ID: 900663040

View in Genome Browser
Species Human (GRCh38)
Location 1:3795661-3795683
Sequence CAGGAGAAGGGGGAGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1162
Summary {0: 2, 1: 0, 2: 4, 3: 113, 4: 1043}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900663027_900663040 30 Left 900663027 1:3795608-3795630 CCAGTTAACAGAATGCGGGGGAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 900663040 1:3795661-3795683 CAGGAGAAGGGGGAGTTGGAAGG 0: 2
1: 0
2: 4
3: 113
4: 1043
900663031_900663040 -1 Left 900663031 1:3795639-3795661 CCACCTAGTATGTTGGTGTGGCC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 900663040 1:3795661-3795683 CAGGAGAAGGGGGAGTTGGAAGG 0: 2
1: 0
2: 4
3: 113
4: 1043
900663032_900663040 -4 Left 900663032 1:3795642-3795664 CCTAGTATGTTGGTGTGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 161
Right 900663040 1:3795661-3795683 CAGGAGAAGGGGGAGTTGGAAGG 0: 2
1: 0
2: 4
3: 113
4: 1043

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900663040 Original CRISPR CAGGAGAAGGGGGAGTTGGA AGG Intronic
900113698 1:1019978-1020000 AAGGAGGAGGGGGAGGAGGAGGG + Intergenic
900304127 1:1994900-1994922 AAAGAGAAGCGGGAGGTGGAGGG + Intronic
900357751 1:2272909-2272931 CAGGCGGAGGGGGAGGTGGTAGG + Intronic
900520030 1:3100970-3100992 CTGGAGGAGGGGGCATTGGAGGG + Intronic
900612863 1:3551721-3551743 CCCGAGATGGGGGAGCTGGATGG + Intronic
900663040 1:3795661-3795683 CAGGAGAAGGGGGAGTTGGAAGG + Intronic
900877109 1:5350635-5350657 AAGGAGAAGGTGGAGGGGGAGGG + Intergenic
901264915 1:7903032-7903054 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264924 1:7903059-7903081 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264933 1:7903086-7903108 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264942 1:7903113-7903135 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264956 1:7903158-7903180 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264970 1:7903203-7903225 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264979 1:7903230-7903252 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264993 1:7903275-7903297 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901265002 1:7903302-7903324 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901463263 1:9404344-9404366 CAGGAGAACCGGGAGAAGGAAGG + Intergenic
901483247 1:9540087-9540109 CAGGAGAAGGGGGCGGGGGAGGG - Intronic
901535800 1:9882451-9882473 GAGGAGAAGGAGGAGTTGGTAGG + Intronic
901751694 1:11413918-11413940 GAGGAGAAGGGGGAGAAGGAGGG - Intergenic
902026713 1:13389567-13389589 TAGGAGAAGTGGGGGTTGCAGGG + Intergenic
902083353 1:13836969-13836991 CAGGGGAAGGTGGGGTGGGAGGG - Intergenic
902188436 1:14743099-14743121 CAGGAGTAGGGAGAGTTCCATGG + Intronic
902525266 1:17053432-17053454 CAGGGGAAGGGAGAGATGGAGGG - Intronic
902641871 1:17772011-17772033 CAGGAGAACAGGGAGGTGGTGGG + Intronic
902668236 1:17954135-17954157 GAGGAGGAGGGGAAGTTAGAAGG + Intergenic
902775767 1:18673861-18673883 AAGCAGAAGGGGGAATTCGACGG + Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903493810 1:23750912-23750934 CAGAAGGAGGAGGAGATGGAGGG + Exonic
903533547 1:24050868-24050890 AAGGAGGAGGGGGACTTGTACGG + Intergenic
903578609 1:24354435-24354457 CTGGACATGGGGGAGCTGGACGG + Intronic
903705129 1:25280029-25280051 CAGGAGAAGTGGGAGGATGAGGG + Intronic
904044881 1:27603167-27603189 AAGGGGGAGGGGGAGGTGGACGG - Intronic
904084586 1:27896004-27896026 CAGGAGAAGAGGCTGATGGAGGG - Intronic
904254172 1:29244038-29244060 AAGGAGAAAGGGGGCTTGGAGGG + Intronic
904698106 1:32341846-32341868 CAGGGGAAGGGGGAGGGGAAGGG - Intergenic
904890146 1:33773643-33773665 GAGGAGGAGGGGGTGGTGGAGGG + Intronic
904962049 1:34341068-34341090 CAGGATGAGGAGGACTTGGAGGG - Intergenic
905532112 1:38688079-38688101 CAGGAGGAGGAGGAGTAGCAGGG - Intergenic
905616946 1:39408283-39408305 CTTGAGAAGGGGGAGAGGGAAGG + Intronic
905980545 1:42221965-42221987 AAGAAGAAGGGGGAGGGGGAGGG + Intronic
906190380 1:43895235-43895257 CAGGATAAGGAAGGGTTGGAAGG - Intronic
906298358 1:44662870-44662892 CAGGAGGAGGGGCAGTTGGGAGG - Intronic
906511142 1:46411069-46411091 AAGAGGATGGGGGAGTTGGAGGG + Intronic
907734365 1:57097415-57097437 CAGGAGAAGAAGGAGCTGGAGGG + Intronic
908121759 1:60992406-60992428 CAGGAGAAGGGTGTGATGGTGGG + Intronic
908456582 1:64310161-64310183 AAGGAAAAGGGGGAATTGGAAGG + Intergenic
908513941 1:64873331-64873353 CAGGAGAAGCTGGAGTTTGTGGG - Intronic
909043807 1:70685878-70685900 GAGGAGAGGGGGGATTTGGGGGG + Intergenic
909209656 1:72807706-72807728 AAGGAGAGGGAAGAGTTGGAAGG - Intergenic
909263566 1:73527039-73527061 TAGTAGATGGGGGAGTTGGAAGG - Intergenic
910278739 1:85475323-85475345 GAGGAGAAGGGGGAGGAGGAGGG + Intronic
910991497 1:93061301-93061323 CAAGAGAAGGATGAGATGGAAGG - Intergenic
911060338 1:93742048-93742070 CAGGAGAATGGAGAGTTGTCTGG + Intronic
911330977 1:96525474-96525496 CAGGATAAGTGGGAGTTGACAGG - Intergenic
911686056 1:100779110-100779132 CAGGAGAAAGGGGTGGTGAATGG - Intergenic
912662363 1:111543681-111543703 GAGGAGGAGGGGGAGAGGGAGGG + Intronic
912681249 1:111730342-111730364 CAGGAGCAGGGGTAGTTGAATGG - Intronic
912720986 1:112019793-112019815 AAGGAGAAGAGGGAGTTAAAAGG + Intergenic
912794841 1:112686693-112686715 CAAGAGGAGGAGGGGTTGGAGGG - Intronic
914319690 1:146547005-146547027 AAGGAGAAGTGGGGTTTGGAAGG + Intergenic
914918134 1:151830805-151830827 CAGGAGCAAGGGGAGGTGGGCGG - Intronic
915267942 1:154732142-154732164 CAGGGGAAAGTGGAGATGGAGGG - Intronic
915393123 1:155562313-155562335 GAGGAGAAGGGAAAGGTGGAAGG + Exonic
915409278 1:155688219-155688241 GAGGAGAAGGGAAAGGTGGAGGG + Exonic
915591325 1:156872316-156872338 CATGAGATGGGAGAGTGGGATGG - Intronic
915939897 1:160112401-160112423 GAGGAGGAGGGAGAGTGGGAGGG - Intergenic
915948879 1:160174434-160174456 CAGGAGGAGTGGGAGAAGGACGG + Intronic
