ID: 900660883 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:3782836-3782858 |
| Sequence | CTGTGGTCCCAGCACTCAGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 7835 | |||
| Summary | {0: 3, 1: 38, 2: 160, 3: 937, 4: 6697} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 900660875_900660883 | 26 | Left | 900660875 | 1:3782787-3782809 | CCAGGCATAATTATAAAAGAAAC | 0: 1 1: 0 2: 2 3: 20 4: 324 |
||
| Right | 900660883 | 1:3782836-3782858 | CTGTGGTCCCAGCACTCAGGAGG | 0: 3 1: 38 2: 160 3: 937 4: 6697 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 900660883 | Original CRISPR | CTGTGGTCCCAGCACTCAGG AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||