intergenic
1032439788 7:131933704-131933726 CCTCCTCTGCTCCACTGAAGAGG + Intergenic
1034317389 7:150145264-150145286 CCTGAAGGGCTCCCCTGGAGAGG + Intergenic
1034775362 7:153821963-153821985 CCTGAAGGGCTCCCCTGGAGAGG - Intergenic
1035134151 7:156684385-156684407 CCTCACGTGCTGTCCTGGAAGGG - Intronic
1036629281 8:10499264-10499286 CCTCTCCCCCTCCCCAGGAGTGG + Intergenic
1038086950 8:24208595-24208617 CTTCACCTGCTCACATGGAGGGG + Intergenic
1038176279 8:25184522-25184544 CCTCGCGCGCTTCCCTGGAGCGG - Intergenic
1038257417 8:25962974-25962996 CCTCATGTGCTCTTCTGGAGGGG + Intronic
1039793579 8:40894246-40894268 CCTCACCAGAGCACCTGGAGTGG - Intronic
1040812391 8:51469610-51469632 CCTTTTCTACTCCCCTGGAGAGG - Intronic
1045060067 8:98403408-98403430 CCTTACCTGCTCCCCTGCTGGGG - Intronic
1048293889 8:133200317-133200339 CCTGAGCTCCTTCCCTGGAGGGG - Intronic
1048319930 8:133390711-133390733 CCTCACATGATCTCATGGAGAGG - Intergenic
1048570861 8:135654765-135654787 CCTCTCCTGCTACCCTGGTGTGG - Intronic
1048857752 8:138698517-138698539 TCTCACCTGCTCTCCCAGAGAGG - Intronic
1049249088 8:141578579-141578601 CCTCTCCTCCTGCCCTTGAGGGG - Intergenic
1049370844 8:142265479-142265501 GTTCACCTGCTCACCTGCAGAGG + Intronic
1049618858 8:143588886-143588908 CCTCCCCTGCCCACCTGGGGTGG - Intronic
1049987975 9:970145-970167 CCTCACGCGGTCCCCTGGAAGGG + Intergenic
1050137998 9:2488254-2488276 CTTCACCTGCTCTCCCGGGGAGG + Intergenic
1050587738 9:7130653-7130675 CCACAACTGTTGCCCTGGAGGGG + Intergenic
1051370672 9:16356352-16356374 CCCCACCTGCTTCCCTGGCGCGG - Intergenic
1052864780 9:33458304-33458326 ACTCCCCTGCCCCACTGGAGAGG + Intergenic
1060548053 9:124472093-124472115 CCTCACCTGTGCCCCTCGGGTGG + Intronic
1060585037 9:124780431-124780453 CCCCTCCTGCTCCCCTGGCTGGG - Intronic
1060827567 9:126695580-126695602 CCTCCCTGGATCCCCTGGAGGGG + Intronic
1060877851 9:127096081-127096103 CCCCATCTGCTACCCTGGGGTGG - Intronic
1061064509 9:128268999-128269021 CCTTCCCTTCTCCCCTGCAGTGG + Intronic
1061777266 9:132973681-132973703 CCTCACCTGTTCCCCTTGTCTGG - Intronic
1061854366 9:133433476-133433498 CCACACCTCCTCCGCAGGAGCGG - Exonic
1061957568 9:133971535-133971557 CCTGAGCTGCTCCACTGGGGAGG + Intronic
1061985440 9:134127650-134127672 CGTCACCCGCATCCCTGGAGTGG - Intergenic
1062161721 9:135083992-135084014 CCTCACCCCCTTCCCTGGAGAGG - Intronic
1186793921 X:13025490-13025512 CCTCCTGTTCTCCCCTGGAGGGG - Intergenic
1197377893 X:125705035-125705057 AAGCACCTGCTGCCCTGGAGGGG + Intergenic
1201175770 Y:11307641-11307663 CCTCCCCGGCTCCTCTGGAAGGG + Intergenic
1201565795 Y:15364364-15364386 CCACACCTGCTCTCCTGAGGTGG - Intergenic
1201611850 Y:15851868-15851890 ACTCTCCTGCTCTCCTGGAAAGG + Intergenic
1202045769 Y:20736065-20736087 TCTGCCCTGCTGCCCTGGAGAGG + Intergenic