916337355 1:163688203-163688225 CGGGAGTAGGGAGAGATGGAAGG - Intergenic
916863971 1:168836742-168836764 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
916900297 1:169215109-169215131 CAGTGGAAAGGGGAGCTGGAGGG + Intronic
917594595 1:176516354-176516376 CAGGGGATGGGGGAGTGGGGAGG - Intronic
918280877 1:183004494-183004516 CAAGAGAAGAGAGAGTTGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919914451 1:202130892-202130914 CAGCAGGAGGGAGAGGTGGAGGG - Exonic
920129481 1:203720738-203720760 CAGGTGAAGGGGGTGTGGGTGGG + Exonic
920294650 1:204948486-204948508 CTGGAGAAGGGTGAGTGAGAGGG - Intronic
920297341 1:204967118-204967140 CAGGACAAGGGAAAGGTGGAGGG - Intronic
920675199 1:208033512-208033534 GAGGAGAAGGGGTTGGTGGAGGG + Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
922213277 1:223501245-223501267 GAGGAGAAGGAGGAGTAGGAGGG - Intergenic
922271983 1:224043367-224043389 CGGGAGAGGGGAGTGTTGGACGG - Intergenic
922504020 1:226115948-226115970 GAGGGGGAGGGGGAGGTGGAGGG + Intergenic
922520100 1:226242790-226242812 GAGGAGAAGGAGGAAGTGGAGGG - Intronic
922768611 1:228169695-228169717 CAGGAGTTAGGGGAGATGGATGG - Intronic
922873402 1:228921056-228921078 CAGGAGCAGGGAGAGGCGGAGGG + Intergenic
922936344 1:229425936-229425958 GAGGAGGAGGGGGAGGAGGAAGG + Intergenic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923373896 1:233340591-233340613 CAGGGGAAGGGGGAGGCAGATGG + Intronic
923790224 1:237105362-237105384 CAGGATAAGGGGGTGATGGAGGG + Intronic
924077342 1:240353980-240354002 CAGGACTAGAGGGAGATGGATGG + Intronic
924190441 1:241546143-241546165 CAGGAGAAGGGCAAACTGGAAGG - Intronic
924250993 1:242133004-242133026 GAAGAGAGGGGGGAGTGGGAGGG - Intronic
1062806472 10:423819-423841 GAGGAAAACGGGGAGGTGGAGGG - Intronic
1062895746 10:1101863-1101885 CAGGACAAGGGGCAGCTGGATGG - Intronic
1063968774 10:11367153-11367175 GAGGAGAAGGGGGAGGGGAATGG - Intergenic
1064029445 10:11874624-11874646 GAGGAGGAGGGGGAGGAGGAAGG + Intergenic
1065297330 10:24289437-24289459 GAGGAGAAGGTGGAGGAGGAGGG + Intronic
1065326633 10:24555414-24555436 CAGGAGAAGTGGGAGAAGCAGGG - Intergenic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1065695580 10:28376681-28376703 CAGGAGAAGGGGGCAGTGGGTGG + Intergenic
1065973684 10:30824502-30824524 CAGAAGAAGGAGGAGATGGAGGG - Intronic
1066017335 10:31260916-31260938 AAGGAGAAGGAGTAGTAGGAGGG - Intergenic
1066440215 10:35431364-35431386 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1067727649 10:48782905-48782927 CAGGAGCAAGGTGGGTTGGAGGG + Intronic
1067827783 10:49591837-49591859 CAGGAAAAAGAGGAGTTGGGGGG + Intergenic
1068478821 10:57563198-57563220 GAGGAGAAGGAAGAGTGGGAAGG - Intergenic
1068774747 10:60857499-60857521 CAGGGAAAGGGGGAGATTGAGGG + Intergenic
1069631345 10:69898672-69898694 GAGGAGAAAGATGAGTTGGAGGG - Intronic
1069633827 10:69913593-69913615 CAGGAGGCGGGGGAGGGGGAGGG - Intronic
1069755977 10:70774653-70774675 AAGGAGAAGGGGGAGGAGGAAGG - Intronic
1069872768 10:71543181-71543203 CAGGAGTACAGGGAGTTGGGTGG + Intronic
1069942294 10:71964200-71964222 GAGGAGAAGGAGGAGCTGGCGGG - Intergenic
1070179223 10:73998286-73998308 CACGAGGAGGGCGAGGTGGACGG + Exonic
1070219163 10:74422743-74422765 TAGGTAAAGGGGGAGTGGGAAGG - Intronic
1070404903 10:76085967-76085989 CATGAGAAGGAGGAGGTGGGAGG - Intronic
1071377520 10:85024007-85024029 CAAGGGAATGGGGAGTAGGAGGG - Intergenic
1071418542 10:85464337-85464359 AAGGAGAAGGAAGAGTGGGAAGG + Intergenic
1071755556 10:88534813-88534835 TAGGAAATGTGGGAGTTGGAGGG + Intronic
1071807683 10:89142542-89142564 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1072195747 10:93116051-93116073 GAGGAGGAGGGGGAGGGGGAGGG + Intergenic
1072210447 10:93241519-93241541 CAGGAGAAGTTGGAATTGGGTGG - Intergenic
1072313221 10:94177309-94177331 CATGAGAAGGGGGAATGGGGAGG - Intronic
1072750420 10:97974911-97974933 CAGGAGGAGGGAGAGACGGAGGG + Intronic
1073064944 10:100752750-100752772 GAGGGGCAGGGGGTGTTGGACGG - Intronic
1073065152 10:100754113-100754135 CTGGAGAGGGGAGAGGTGGAGGG + Intronic
1073111193 10:101063868-101063890 AAGGGGAAGGGGGATCTGGAAGG + Intronic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073441487 10:103555283-103555305 GAGGAGACGGGGGAGGAGGAGGG + Intronic
1073464126 10:103684028-103684050 CAGCAGCAGAGGGAGATGGAGGG - Intronic
1073821153 10:107265565-107265587 CAGAAGTAGGGGGAGTTGGGTGG - Intergenic
1074306742 10:112286143-112286165 CAGGAGAAGGAGTAGTTGACAGG - Exonic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074691129 10:116005057-116005079 CAGGAGGAGAAGGAGATGGAGGG - Intergenic
1075108731 10:119560506-119560528 GAGGGGGAGGGGGAGGTGGAGGG + Intergenic
1075475533 10:122730523-122730545 CAGGAGGAGGGGGAACAGGAAGG + Intergenic
1075534979 10:123263289-123263311 AAGGAGGAGGAGGAGCTGGAGGG + Intergenic
1076100698 10:127775387-127775409 CAGGAGAGAGGAGAGTTGGTGGG - Intergenic
1076302965 10:129441840-129441862 GAGGGGGAGGGGGAGTTGCAGGG - Intergenic
1076312260 10:129517057-129517079 CTGGAGAAGCTGGAGTGGGAGGG - Intronic
1076437917 10:130459306-130459328 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076437924 10:130459336-130459358 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1077046990 11:551105-551127 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
1077128140 11:953656-953678 CAGGAAAAAGGGGAGGTGCAGGG - Intronic
1077294250 11:1817156-1817178 CAGGGGCTGGGGGAGGTGGAGGG + Intergenic
1077555170 11:3222501-3222523 CACGAGAAGGGGCTGTGGGAGGG - Intergenic
1078510032 11:11978175-11978197 CAGGAGAAGGTTGAGAAGGAAGG + Intronic
1079092644 11:17491863-17491885 GAGGAGCCGGGGGAGGTGGATGG - Intergenic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1080141297 11:28923505-28923527 CAGGATAAGGGTGATTTGGGCGG + Intergenic
