ID: 900661243

View in Genome Browser
Species Human (GRCh38)
Location 1:3785101-3785123
Sequence GGGGCCGGGCGCAGTACAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900661233_900661243 13 Left 900661233 1:3785065-3785087 CCTGCAAAGGAGGCTGCAGCACC 0: 1
1: 0
2: 1
3: 26
4: 267
Right 900661243 1:3785101-3785123 GGGGCCGGGCGCAGTACAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 230
900661239_900661243 -8 Left 900661239 1:3785086-3785108 CCTTGAGGTCCTGTGGGGGCCGG 0: 1
1: 0
2: 3
3: 18
4: 181
Right 900661243 1:3785101-3785123 GGGGCCGGGCGCAGTACAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 230
900661232_900661243 14 Left 900661232 1:3785064-3785086 CCCTGCAAAGGAGGCTGCAGCAC 0: 1
1: 0
2: 1
3: 24
4: 282
Right 900661243 1:3785101-3785123 GGGGCCGGGCGCAGTACAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900661243 Original CRISPR GGGGCCGGGCGCAGTACAGC AGG Exonic
900032137 1:379852-379874 GGGGCAGGGGGCAGCAGAGCTGG + Intergenic
900052686 1:608038-608060 GGGGCAGGGGGCAGCAGAGCTGG + Intergenic
900319101 1:2073737-2073759 GGGGCGGGGGACAGGACAGCCGG + Intronic
900651626 1:3732703-3732725 GGGGCAGGGGGCAGTGGAGCAGG - Intronic
900661243 1:3785101-3785123 GGGGCCGGGCGCAGTACAGCAGG + Exonic
901443495 1:9293195-9293217 GGGGCCGGGCGCGGGGGAGCGGG + Intronic
901833024 1:11905629-11905651 GGGGCCGGGCGCAGTGGCTCAGG - Intergenic
905227151 1:36486774-36486796 GGGGCGGGAGGCAGGACAGCTGG - Intergenic
905884600 1:41484913-41484935 GGGGCCCCTCGCAGTCCAGCTGG + Intergenic
905914588 1:41675945-41675967 GGGACCGGGGACAGGACAGCTGG + Intronic
907398035 1:54205955-54205977 GGGGTGGGGGGCAGTAAAGCAGG - Intronic
910550350 1:88467404-88467426 GGGACCGGGCGCCGTGGAGCAGG - Intergenic
910773393 1:90851611-90851633 TGGGGCGGGCGCAGGACTGCAGG - Intergenic
912538700 1:110396356-110396378 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
912831408 1:112956693-112956715 GGGGGCCGGCGCTGTAGAGCCGG + Intronic
917815532 1:178706159-178706181 GGGGCAGGGCGAAGACCAGCGGG + Intergenic
917929366 1:179813086-179813108 GGCGCCGGGCGGATGACAGCGGG + Exonic
920440421 1:205977056-205977078 GGGGCCGGGGGGAGGTCAGCAGG - Exonic
920692000 1:208154231-208154253 GGTGCTGGGTACAGTACAGCAGG + Intronic
922166083 1:223116989-223117011 GGGACCGGGCGCCGTGGAGCAGG + Intronic
922204427 1:223434161-223434183 GGGGCCGGGCGCAGTGGCTCAGG + Intergenic
1064097838 10:12436962-12436984 GGGGCAGGGCGCAGATCAGGTGG + Intronic
1064630552 10:17306349-17306371 TGGGCCGGGCGCAGTAACTCAGG + Intergenic
1069489383 10:68848334-68848356 GTGGCAGGGAGTAGTACAGCTGG - Intronic
1071527241 10:86365940-86365962 GGGGCAGGGGGAGGTACAGCGGG - Intronic
1072799798 10:98385016-98385038 CGGGGCGGGCGAAGTAGAGCTGG + Exonic
1073138031 10:101230298-101230320 GGGCCCGGGCGGAGCGCAGCAGG - Intergenic
1073772469 10:106750447-106750469 GGGGCCGGGCGCAGTGGTTCAGG + Intronic
1074138107 10:110644729-110644751 GGGGGCGAGCGAAGTTCAGCAGG - Intronic
1074317212 10:112370658-112370680 GGGACTGGGCGCAGTGGAGCAGG - Intergenic
