ID: 900660883

View in Genome Browser
Species Human (GRCh38)
Location 1:3782836-3782858
Sequence CTGTGGTCCCAGCACTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7835
Summary {0: 3, 1: 38, 2: 160, 3: 937, 4: 6697}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900660875_900660883 26 Left 900660875 1:3782787-3782809 CCAGGCATAATTATAAAAGAAAC 0: 1
1: 0
2: 2
3: 20
4: 324
Right 900660883 1:3782836-3782858 CTGTGGTCCCAGCACTCAGGAGG 0: 3
1: 38
2: 160
3: 937
4: 6697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900660883 Original CRISPR CTGTGGTCCCAGCACTCAGG AGG Intronic
Too many off-targets to display for this crispr