1080290551 11:30666065-30666087 AAGGAGAAGGGGGAGAAGGAGGG + Intergenic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1081075461 11:38667805-38667827 GAGGTGGATGGGGAGTTGGAAGG + Intergenic
1081361423 11:42184773-42184795 CAGGGGAAGAGAGAATTGGAGGG + Intergenic
1081701328 11:45154714-45154736 CGGGAGAAGGTGCAGTTGGGAGG - Intronic
1081937642 11:46916625-46916647 CTAGGGAAGGGGGAGCTGGAAGG - Intronic
1082762068 11:57136798-57136820 GAGGAGGAGGGGGAGGGGGAGGG + Intergenic
1082835756 11:57649177-57649199 TAGGAGAAAGGGGAGAGGGAGGG + Exonic
1082960285 11:58913115-58913137 CAGGAGATGGGGCAGAGGGAGGG + Intronic
1082987632 11:59182077-59182099 CAGGAGCAGGGGGACATGGGGGG - Exonic
1083068660 11:59952630-59952652 CAGAAGAGGGGGAAGTTGGGAGG + Intergenic
1083105740 11:60356826-60356848 CAGGAGAAGGGTGGGGTGGGTGG - Intronic
1083148804 11:60777178-60777200 AAGGAGGAGGGGGAGTTTGTTGG - Intergenic
1083437054 11:62649749-62649771 CATGAGAGGGTGGAGGTGGACGG + Exonic
1083618846 11:64039146-64039168 CAGAGCAAGGGGGAGCTGGAGGG + Intronic
1083630115 11:64091008-64091030 TAGGAGAAGGGGGAGGAGGGAGG + Intronic
1083827584 11:65212090-65212112 AAGGAGATGGAGGGGTTGGAGGG - Intergenic
1083884630 11:65566412-65566434 AAGGAGGAGGGGGAGGGGGAGGG - Intergenic
1083886763 11:65576872-65576894 CTGAAGAGGCGGGAGTTGGAGGG - Intronic
1083887858 11:65581507-65581529 GAGCAGGAGGGGGAGTTGGGGGG - Intronic
1083944930 11:65918567-65918589 CAGGAAAAGGGGGCCTTGGCAGG - Intronic
1084164479 11:67368756-67368778 CAGGCAGAGGGTGAGTTGGAGGG + Intronic
1084507036 11:69574787-69574809 CGGGTGAAGGGAGAGTTGCAGGG - Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084830301 11:71763591-71763613 CAGCAGATGGGGGAGTCAGAAGG - Intergenic
1084860750 11:72016421-72016443 CAGGAGAAGGGCGAGGTGCTGGG - Exonic
1085409623 11:76283412-76283434 GAGGAGAAGGGGGAAGGGGAGGG + Intergenic
1085413412 11:76305340-76305362 CTGGAGAAGGCAGAGTTGGGAGG + Intergenic
1085452387 11:76642478-76642500 CAGGAGAAGGCGGAGCTTGGAGG - Intergenic
1085508248 11:77072239-77072261 CAAGAGATGGAGGAGGTGGAAGG - Intronic
1085661977 11:78376705-78376727 CATGATGAGGGAGAGTTGGAGGG + Intronic
1085886339 11:80526733-80526755 CAGAAGAGGGGAGGGTTGGATGG + Intergenic
1086165445 11:83772486-83772508 AAGGAGAAGGGGGAGGGGAAGGG + Intronic
1086404387 11:86487541-86487563 GAGGAGAGGGGGGAGTAAGAAGG + Intronic
1086490657 11:87355122-87355144 CATGAGACGGGGAAGGTGGATGG - Intergenic
1087259048 11:95990343-95990365 CACGAGAAGGGGGAATTGATGGG - Intronic
1087487174 11:98770785-98770807 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1088063475 11:105686218-105686240 CTAGAGAAGGGAGAGATGGAGGG - Intronic
1088568308 11:111196492-111196514 CAGGAGACAGGGTTGTTGGAGGG + Intergenic
1088598727 11:111457711-111457733 AAGGAGGAGGGGGAGAGGGAGGG - Intronic
1088715698 11:112547393-112547415 TAGGAGACGGGGGAGTTGAGGGG - Intergenic
1088746278 11:112807642-112807664 CAGGGGAAGTGGAAGTTAGAGGG + Intergenic
1088821776 11:113462887-113462909 CAGGAGAAGGGGGAGTTTCTGGG - Intronic
1089124330 11:116165871-116165893 CAGGAGAAAGAAGAGTGGGATGG + Intergenic
1089542785 11:119200379-119200401 CAGGAGAAGGAGGTGGTGGAGGG - Intergenic
1089602985 11:119626565-119626587 CAGGGGAAGGGGGAGATGAAAGG + Intronic
1089605847 11:119640776-119640798 CAGCAGAAGGAGGAACTGGAAGG - Intronic
1089628702 11:119770108-119770130 CAGGGGACGGGGGAGTGGGTAGG + Intergenic
1089842667 11:121431825-121431847 CAAGAGAAAGGGGGATTGGATGG - Intergenic
1090391777 11:126393466-126393488 CAGGAGGAGGGGGATGGGGACGG + Intronic
1090610638 11:128467540-128467562 AGGGATAAGGGGGAGTTGCAGGG - Intronic
1091041235 11:132283932-132283954 CAGGAAAAGGGCGGGATGGAGGG - Intronic
1091209171 11:133842118-133842140 GAGGAGAAGGGCCAGGTGGAGGG + Intronic
1091224025 11:133946946-133946968 CCGCAGAGGGGGGAGTGGGAGGG + Intronic
1091319385 11:134639262-134639284 GAGGGGAAGGAGGACTTGGAGGG + Intergenic
1091718196 12:2794747-2794769 CAGGAGAAGGGGGAGGGGGCAGG + Intergenic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092052274 12:5480345-5480367 CGGGAGGAGGGGGAGCTGGGTGG + Intronic
1092227115 12:6754588-6754610 GAGGATAAGGGGAAGTTGCATGG - Intronic
1092382915 12:8012530-8012552 CTGCAGTAGGGGGAGTTGGGTGG + Intergenic
1092483383 12:8880624-8880646 CTGGTGAACGGGGAGTGGGAGGG + Intronic
1092817118 12:12322132-12322154 CAGGAGAATGGGGAGATGGATGG - Intergenic
1093084571 12:14852454-14852476 GAGGAGGAGGGGGAGGGGGAGGG - Intronic
1093110262 12:15143780-15143802 GAGAAGAAAGAGGAGTTGGAGGG + Intronic
1094797610 12:33994198-33994220 CATGAGAAGGTAGAGTTGAAAGG - Intergenic
1095889026 12:47218590-47218612 CAGGAGGAGGCTGAGGTGGAAGG - Intronic
1095954809 12:47799874-47799896 CTGGAGAAGGGGAAGTGGGTGGG + Intronic
1096001048 12:48130956-48130978 AAGGAGAAGGGGAAGTTGGTGGG - Intronic
1096178140 12:49536640-49536662 GAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1096204003 12:49706763-49706785 CAGCAGAAGGGGGAGGAAGAAGG + Intronic
1096292622 12:50353933-50353955 CAGGAGAAGGGAGAAAGGGAAGG - Exonic
1096509434 12:52119614-52119636 CAGGAGGAGGGGCAGCAGGAGGG - Intergenic
1096528415 12:52228127-52228149 AAGGAGGAGGGGGAGGGGGAGGG - Intergenic
1096597155 12:52703156-52703178 GGGGAGTAGGGGGATTTGGAGGG - Exonic
1096862511 12:54539996-54540018 GAGGAGAAGGGGGACTGGGCTGG + Intronic
1097339287 12:58419142-58419164 CAGCAGAGAGGGGAGCTGGAAGG - Intergenic
1097384639 12:58934742-58934764 CAGGAGGAGGGAGTGTTGCAAGG - Intergenic
1098035636 12:66299596-66299618 GAGGAGGAGGGGGAGGTGGAGGG - Intergenic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098138887 12:67431402-67431424 AGGGAAAAGGGGGAGTTTGATGG - Intergenic
1098311610 12:69154363-69154385 CAGGAAGAAGGGGAGTTGGCAGG + Intergenic
1099680812 12:85825367-85825389 GATGAGAAGGGGGAGTTTTAGGG + Intronic
1099959179 12:89380408-89380430 GAGGAGAAGGGGGAGGGGGAAGG - Intergenic