1077016827 11:401829-401851 GGGGCCGGGGTCAGTGGAGCCGG - Intronic
1077016859 11:401899-401921 GGGGCCGGGGTCAGTGGAGCCGG - Intronic
1077016903 11:401992-402014 GGGGCCGGGGTCAGTGGAGCCGG - Intronic
1077016935 11:402062-402084 GGGGCCGGGGTCAGTGGAGCCGG - Intronic
1077016967 11:402132-402154 GGGGCCGGGGTCAGTGGAGCCGG - Intronic
1077016997 11:402201-402223 GGGGCCGGGGTCAGTGGAGCCGG - Intronic
1077017029 11:402271-402293 GGGGCCGGGGTCAGTGGAGCCGG - Intronic
1077017073 11:402364-402386 GGGGCCGGGGTCAGTGGAGCCGG - Intronic
1077017105 11:402434-402456 GGGGCCGGGGTCAGTGGAGCCGG - Intronic
1077017137 11:402504-402526 GGGGCCGGGGTCAGTGGAGCCGG - Intronic
1081428440 11:42950219-42950241 GGGACTGGGCGCAGTGGAGCAGG - Intergenic
1081672774 11:44950835-44950857 GGCGCCGCGCGCAGTCCAGCCGG - Intronic
1083453006 11:62758890-62758912 GGGGCCGGGCGCAGTGGCTCAGG + Intergenic
1083738094 11:64693188-64693210 GGGGCGGGGGGCACTGCAGCGGG + Intronic
1083920360 11:65778998-65779020 TGGGCCGGGCTTGGTACAGCTGG + Exonic
1083951406 11:65958614-65958636 GGGGCCGAGCCCTGTGCAGCTGG - Intronic
1084831778 11:71775028-71775050 GGGACTGGGCGCAGTGGAGCAGG - Intergenic
1085982737 11:81744533-81744555 GGGACCGGGCACAGTGCAGCAGG + Intergenic
1089046003 11:115503152-115503174 GAGGCTGGGTGCAGCACAGCCGG + Intronic
1089666918 11:120026233-120026255 GGGACCGGGCGCCGTGGAGCAGG - Intergenic
1091201257 11:133782632-133782654 GGGACTGGGCACAGTAGAGCAGG - Intergenic
1093652605 12:21661861-21661883 GGGACTGGGCGCAGTGGAGCAGG - Intronic
1093653856 12:21674034-21674056 GGGACTGGGCGCAGTGGAGCAGG + Intronic
1093972343 12:25386390-25386412 GGGGCCGCGGGCGGGACAGCGGG + Intergenic
1095534016 12:43224613-43224635 GGGACTGGGCGCAGTGGAGCAGG - Intergenic
1096503575 12:52079869-52079891 GGGGCCGCGCGCGGTGCAGGCGG + Intergenic
1096811526 12:54173445-54173467 CGGGGCGGGCGCAGCAGAGCGGG + Intronic
1097664145 12:62461301-62461323 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
1097929540 12:65169328-65169350 AGGGCAGGGCGGAGAACAGCTGG + Intergenic
1100734581 12:97512812-97512834 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
1102473777 12:113175504-113175526 GGGGCCGGGCGCAGTGGCTCAGG + Intronic
1102855305 12:116288402-116288424 GGGGCCTGCAGCAATACAGCTGG + Intergenic
1104953772 12:132454052-132454074 GGGGCTGGGCAGAGCACAGCAGG + Intergenic
1106414839 13:29537937-29537959 CCGGGCGGGCGCAGTGCAGCAGG + Intronic
1109364690 13:61339502-61339524 GGGACCCGGCGCAGTGGAGCAGG - Intergenic
1109506198 13:63306065-63306087 GGGACCGGGCGCGGTGGAGCAGG - Intergenic
1110792348 13:79600185-79600207 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
1112226559 13:97545618-97545640 GGGACCGGGCGCCGTGGAGCAGG - Intergenic
1112518699 13:100077849-100077871 GGGACTGGGCGCCGTAGAGCAGG - Intergenic
1114560256 14:23584908-23584930 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
1118753285 14:68821512-68821534 GGGGCCAGGGGCAGGACAGAGGG + Intergenic
1118887513 14:69879353-69879375 GGGGCGGGGCGGAGCACGGCGGG - Intronic
1120439056 14:84512936-84512958 GGGACTGGGCGCCGTGCAGCAGG + Intergenic
1120704702 14:87734758-87734780 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
1121547738 14:94774183-94774205 GGGGCAGCGCGCATTAGAGCTGG + Intergenic
1121844374 14:97160002-97160024 GGGGCTGGGCGAGGTCCAGCTGG + Intergenic
1122316328 14:100827926-100827948 GGGGCCTGGCGCAGGTCCGCTGG + Intergenic
1122769354 14:104091144-104091166 AGGGCCGGGCGCAGTGCCTCAGG - Intronic
1122806764 14:104263737-104263759 GAGGCCGGGCACTGTACAGTTGG + Intergenic
1123783214 15:23646337-23646359 GGGGCCTGGCGGATCACAGCGGG + Exonic
1126102813 15:45129910-45129932 GGGGCGGGGCGCAGTGGGGCGGG - Intronic
1128344121 15:66842799-66842821 GGGGCCGCGCGCAGGGCAGGGGG + Intergenic
1129200335 15:73994845-73994867 GGGGCCGGGCGGGGTCCTGCTGG - Exonic
1129348220 15:74937930-74937952 GGGTCCGGGCGGAGTGCAGGAGG + Exonic
1130390251 15:83448087-83448109 GGAGCCGGGCACAGTCCAGACGG - Intronic
1131458256 15:92600058-92600080 GGGGCAGGGAGCAATCCAGCAGG + Intergenic
1132155791 15:99494704-99494726 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
1132574748 16:659243-659265 AGGCCCGGGCGCAGGACCGCTGG + Exonic
1132696379 16:1204003-1204025 GGGGCCTGGCCCAGTCCTGCGGG - Exonic
1132749904 16:1452722-1452744 GGGCCCGGGCGGGGTCCAGCAGG - Intronic
1133031512 16:3013425-3013447 GGGGCAGGGCGCAGGACACCAGG - Exonic
1133738254 16:8631937-8631959 TGGGCCGGGCGCGGTCCAGGTGG - Intronic
1133770290 16:8863732-8863754 AGGGCCGGGCAAAGTCCAGCTGG + Intronic
1134447875 16:14344439-14344461 GGGGCGGGGAGCAGCACAGAGGG - Intergenic
1139224199 16:65218295-65218317 GTGGCCAGGGGCAGCACAGCTGG - Intergenic
1142848344 17:2692621-2692643 GGTAGCGGGCGCGGTACAGCAGG + Exonic
1143524867 17:7466170-7466192 GGGCCCGGGCCCAGGCCAGCTGG - Exonic
1143604984 17:7978262-7978284 GGGGCCGGGCGCAGTGGCTCAGG + Intergenic
1144804624 17:17956523-17956545 GGGACCGGGCGCAGTGGAGCAGG + Intronic
1145979987 17:29005673-29005695 GGCGCCGGGGGCAGCGCAGCCGG + Intronic
1146053015 17:29567493-29567515 GGGGCCGGGCGGGGGAGAGCAGG - Intronic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1150788326 17:68180186-68180208 GGGACCGGGCGCCGTGGAGCAGG - Intergenic
1152402462 17:80075758-80075780 GGGGCCGGGCGCAGTGGCTCAGG - Intronic
1152623788 17:81379292-81379314 GGGGCAGGGGGCAGAGCAGCAGG + Intergenic
1153070434 18:1098565-1098587 GGGACCGGGCGCTGTGGAGCGGG - Intergenic
1154492361 18:14931967-14931989 GGGGCCTGGGACAGTACAGGAGG - Intergenic
1154940811 18:21111446-21111468 CGGGCCGGGCCGAGTAGAGCCGG - Exonic
1159818879 18:73114351-73114373 GGGACAGGCTGCAGTACAGCAGG + Intergenic
1161398269 19:4056205-4056227 GAGGCTGGGGGCAGGACAGCTGG - Intronic
1162611531 19:11758666-11758688 GGGGTGGGGCGCAGTTCAGGAGG - Intergenic
1163444934 19:17340713-17340735 GGGGCGGGGCACAGCACAGGAGG - Intronic
1163444963 19:17340825-17340847 GGGGCGGGGCACAGTGCAGGGGG - Intronic
1165914186 19:39247836-39247858 GGAGCCGAGCGCAGGACTGCGGG + Intergenic