1100121918 12:91378482-91378504 CAGAATAAGGGGAAGTTTGAGGG - Intergenic
1100606303 12:96154625-96154647 CAGGAGGAGGGGCCTTTGGAAGG + Intergenic
1100616072 12:96232615-96232637 CAGGAGATGGGGGAGGGGGCGGG + Intronic
1101242009 12:102848309-102848331 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1101242036 12:102848449-102848471 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1101242050 12:102848519-102848541 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1101242113 12:102848868-102848890 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1101746718 12:107547210-107547232 AAGGAGAAGGGGGAGGGGGAGGG + Intronic
1102175199 12:110868749-110868771 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1102223095 12:111208034-111208056 AAGGAGAAGGGGAAGTGGGAGGG + Intronic
1102640532 12:114362513-114362535 TAGGAGAAGGGGGAGGTGTGAGG - Intronic
1102804449 12:115767280-115767302 CAGGAGAATGGAGACTTTGATGG + Intergenic
1102808084 12:115799659-115799681 AAGAAGAAGGGGGGGTTGGGGGG + Intergenic
1102866897 12:116381880-116381902 CTGGGGAGAGGGGAGTTGGAGGG - Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103003757 12:117405937-117405959 CAGGAGAATGGGGACATGGAAGG - Intronic
1103080936 12:118023457-118023479 GAGGAGAAGGCGGAGGAGGAGGG + Intronic
1103235352 12:119368078-119368100 AAGGAGGAGGGGGAGGAGGAGGG + Intronic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1103561332 12:121794601-121794623 CAGGGGATGGGAGAGTTGGGGGG - Intronic
1103567256 12:121822997-121823019 CAGGGGAAGGGGCAGAGGGAGGG - Exonic
1103702969 12:122857177-122857199 CAGGAGCAGGGCGAGTTGCAGGG + Exonic
1103947144 12:124532908-124532930 AAGGAGGAGTGGGACTTGGAGGG - Intronic
1103947183 12:124533027-124533049 GAGGAGGAGTGGGATTTGGAGGG - Intronic
1104222277 12:126796582-126796604 AAGGAGAAAGGGAGGTTGGAAGG - Intergenic
1104430154 12:128709752-128709774 GAGGAGAACGGGGAGTAGGGAGG - Intergenic
1104512649 12:129394566-129394588 CTGGAGAAGGGGGAGACAGAGGG + Intronic
1104755263 12:131265152-131265174 CAGGGGCTGGGGGAGTGGGAGGG + Intergenic
1104936603 12:132367813-132367835 CGGGAGAACAGGGAGTGGGAAGG - Intergenic
1105358865 13:19687570-19687592 GAGGAGAAAGGGCAGATGGAAGG - Intronic
1105510034 13:21043499-21043521 CAAGAAAAGTGTGAGTTGGAGGG + Intronic
1105579490 13:21681119-21681141 AATGAGAAGGGGGAGCTGTATGG + Exonic
1105726246 13:23164997-23165019 CAGGAGAAGGTGCAGTGGGAGGG - Intergenic
1106071132 13:26412241-26412263 AAGGAAAAGGGGCACTTGGAGGG - Intergenic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106679952 13:31999439-31999461 GAGGAGGAGGGGGAGGGGGAGGG - Intergenic
1106948369 13:34854342-34854364 CAGGAGAAGTGGGAGTCCCAGGG - Intergenic
1107037509 13:35916871-35916893 CAGGAGAGAAGGGAGGTGGAAGG - Intronic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107112858 13:36716699-36716721 CAGGAGGAGGGTGACTTGGAGGG - Intergenic
1107210923 13:37852885-37852907 AAGGAGAAGGAAGAGTGGGAAGG + Intronic
1107440741 13:40425387-40425409 CTGGAGCAGGGTGAGGTGGAGGG - Intergenic
1108692901 13:52875812-52875834 CAGGAGGAGGGGCAGGGGGAAGG - Intergenic
1110515882 13:76411536-76411558 GAGGAGAAGGGGGAGGAAGAGGG + Intergenic
1110667100 13:78129831-78129853 AAGGAGAAAGGAGAGCTGGAGGG - Intergenic
1110916741 13:81030595-81030617 AAGGAGATGGGAGAGTGGGAAGG - Intergenic
1111075213 13:83226614-83226636 CAGGAGAAGGCTGAATTGGGTGG - Intergenic
1112419859 13:99238475-99238497 CAGGAGGAGGGCGAGCAGGAGGG - Exonic
1113159578 13:107364933-107364955 AATGAGGAGGGGGAGTGGGAGGG - Intronic
1113499233 13:110760195-110760217 CAGGAGAAGTGATGGTTGGAGGG + Intergenic
1113796539 13:113061754-113061776 GAGGGGAAGGGGGAGAGGGAAGG - Intronic
1113796550 13:113061777-113061799 GAGGGGAAGGGGGAGAGGGAGGG - Intronic
1113796562 13:113061800-113061822 GAGGGGAAGGGGGAGAGGGAAGG - Intronic
1113819491 13:113203143-113203165 CAGGAGAAGGGAGAGTCCCATGG + Intronic
1113909747 13:113836398-113836420 GAGGAGGAGGGGGAGGAGGAGGG + Intronic
1113909916 13:113836832-113836854 GAGGAGGAGGGGGAGTGGGGGGG + Intronic
1114054434 14:18954596-18954618 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1114108120 14:19447336-19447358 CAGGGGAAGGAGGAGATGGAAGG + Intergenic
1114201235 14:20522612-20522634 GAGGAGAAGGGGAAGTGGAAGGG + Intergenic
1114544474 14:23488436-23488458 CAGAAGAAGGGGGGATGGGATGG + Intronic
1114880279 14:26776407-26776429 TAGGGGAAGGGGGACTTGGCAGG + Intergenic
1114938178 14:27571245-27571267 CAGGAGAATGGAGAGTTTGAGGG + Intergenic
1115786979 14:36837323-36837345 CAGGAGAAGGAGGAGGTGAAGGG + Intronic
1116096434 14:40376380-40376402 CAAGAGGTGAGGGAGTTGGATGG - Intergenic
1116192645 14:41680035-41680057 CAGGGGAGGGAAGAGTTGGAAGG + Intronic
1116416985 14:44689853-44689875 GAGGAGGAGGGGGAGAAGGAGGG + Intergenic
1116435116 14:44887501-44887523 CAGGAGCAAGTGGAGCTGGAAGG - Intergenic
1116523804 14:45880453-45880475 CAGCAGAAAGGGGAACTGGAAGG - Intergenic
1117355321 14:54918551-54918573 CAGGGGAAGAGGGATTTAGAGGG + Intergenic
1117667851 14:58076094-58076116 GAGGGGAAGGGGGAGGGGGAAGG + Intronic
1118092613 14:62498710-62498732 AAGGAGGAGAGGGAGTTGGGAGG + Intergenic
1118171909 14:63396084-63396106 GAGGAGAAGGGGGAGGGGGCAGG + Intronic
1118301214 14:64618124-64618146 CAGGAAGAGGGGAAGTTGAAGGG - Intergenic
1118486151 14:66216019-66216041 CAGCAGAGAGGGGAGCTGGAAGG - Intergenic
1118813381 14:69291629-69291651 CAGGAGGAAAGGGAGTGGGATGG + Intronic
1119004386 14:70910097-70910119 GAGGAGGAGGGGGAGGAGGAGGG - Intronic
1119788152 14:77327825-77327847 GAGGAGAAGGAGGAGTTTGCTGG + Intronic
1119862830 14:77948878-77948900 TAGGGGAAGGGGGAGGGGGAAGG - Intergenic
1119932008 14:78556901-78556923 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1120631991 14:86902818-86902840 CAGTAGAAGCGGGAGGGGGAGGG + Intergenic