1165916687 19:39265102-39265124 GGAGCCGAGCGCAGGACTGCGGG - Intergenic
1166388091 19:42393150-42393172 GGGGCTGGGAGCAGAACAGGAGG + Intergenic
1166878248 19:45911365-45911387 GAGGCCAGGTGCAGGACAGCTGG - Intergenic
1168207530 19:54862385-54862407 AGGCCCAGGTGCAGTACAGCAGG - Intronic
1168406128 19:56111571-56111593 GGGGCCGGGGGCAGCAGAGGAGG + Intronic
925367129 2:3318151-3318173 AGGGCAGGGCGCAGACCAGCAGG + Intronic
928723067 2:34142561-34142583 GGGACCGGGCGCTGTGGAGCAGG + Intergenic
932178331 2:69622374-69622396 GGGACCGGGCGCTGTGGAGCAGG - Intronic
937073803 2:119086161-119086183 GGTGCCGGGGGCAGTACCCCTGG - Intergenic
938376957 2:130814310-130814332 GGGGCCAGGCCCAGCAAAGCAGG - Intergenic
941476537 2:165957090-165957112 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
943494698 2:188606421-188606443 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
943955005 2:194176698-194176720 GGGACCGGGCGCCGTGGAGCAGG - Intergenic
946982138 2:225229571-225229593 GGGGCAGGGCTCAGGACTGCAGG - Intergenic
1170578503 20:17681625-17681647 GGGGCGGGGCGGCGCACAGCTGG - Intronic
1171271490 20:23821898-23821920 GGGGCTGAGAGCAGAACAGCAGG - Intergenic
1171300672 20:24057670-24057692 GGGGCCGGGTGCAGTAGCTCAGG + Intergenic
1172627110 20:36353589-36353611 GGGCCCAGGAGCCGTACAGCTGG + Intronic
1174211637 20:48883857-48883879 GGGGCCGGGCGCAGTGGCTCAGG + Intergenic
1175371460 20:58495795-58495817 GGTGCCGGGCGCAGTGTGGCAGG - Intronic
1176019794 20:62956810-62956832 TGGAGCGGGCGCAGTACAGAAGG - Exonic
1176025040 20:62981523-62981545 GGGGCCGAGGGGAGTCCAGCAGG - Intergenic
1176511207 21:7749682-7749704 GGATCAGGGCGCAGTACAGGGGG - Intronic
1177973953 21:27824835-27824857 GGGGCCGGGCACAGTGCCTCAGG + Intergenic
1178119098 21:29450010-29450032 GGGGAGGGGTGCAGTACAGCTGG - Intronic
1178327044 21:31654519-31654541 GGGACTGGGCGCCGTAGAGCAGG - Intergenic
1178645321 21:34380211-34380233 GGATCAGGGCGCAGTACAGGGGG - Intronic
1182296043 22:29311672-29311694 GGGGCCGGCCGCGATCCAGCCGG - Intronic
1182331552 22:29554742-29554764 GAGGCAGGGCACAGTAGAGCTGG - Intronic
1183194279 22:36342771-36342793 GGGGCCTGGCGAAGTGAAGCCGG + Intronic
1184510020 22:44927954-44927976 GGGGCGGGGCGGGGCACAGCTGG + Intronic
1185384603 22:50526066-50526088 GGGGCCGGGCGCAGCCGCGCTGG - Exonic
950068907 3:10136462-10136484 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
950400919 3:12768820-12768842 GGGACCGGGCGCCGTGGAGCAGG + Intronic
953326145 3:42013807-42013829 GGGGCCGCGCGCGGGAGAGCCGG + Intronic
960669258 3:120140582-120140604 GGGACCGGGCGCCGCAGAGCAGG - Intergenic
961828924 3:129613332-129613354 GGGGGCGGGGGCAGAAGAGCTGG - Intergenic
963583391 3:147154402-147154424 GGGACCGGGCGCTGTGGAGCAGG - Intergenic
966096732 3:176213442-176213464 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
966182978 3:177203901-177203923 GGGACCGGGCGCCGCAGAGCAGG + Intergenic
966548924 3:181183057-181183079 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
966917668 3:184593848-184593870 GTGGCCAGGCGCAGGACAGTAGG + Intronic