1120708888 14:87772959-87772981 CAGGACCTGGTGGAGTTGGAGGG + Intergenic
1121121844 14:91380904-91380926 AAGGAGAATGGGAACTTGGAAGG + Intronic
1121145601 14:91579473-91579495 CGGCAGGAAGGGGAGTTGGAAGG - Intergenic
1121170979 14:91854409-91854431 GAGGAGGAGGGGGAGGGGGAGGG + Intronic
1121260823 14:92564950-92564972 CAGGAGCAGTGGCAGATGGAGGG + Intronic
1121427355 14:93861958-93861980 CAGGAGGAAGGAGAGCTGGATGG - Intergenic
1121816018 14:96929128-96929150 TAGGTGAAGGGATAGTTGGATGG - Intronic
1121881088 14:97500822-97500844 TAGGAGAAGGGGGGGTGGGTGGG + Intergenic
1121887325 14:97555594-97555616 GAGGTGATGGGGGAGATGGAAGG - Intergenic
1122082414 14:99274709-99274731 GAGGAAAAGGGGGAGGAGGAGGG - Intergenic
1122204627 14:100142420-100142442 GAGGAAAAGGGGGAGTGGGCAGG + Intronic
1122389947 14:101373381-101373403 CAGCAGAAAGGGAAGTTGGAGGG - Intergenic
1122428972 14:101628035-101628057 GAGGAGACGGGGGACTGGGAGGG + Intergenic
1122447941 14:101782317-101782339 GAGGGGAAGGGGGAGAGGGAGGG - Intronic
1122448057 14:101782634-101782656 GAGGGGAAGGGGGAGAGGGAGGG - Intronic
1122782637 14:104150134-104150156 GAGGAGGAGGGGGAGGGGGACGG - Intronic
1122931757 14:104936356-104936378 CATGAGCAGGGGAAGTGGGAAGG - Exonic
1123978652 15:25578187-25578209 CAGGAGAAGGGTGTGTTTGAAGG - Intergenic
1124100810 15:26690995-26691017 CAGGAGGAGGGGGAGTGAGTGGG - Intronic
1124356630 15:29000305-29000327 CCTGAGAAGGGGGACTTTGAGGG + Intronic
1124382307 15:29177050-29177072 TGGGAGAAGGAAGAGTTGGAGGG + Intronic
1124612235 15:31216219-31216241 GAGGGGAAGGGGGAGGCGGAGGG + Intergenic
1125539341 15:40460758-40460780 CAGGGGAAGGGAGATCTGGAAGG - Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126097591 15:45100428-45100450 CAGGAGGAGGGGGAGTAGCAGGG - Intronic
1126102676 15:45129389-45129411 GAGGAGGAGGGGGGATTGGAGGG - Intronic
1126183838 15:45811383-45811405 AAGGAGAAGGAAGAGTGGGAAGG + Intergenic
1126210607 15:46097478-46097500 TTGGAGAAGGGGGATTTGGCAGG + Intergenic
1127165651 15:56243375-56243397 GAGGAGGAGGGGGAGGGGGAGGG + Intergenic
1127290522 15:57566388-57566410 CAGGAGCTGGGGGATTTGGGTGG - Intergenic
1127313153 15:57770210-57770232 GAGGACCAGTGGGAGTTGGAAGG - Intronic
1128300605 15:66564396-66564418 CAAGTGAAGGGGGAGCTGAAGGG - Intronic
1128637501 15:69312606-69312628 CAGGAGAAGGGGGGTTTTCATGG - Intronic
1128647185 15:69386614-69386636 CAGGGGAGGGGGGACATGGAGGG - Intronic
1128891045 15:71332025-71332047 AAGAAGAAGGGGCAGTTGTAGGG + Intronic
1129741640 15:77992384-77992406 CTGGAGCAGGGGGAGGTGGCGGG + Intronic
1130059551 15:80559740-80559762 GAGGAGACGGGGGAGATGGGAGG - Intronic
1130603143 15:85291654-85291676 AAGGAGGAGGGGGACTGGGAAGG + Intergenic
1130959830 15:88652399-88652421 GAGGAGGAGGGGGAGGAGGAGGG - Intronic
1130959836 15:88652411-88652433 AAGGAGGAGGGGGAGGAGGAGGG - Intronic
1130959855 15:88652460-88652482 GAGGAGGAGGGGGAGGAGGAGGG - Intronic
1130959861 15:88652472-88652494 AAGGAGGAGGGGGAGGAGGAGGG - Intronic
1131302243 15:91209988-91210010 GAAGAGAATGGGGAGATGGAGGG + Intronic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131641573 15:94299029-94299051 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1131842945 15:96457576-96457598 TAGGAGTAGAGGGAGCTGGAGGG - Intergenic
1131948402 15:97652858-97652880 CAGGTGAACGGGGAAGTGGAAGG + Intergenic
1131951222 15:97683707-97683729 AAAGAGAAGGGGGAGGGGGAGGG + Intergenic
1132053765 15:98633935-98633957 GAGGAGGAGGGGGAGGAGGAAGG - Intergenic
1132578833 16:676012-676034 CTGGAGAAGGGAGAGTCGGGGGG + Intronic
1132983403 16:2751058-2751080 CAGGAGATGGGGGTGGTGGGGGG + Intergenic
1133044001 16:3076069-3076091 CAGCAGATGGGGGAGATGGGCGG + Intronic
1133211111 16:4263938-4263960 CAGGGGCGGGGGGAGTTGCAGGG - Intronic
1133275996 16:4638823-4638845 CCGAGGAAGGGGGAGTGGGAAGG - Intronic
1133460700 16:5984065-5984087 GAGGAGGAGGGGGAGTGGGAGGG - Intergenic
1133460711 16:5984090-5984112 GAGGAGGAGGGGGAGTGGGAGGG - Intergenic
1133536116 16:6704031-6704053 GAGGAGGAGGGGGAATTAGATGG - Intronic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1134398659 16:13889072-13889094 AAGGAGAAAGGGGAGGGGGAGGG - Intergenic
1134411016 16:14003363-14003385 CAGGAGCAGAGGGAAGTGGAAGG - Intergenic
1134692157 16:16197954-16197976 AAGGAGGAGGGGGAGAAGGAGGG + Intronic
1134770602 16:16806044-16806066 AAGGAGAAGGGGGAAGGGGAAGG - Intergenic
1135771932 16:25224419-25224441 CAGGAGCAGGGGCAGGTGGCAGG + Exonic
1136081342 16:27854319-27854341 AAGGAAAAGGGGGAGGAGGAGGG + Intronic
1136109741 16:28057270-28057292 CAGGAGCAGGGGGAGCTGCGGGG + Intronic
1136544404 16:30947587-30947609 CAGGGGCTGGGGGAGGTGGAAGG + Exonic
1136548675 16:30969885-30969907 CAGCAGAAGAGGGAGCAGGAGGG - Intronic
1136551656 16:30985370-30985392 CAGGAGTTGAGGGAGGTGGAGGG - Intronic
1137021592 16:35433162-35433184 CAGGTGAAGAGGGAGTTGTCAGG + Intergenic
1137383665 16:48021987-48022009 AATGAGCAGGGGGAGGTGGAAGG + Intergenic
1137557030 16:49477239-49477261 AAGGAGGAGGGGGAGGAGGAGGG + Intergenic
1137557041 16:49477263-49477285 AAGGAGGAGGGGGAGGAGGAGGG + Intergenic
1137605741 16:49785863-49785885 CAGGAGAAGTTGGGGTTGGCAGG + Intronic
1137629412 16:49931692-49931714 CATGAGCAGGGGGACTTTGAAGG - Intergenic
1138307090 16:55988429-55988451 GAGGAGGAGGGGGAGGGGGAGGG - Intergenic
1138641373 16:58390674-58390696 CAGGAATAGGGGCAGCTGGAGGG - Intronic
1138645055 16:58418665-58418687 CAGGAGATGAGGGAGTGGGGAGG + Intergenic
1138904132 16:61309981-61310003 CAGCTGAAATGGGAGTTGGAGGG - Intergenic
1139064189 16:63291927-63291949 CAGAAGAAGATGGAGTGGGAAGG - Intergenic
1139066777 16:63325404-63325426 GAGGAGGAGGGGAAGTTGGCAGG + Intergenic
1139610559 16:68054384-68054406 CAGAAAAAGGTGGACTTGGAAGG - Intronic
1139757687 16:69158082-69158104 CAGGACAAGGGAGAGGTGAAAGG - Intronic
1139818629 16:69700126-69700148 AGGGAGGAGGGGGAGATGGAAGG - Intronic