967268428 3:187712999-187713021 GTGGCAGGGCCCAGGACAGCAGG + Intronic
968642456 4:1721436-1721458 GCGGCCGGGGGCAGGACCGCAGG - Intergenic
969715960 4:8868253-8868275 CGGGCCGGGAGCGGTGCAGCGGG - Exonic
970182645 4:13415717-13415739 GGGACCGGGCGCCGTAGAGCAGG - Intronic
971377055 4:26063996-26064018 GGGACTGGGCGCCGTGCAGCAGG + Intergenic
973190259 4:47378069-47378091 GGGACTGGGCGCCGTAGAGCAGG + Intronic
973764247 4:54149335-54149357 GGGGCCGGGCGCCGCGGAGCAGG + Intronic
974792715 4:66712443-66712465 GGGACTGGGCGCTGTACAGCAGG + Intergenic
974992052 4:69105035-69105057 TTGGCTGGGCGCAGTCCAGCAGG - Intronic
975401514 4:73944315-73944337 GGGGCGCGGCGCAGTTCACCGGG + Intergenic
976690545 4:87863696-87863718 GGGACCGGGCGCTGCAGAGCAGG + Intergenic
978241834 4:106525371-106525393 GGGGCTGGGCGCCGTGGAGCAGG + Intergenic
979033174 4:115678527-115678549 GGGACCGGGCGCCGCAGAGCAGG + Intergenic
979308375 4:119174120-119174142 GGGACTGGGCGCAGTGGAGCAGG - Intronic
980698797 4:136395651-136395673 GGGACTGGGCGCAGTGGAGCAGG - Intergenic
984238765 4:177193222-177193244 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
986626228 5:9725662-9725684 GGGGCTGGGCGCCGTGGAGCAGG - Intergenic
990557617 5:56951802-56951824 GGGGCAGGGCTCACTGCAGCCGG + Intronic
991427132 5:66503569-66503591 GGGACTGGGCGCAGTGGAGCAGG - Intergenic
994570354 5:101506363-101506385 GGGACCGGGCGCTGTGGAGCAGG - Intergenic
994620400 5:102155275-102155297 GGGACCGGGCGCCGTGGAGCAGG - Intergenic
997585263 5:135039894-135039916 GGGGCGGCGCGCAGTCCCGCCGG + Intronic
1000432319 5:161166183-161166205 GGGACTGGGCGCTGTGCAGCAGG + Intergenic
1001636499 5:173213766-173213788 GGGACCGGGCGCCGTGGAGCAGG - Intergenic
1002341541 5:178519410-178519432 GGGTCCAGGAGCAATACAGCAGG + Intronic
1002721068 5:181261666-181261688 GGATCCGGGCGCCGCACAGCTGG + Intergenic
1002741683 5:181439016-181439038 GGGGCAGGGGGCAGCAGAGCTGG - Intergenic
1002906974 6:1456996-1457018 GGGACTGGGCGCCGTAGAGCAGG + Intergenic
1003176911 6:3758452-3758474 GGGACTGGGCGCCGTAGAGCAGG - Intergenic
1003581492 6:7344550-7344572 GGGACTGGGCGCTGTAGAGCAGG - Intronic
1003836162 6:10074735-10074757 GGGACCGGGCGCCGTGGAGCAGG + Intronic
1003965188 6:11246254-11246276 GGGGCCTGGCACAGGGCAGCCGG + Intronic
1004499623 6:16198126-16198148 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
1004883753 6:20032665-20032687 GGGACCCGGCGCTGTAAAGCAGG - Intergenic
1004905471 6:20233508-20233530 GGGACCGGGCGCTGTGGAGCAGG - Intergenic
1006097406 6:31664748-31664770 GGGGCCGGACGCAGGACCTCTGG - Intronic
1009587702 6:65627876-65627898 GGGACTGGGCGCCGTAGAGCAGG - Intronic
1018624591 6:165765312-165765334 GGGACTGGGCGCTGTAGAGCAGG + Intronic
1018754355 6:166836990-166837012 GGGACCTGGCCCAGCACAGCGGG + Intronic
1018876645 6:167827275-167827297 GGGGCGGGGCGCGGCGCAGCGGG - Intronic
1019112293 6:169725187-169725209 GGGGCGGCCCGCCGTACAGCTGG + Intronic
1019246823 6:170714780-170714802 GGGGCAGGGGGCAGCAGAGCTGG - Intergenic