1139946269 16:70644702-70644724 GAGGAGGAGGGGGAGGAGGAGGG + Intronic
1140223354 16:73059172-73059194 AAAGAAAAGGGGGAGGTGGAGGG + Intronic
1140279763 16:73543827-73543849 CTGGAGAAGGGGGTGGGGGAGGG + Intergenic
1140739130 16:77925837-77925859 CAGAAGCAGGGGGAGGTGGGGGG - Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141372458 16:83500515-83500537 GAGGAGGAGGGGGAGGAGGAGGG - Intronic
1141372842 16:83503440-83503462 CAGGAGGAGGGGCAGTGAGAAGG + Intronic
1141862631 16:86728348-86728370 CAGGAGAGGGGTGAGAAGGAGGG + Intergenic
1141896052 16:86959365-86959387 AAGGGGAAGGGGAAGATGGATGG + Intergenic
1142560888 17:808186-808208 CAGGAGCAGAGGGAGGTGGGTGG - Intronic
1142899615 17:3004001-3004023 GAGGAGGAGGGGGAGTGGGGTGG + Intronic
1142920689 17:3182736-3182758 CAGGAGAAGAGAGAGTGGGGGGG + Intergenic
1142958492 17:3536624-3536646 CTGGACTAAGGGGAGTTGGAGGG + Intronic
1143082829 17:4394256-4394278 CGGGAGCAGGGAGAGTTGGATGG + Intergenic
1143292359 17:5840954-5840976 CAGCAGATGGGGGAGTCAGAAGG + Intronic
1143514953 17:7414887-7414909 AAGGAGAGGGGGGAGTTGGCAGG - Intronic
1143592387 17:7893499-7893521 CAGCAGCAGGGGGTGGTGGAAGG - Exonic
1143619497 17:8072985-8073007 CAGGAGGAGGGGGTGCTGGCCGG - Intronic
1143665547 17:8356988-8357010 CAGGAGTTTGGGGAGTAGGAAGG + Intergenic
1143727522 17:8859632-8859654 TAGGAGAAGAGGGAGGAGGAAGG + Intronic
1143871312 17:9959018-9959040 CAGGAGAAGGGGAGGTGGGAGGG + Intronic
1144098752 17:11925319-11925341 CAGGAGATGGGGGAGGTTCATGG - Intronic
1144425135 17:15134330-15134352 CAGGAGAAAAGGAAGTTGGTTGG + Intergenic
1144818791 17:18056395-18056417 CACCAGCAGGTGGAGTTGGAAGG + Intronic
1144844239 17:18207840-18207862 GTGGAGAAGGGGGTGTTGGGAGG + Intronic
1144844649 17:18210284-18210306 CTGGTGAAGGGGGAGATGGCAGG + Intergenic
1144952559 17:19002106-19002128 GAGGAGGAGGGGGAGGAGGAAGG - Intronic
1145769392 17:27481812-27481834 CAGGAGAAGGGACAGTGGGAGGG - Intronic
1145965390 17:28913084-28913106 CAGGACAAGGGGTAGTGGGAAGG + Exonic
1145988877 17:29066085-29066107 CTGGGGAGGGGAGAGTTGGAGGG + Intergenic
1145993601 17:29093348-29093370 CGAGAGAAGCGGGAGCTGGAGGG - Exonic
1146054368 17:29573824-29573846 CAGGAGCAGGAGGAGATGGAGGG + Exonic
1146300030 17:31680653-31680675 CAGGAGGAGGATGAGGTGGAAGG + Intergenic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146466022 17:33087386-33087408 CAGGAGCAGGAGGTGCTGGAAGG - Intronic
1147125435 17:38364810-38364832 GAGGAGGAGGGGGAGTTGGAGGG - Exonic
1147250391 17:39149750-39149772 CTGGGGAAGGGGGAATTGGGAGG - Intronic
1147331964 17:39704617-39704639 AAGGAGATGGGAGAGTGGGAGGG + Intronic
1147498771 17:40942362-40942384 GAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1147620106 17:41860703-41860725 AATGAGAAGGTGGAGTGGGATGG - Intronic
1147657050 17:42096995-42097017 CAGGGGAGGGGGGAGTGGAAGGG - Intergenic
1147741968 17:42675094-42675116 GAGGAGGAGGGGGAGGGGGAGGG - Intronic
1148086430 17:44996319-44996341 TTGGAGATGGGGGAGATGGAAGG + Intergenic
1148239113 17:45988393-45988415 GAGGAGAAGGGGGTGTTTGGAGG - Intronic
1148326507 17:46786272-46786294 CAGGAGAAGCGGGGGATGGAGGG + Intronic
1148384259 17:47222900-47222922 CTGGAGAAAGGGGAGCAGGAGGG + Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148537772 17:48455169-48455191 CAGCAGGATGGGGAGCTGGAAGG - Intergenic
1148643871 17:49207867-49207889 CAAGAGAAGGGGGTCTTGGCTGG + Intronic
1148754143 17:49963874-49963896 TGGGAGTAGTGGGAGTTGGAAGG - Intergenic
1148807599 17:50272172-50272194 CAGGAGGAGGGGGAGGAGGCTGG - Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149315138 17:55431869-55431891 CAGGGGGAGGGGGAGGGGGAGGG + Intergenic
1149517789 17:57293431-57293453 GAGGAGGAGGCGGAGGTGGAAGG - Intronic
1149655312 17:58306736-58306758 CAGGGTCAGGTGGAGTTGGAAGG + Intronic
1149856422 17:60087067-60087089 CAGGAGGAGTGGCAGATGGAGGG + Intergenic
1149926358 17:60705958-60705980 GAGGAGATGGAGGAGGTGGAAGG - Intronic
1150224284 17:63514749-63514771 AAGGATAAGGGGGATTCGGACGG - Intronic
1150364849 17:64573189-64573211 GAGGAGGAGGGGGAGGAGGAGGG + Intronic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1150964019 17:69947219-69947241 CAGGAGGAGGAGGAGGGGGAGGG - Intergenic
1151216006 17:72576671-72576693 AAGGAGAAGGGGGAGTGGCGAGG + Intergenic
1151282785 17:73089086-73089108 CAGAAGAAGGGGGCATAGGAGGG + Intronic
1151361457 17:73591751-73591773 CATGAGTAGGGGGTGCTGGATGG - Intronic
1151859055 17:76745689-76745711 CAGGAGAAGAGGGAGGGAGATGG - Intronic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152017776 17:77762996-77763018 CAGGAGCTGGGGGTGCTGGAGGG + Intergenic
1152017959 17:77764276-77764298 CAGGAGCTGGGGGTGCTGGAGGG + Intergenic
1152225440 17:79090585-79090607 CAGGCAGTGGGGGAGTTGGAGGG - Intronic
1152266274 17:79296834-79296856 CAGGAGGAGGGGGAGGAGGGGGG - Intronic
1152336633 17:79702853-79702875 GAGGAGGAGGGGGAGGAGGAAGG - Intergenic
1152400796 17:80065129-80065151 AGGGAGAAGGGGGAGAGGGAGGG - Intronic
1152440352 17:80304866-80304888 CAGGAGGAGGGGGAGTGTGGAGG - Intronic
1152456278 17:80418298-80418320 CAGGAGAAGTTGGAGGGGGAAGG - Intronic
1152488131 17:80609033-80609055 CAGGAGAGGAGAGAGTTGGGAGG + Intronic
1152552056 17:81034939-81034961 CCGGAGAAGGGGGAGGGGGGCGG - Intergenic
1152563384 17:81089628-81089650 CAGGCGGAGGGGGAGAGGGAGGG + Intronic
1152595895 17:81237445-81237467 CAGGAGAATCGGGAGCTGAAAGG + Exonic
1152609183 17:81307363-81307385 AAGGAGGAGGGGGAGGGGGAGGG - Intergenic
1152609217 17:81307443-81307465 AAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1152681421 17:81670302-81670324 CAGAGGAAGGGGGAGTCTGACGG + Exonic
1152893460 17:82896090-82896112 CTGAAGAAGGGGGTGTGGGAGGG - Intronic
1153733689 18:8042921-8042943 GCAGAAAAGGGGGAGTTGGAGGG - Intronic
1153806292 18:8711031-8711053 GAGGAGTAGGGGGAGTGGGGAGG - Intronic
1154021169 18:10665147-10665169 CAGGACAGGGTGGAGCTGGAGGG + Intergenic
1154126607 18:11697773-11697795 AAGAAGAAGAGGCAGTTGGAGGG + Intronic
1154233451 18:12580245-12580267 AAGGAGAAGAGGGTGTTGCAGGG + Intronic
1156598846 18:38579821-38579843 AAGGAGAAGGAGGAGGTAGAAGG + Intergenic
1156624258 18:38889395-38889417 CAGTAGGAAGGGAAGTTGGATGG - Intergenic
1157422691 18:47559604-47559626 CAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1157477269 18:48031384-48031406 CAGGAGCAGTGGGATGTGGAGGG - Intronic
1158129015 18:54132316-54132338 AAGGTGAAGGGGGAGTAGGCAGG - Intergenic
1158431223 18:57389335-57389357 GAGGAGAGGGGAGAGTGGGAAGG + Intergenic
1158646726 18:59254952-59254974 GAGGCGGAGGGGGAGTGGGACGG - Intergenic
1159200450 18:65176952-65176974 GAGGAGAAAAGGGAGGTGGAGGG + Intergenic
1159215251 18:65383965-65383987 CAGCAGATGGGGGAGCTAGAAGG - Intergenic
1160237675 18:77098955-77098977 GAGGAGAAGAGGGAGGGGGAAGG - Intronic
1160554131 18:79715057-79715079 CAGGAGGAGGGCGAGCGGGATGG + Exonic
1160608141 18:80067413-80067435 CTGGAGAAAGGGGAGATGGGAGG + Intronic
1160819736 19:1052413-1052435 GAGGAGGAGGGGGAGGAGGAGGG + Intronic
1160827068 19:1085547-1085569 CAGGAGAGGGGGGAGAGAGATGG - Intronic
1160941410 19:1621984-1622006 CAGGAGGAGGGTGGGTTAGATGG + Intronic
1160965695 19:1746096-1746118 AGGGAGAAGGGGGAGTAGAAGGG + Intergenic
1160970666 19:1766452-1766474 GAGGAGGAGGGGGAGAGGGAAGG + Intronic
1160978850 19:1807298-1807320 CAGGGGACGGGGGAGTGGGCTGG - Intronic
1161066137 19:2238784-2238806 GAGGATAAGGGGGTCTTGGAGGG - Intronic
1161206105 19:3042130-3042152 CCCGAGAAGGGGGTGTAGGAGGG + Intronic
1161400551 19:4065097-4065119 CAGGGGAGGGGGGAGCTGGTGGG - Intronic
1161403993 19:4081770-4081792 GAGGAGAAGGGGGAGTAGGAGGG - Intergenic
1161563699 19:4987827-4987849 CAGGAGAAGGGGGTCTGGGCTGG + Intronic
1161821714 19:6534059-6534081 GAGGAGAAGGGAGAGAAGGAAGG - Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161994230 19:7702646-7702668 AGGGAGAAGGAGGAGTAGGAGGG + Intergenic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162520675 19:11177791-11177813 CACGAGAAGTGGGAGGTGCAGGG - Intronic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1162901877 19:13799975-13799997 CTGGAAATGGGGGAGTTGGAGGG + Intronic
1163361314 19:16847905-16847927 CAGGAGCTGGGGGAGGTGAATGG - Intronic
1163361632 19:16850619-16850641 CAGGGGAAGGCGGAGTACGATGG + Intronic
1163440334 19:17319567-17319589 CAGGAGCAAGTGGAGCTGGAAGG + Exonic
1163441475 19:17324387-17324409 CAGGAGAAGGGTGGGCTGGTTGG + Intronic
1163804883 19:19389669-19389691 CAGGGGAAGGGAAAGTTGGAGGG + Intronic
1163827843 19:19533547-19533569 CAGGAGGAGGGGGAGGAGGAGGG - Intronic
1164477748 19:28588206-28588228 CAGGGGCAGGGAGAGCTGGAAGG - Intergenic
1164696578 19:30249343-30249365 GAGGAGAAGGAGGAGGGGGAGGG + Intronic
1164718681 19:30415202-30415224 GAGGAGGAGGGGGAGGGGGAGGG - Intronic
1164724798 19:30458862-30458884 CAGGAGAGATGGGAGGTGGAAGG - Intronic
1164841887 19:31398906-31398928 CACGAGAAAGGGCATTTGGAAGG + Intergenic
1165197735 19:34118123-34118145 AAGAAGAAGGGGGAGGGGGAGGG + Intergenic
1165348913 19:35266318-35266340 CAGGAGAAGGGGGATGAGGCAGG - Intronic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1165940091 19:39410545-39410567 GAGGACAATGGGGAGTGGGAGGG - Intergenic
1166279370 19:41780774-41780796 CTGGTGATGGGGGAGGTGGAAGG + Intergenic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1166544146 19:43624101-43624123 CGGCAGAAGGGTGAGTGGGACGG - Exonic
1166567910 19:43776337-43776359 CAGGGGAAGGCGGAGCTGGTGGG + Intronic
1166617436 19:44262879-44262901 TCAGAGAAGGGGAAGTTGGAGGG - Intronic
1166621608 19:44306265-44306287 CAGCAGAAGGGGGAGCCAGAAGG + Intergenic
1166679433 19:44758011-44758033 AAGGAGTCGGGGGAGCTGGAGGG - Intronic
1166730994 19:45058993-45059015 AAAGAGAAGGGAGAGATGGACGG - Intronic
1166979531 19:46624343-46624365 CAGGAGAACTGGGGGTTGGCTGG - Intronic
1167244479 19:48365209-48365231 CAGGAGAGGGGGGCATAGGATGG - Intronic
1167610890 19:50507277-50507299 CAGGAGGCTGGGGAGTTGGGTGG - Intronic
1167648769 19:50718945-50718967 AAGGAGAAGCGGGAGCTGGAGGG + Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167686519 19:50960064-50960086 GAGGAGGAGGGGGAGGAGGAGGG + Intronic
1167686524 19:50960076-50960098 GAGGAGGAGGGGGAGGAGGATGG + Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1167980750 19:53272986-53273008 TAGGAGAAGGAGGACATGGAAGG + Intergenic
1168136617 19:54356210-54356232 CAGGTAAAGGGGGAGGAGGAGGG - Exonic
1168314433 19:55478273-55478295 AAAGGGAATGGGGAGTTGGAAGG + Intronic
1168434418 19:56305970-56305992 CAGGAGAAGGGGGAGGGAGTGGG + Intronic
1168641836 19:58035773-58035795 CAGGAGAAAGGAGAGGTGCAGGG - Intronic
925069641 2:956274-956296 CAGGCGCAGGGGGAGGTGCAGGG - Intronic
925228618 2:2209373-2209395 CAGGGGGTAGGGGAGTTGGAAGG - Intronic
925507480 2:4584284-4584306 AGGGAGAGGGGGGAGTAGGATGG - Intergenic
925622564 2:5808065-5808087 CAGGGGCAGGCAGAGTTGGATGG - Intergenic
925693367 2:6548409-6548431 AAGAAAAAGGGGGGGTTGGATGG + Intergenic
925988698 2:9236109-9236131 CAGGTGATGGTGGACTTGGAGGG + Intronic
926096930 2:10087448-10087470 CAAGAGAAGGAGAATTTGGATGG - Intergenic
927674707 2:25096734-25096756 CAGGAGGAAGGGGCCTTGGACGG - Intronic
927850407 2:26495081-26495103 CAGGAGAAGGGGGAGCCAGAAGG + Intronic
927900043 2:26812499-26812521 CAGGAGAGGAGGGGGTGGGAGGG - Intergenic
928108440 2:28488172-28488194 GAGGAGAAGGAGGAGAAGGAGGG + Intronic
928233208 2:29517902-29517924 CAGGTGAAGGAGGAGATGAAGGG - Intronic
928337171 2:30407932-30407954 CAGGGGATGGGGGTATTGGATGG + Intergenic
928349797 2:30539356-30539378 CAGGAGGAGGGTGAGGTGGAAGG - Intronic
928781933 2:34833791-34833813 TAGGAGGAAGGGGAGGTGGAGGG + Intergenic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929593201 2:43160086-43160108 CAGGAGGTGGGTGAGTAGGAGGG - Intergenic