1019743660 7:2688115-2688137 GGGGCCGCGGGCAGGACAGGAGG - Intronic
1020103394 7:5408056-5408078 GTGGCCGGGCGCAGTAGGGGTGG + Intronic
1020288847 7:6706836-6706858 GGGGCTGGGCGCCGAAGAGCCGG - Exonic
1021877186 7:25059919-25059941 GGGGGCGGGGACAGCACAGCAGG - Intergenic
1023378038 7:39577733-39577755 GGGACCGGGCGCAGCAGAGCAGG - Intronic
1027512551 7:79101441-79101463 GGGGCCGGGCGCAGTGTCTCAGG + Intronic
1029407154 7:100382067-100382089 GGGACCGGGCGCCGTGGAGCAGG - Intronic
1031043296 7:116861488-116861510 GGGGCCGGGCGCGGTAGCTCAGG - Intronic
1034097968 7:148426743-148426765 GGGACTGGGTGCCGTACAGCAGG - Intergenic
1034223004 7:149460197-149460219 GGGGCCGCGCGCAGTAGCGGCGG - Intronic
1034488847 7:151382205-151382227 GGGCCCGGGCGGTGTTCAGCAGG - Intronic
1035412210 7:158654063-158654085 GGGGCCAGGGGGAGTGCAGCTGG - Intronic
1035501318 8:93180-93202 GGGGCAGGGGGCAGCAGAGCTGG + Intergenic
1035622979 8:1048502-1048524 GGGGCCTTGCGGAGTATAGCAGG - Intergenic
1039484398 8:37899602-37899624 GGGGCGGGGCGCGGCGCAGCAGG - Intergenic
1039936627 8:42051748-42051770 GAGGCCTGGCGCAGAGCAGCGGG + Intronic
1039983696 8:42429871-42429893 GGGGCCGGGCACAGTAAGGGAGG + Intronic
1042169438 8:65977822-65977844 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
1042948707 8:74179557-74179579 GGGACCGGGCGCTGTGGAGCAGG + Intergenic
1043502831 8:80873902-80873924 GGGGCCGGGCCCGGGACAGGGGG + Intronic
1045596195 8:103659428-103659450 GGGGCCCTGAGCAGTGCAGCTGG - Intronic
1045743296 8:105387357-105387379 GGGACTGGGCGCCGTAGAGCAGG + Intronic
1047024543 8:120811772-120811794 GCGGCCGGGCGCAGCGGAGCGGG - Exonic
1048923649 8:139252178-139252200 AGGGCCGGGGGCAGAACAGGGGG - Intergenic
1049235159 8:141508546-141508568 GGGGCAGGGCGCATTCCAGGAGG - Intergenic
1049399026 8:142416589-142416611 AGGGCTGGGCCCAGGACAGCTGG + Intergenic
1049453633 8:142676064-142676086 GAGGCCGGGGCCAGGACAGCCGG - Intronic
1051314127 9:15810424-15810446 GGGACCGGGCGCTGTGGAGCAGG + Intronic
1051774521 9:20620564-20620586 GGGGCGGGGAGCGGGACAGCGGG + Intronic
1053547861 9:39042383-39042405 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
1055774073 9:79749086-79749108 GGGGCGGGGGGCAGTGCAGTGGG + Intergenic
1060305329 9:122406225-122406247 GGGACTGGGCGCCGTAGAGCAGG + Intergenic
1061483881 9:130910456-130910478 GGGACCGGGCGCTGTGGAGCAGG - Intronic
1062146161 9:134991059-134991081 GGGACCGGGCACAGTGGAGCAGG + Intergenic
1062370175 9:136234757-136234779 TGGGGCGGGCGCAGTGGAGCTGG - Intronic
1062370197 9:136234834-136234856 TGGGGCGGGCGCAGTGGAGCTGG - Intronic
1203607595 Un_KI270748v1:70232-70254 GGGGCAGGGGGCAGCAGAGCTGG - Intergenic
1186448385 X:9651991-9652013 GGGTCCAGGCACAGCACAGCTGG + Intronic
1190413917 X:50163357-50163379 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
1194890440 X:99372098-99372120 GGGACCGGGCGCAGTGGAGCAGG + Intergenic
1194931114 X:99888228-99888250 GGGGCCGGGCGAGGTACCCCAGG - Intergenic
1196775560 X:119333929-119333951 GGGACTGGCCGCAGTAGAGCAGG - Intergenic