929739336 2:44587438-44587460 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
929868232 2:45736348-45736370 CATGATAGGCGGGAGTTGGAAGG + Intronic
930198289 2:48530125-48530147 GAGGAGGAGGGGGAGGAGGAGGG - Intronic
930713664 2:54572921-54572943 CAGGAGCAGTGTGAGTGGGAAGG + Intronic
931952122 2:67376379-67376401 CAGGAGAAGGGAGAAATGGGGGG - Intergenic
932112876 2:69017423-69017445 CAGGGGAAGAAGGAGTTGCAGGG - Intronic
932263274 2:70344746-70344768 TAGGAGAAGGCAGAGTTGGATGG - Intergenic
932356677 2:71073268-71073290 CAAGATAAGGGAAAGTTGGAGGG - Intronic
932515304 2:72341008-72341030 GAGGAGGAGGTGGAGGTGGAAGG + Intronic
933003775 2:76962374-76962396 CATGAGAAAAGGGAGGTGGAAGG - Intronic
933292960 2:80457867-80457889 CAGGAGACAAGGGAGTTGGAAGG - Intronic
933585331 2:84173913-84173935 CAGGAGAAGAGGTAGATGTAAGG + Intergenic
933840754 2:86284068-86284090 CAGGCCAAGGGGGAGGTGGCTGG + Intronic
933865866 2:86516855-86516877 AAGGAGAAGGTGGAGATGGGAGG + Intronic
934652377 2:96099894-96099916 GAGGAGAAAGGGGAGGGGGAGGG + Intergenic
934661732 2:96146666-96146688 CAGGAGACTGGGGGCTTGGAGGG - Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
936463020 2:112725543-112725565 CAGGAGAAGGGTGAGCTGTTGGG + Exonic
936528787 2:113260579-113260601 GGGGAGAAGGGGGAATAGGAAGG + Intronic
936758854 2:115749069-115749091 CAGAACTAGTGGGAGTTGGATGG + Intronic
936859119 2:116994815-116994837 CAGGAGAAGGGGTGGTTGCCAGG - Intergenic
937080766 2:119137964-119137986 CTGGAGGAGGGGAAGTTTGAAGG + Intergenic
937573354 2:123390973-123390995 AAGGAGAATGGGGAGGAGGAAGG - Intergenic
937854008 2:126659862-126659884 CAGGAGGTGGAGGAGGTGGAGGG - Intronic
937906957 2:127057111-127057133 CAGGGCCAGGGAGAGTTGGAAGG - Intronic
938472451 2:131577360-131577382 GAGGGGAAGGAGGAGATGGAAGG - Intergenic
938539716 2:132275871-132275893 GAGGACAAGGGGGAGAGGGAAGG + Intergenic
939105687 2:137945905-137945927 AAGTAGAAGAGGGATTTGGAAGG - Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939754485 2:146093328-146093350 CAGGAGAGAGGGGCGATGGAAGG + Intergenic
939977636 2:148737460-148737482 CTGGAGATGGAGGAGTGGGATGG + Intronic
940277376 2:151953391-151953413 CAGGGAAGGGAGGAGTTGGAGGG - Intronic
940526719 2:154825165-154825187 CAGGAAAAGGGTAAGTTGGGAGG - Intronic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941038233 2:160590606-160590628 GAGGAGAAGGGGGAGGAGAAGGG - Intergenic
941038238 2:160590618-160590640 GAGGAGAAGGGGGAGGAGAAGGG - Intergenic
941038243 2:160590630-160590652 GAGGAGAAGGGGGAGGAGAAGGG - Intergenic
941591148 2:167422123-167422145 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
941779306 2:169427001-169427023 CCGGAGAAAGTGGAGGTGGAGGG + Intergenic
942141172 2:172978614-172978636 CAGGAGAGGGCGGTGTTAGAGGG - Intronic
942247781 2:174023741-174023763 CAGGAGAAGGAGGGGTGGGGAGG + Intergenic
942357998 2:175140477-175140499 CAGGAGTAGAAGGAGTGGGAGGG + Intronic
942750130 2:179277382-179277404 GAGGAGTAGGAAGAGTTGGAAGG + Intergenic
943300790 2:186196322-186196344 CAGGTGAAGGGAGATTTGGATGG + Intergenic
943454830 2:188092688-188092710 CTGGAGAAAGGGGATTTGGTTGG - Intergenic
943805630 2:192121447-192121469 GAGGGGAAGGAGGAGGTGGAAGG + Intronic
944100378 2:196019943-196019965 AAGAAGAAGGGGGAGGAGGAGGG - Intronic
944758090 2:202784808-202784830 TAGGAGAAGGGGTTGTTGAACGG + Intronic
945122280 2:206469255-206469277 CAGGAGAAGGAGGTGGTGGTAGG - Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945534509 2:210997712-210997734 CAGGAATAGGGGAAGTAGGAGGG + Intergenic
945552526 2:211237764-211237786 CAAGCGAAGGGGAAGTTGGGTGG - Intergenic
945988975 2:216377595-216377617 GAGGAGGAGGGGGAGGGGGAGGG + Intergenic
946089237 2:217206181-217206203 CAGGGGCAGGGGGAAATGGATGG + Intergenic
946109626 2:217403189-217403211 GAGGAGAAGGGAGAGGGGGAGGG + Intronic
946142887 2:217706587-217706609 GAGGAGAAAGGGGAGGAGGAAGG + Intronic
946174151 2:217912395-217912417 CAAGAGTCGGGAGAGTTGGAGGG - Intronic
946182386 2:217956405-217956427 CAGCAGAAGGGGGAGTAACAAGG + Intronic
946247661 2:218396700-218396722 CAGCTGAAGGAGGAGATGGATGG + Exonic
946400359 2:219465284-219465306 GAGGCGAAGGGTGAGGTGGAAGG - Intronic
946411606 2:219517896-219517918 CAGCAGAGTGGGGAGTGGGAAGG - Intronic
946416794 2:219543859-219543881 GAGGAGAAGGGGGAGGTTAAAGG + Exonic
946762720 2:223010962-223010984 CAGGAAAAGTGGAAGTGGGAGGG + Intergenic
946869974 2:224076289-224076311 CAGGAGCAAGAGGAGTAGGAAGG - Intergenic
946907422 2:224430130-224430152 CAGCAGAGAGGGGAGCTGGACGG - Intergenic
947128273 2:226894921-226894943 CAGGAGCTGGGGGACATGGAGGG + Intronic
947538135 2:230953897-230953919 CAGGAGACCGGGGAGGTGGAGGG - Intronic
947760945 2:232603411-232603433 GAGGAGGAGGAGGAGGTGGAAGG + Intergenic
948237748 2:236403125-236403147 GAGGAGGAGGGGGAGGGGGAGGG + Intronic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948662002 2:239513349-239513371 CAGGCGAAGGGGGAGCAGGCAGG - Intergenic
948733536 2:239982969-239982991 CAGGAGTAGGAGGAGATGGAGGG - Intronic
948760162 2:240185312-240185334 TAGGTGAAGGGTGAGTTGCAAGG + Intergenic
948760206 2:240185551-240185573 TAGGTGAAGGGTGAGTTGCAAGG + Intergenic
948760266 2:240185907-240185929 TAGGTGAAGGGTGAGTTGCAAGG + Intergenic
948809547 2:240467590-240467612 CAGGGGGAGGAGGACTTGGAGGG + Exonic
948939227 2:241187829-241187851 GAGGAGGAGGAGGAGTTGGGGGG + Intergenic
948939253 2:241187931-241187953 GAGGAGAAGGAGGAGAGGGAAGG + Intergenic
1169055268 20:2615657-2615679 AAGGAGAAAGAAGAGTTGGAAGG + Intronic
1169198338 20:3695085-3695107 CAGGAGAGTGGGGAGCAGGAGGG - Intronic
1169266076 20:4168071-4168093 CAGGAGGAGAGGGAGTGGGAGGG - Intronic
1169974585 20:11310282-11310304 CAAGAGAATGGGGAGTTGACGGG - Intergenic
1169976364 20:11333144-11333166 TAGGAGATGAGGGATTTGGAGGG - Intergenic
1170150334 20:13221212-13221234 GAGGAGGAGGAGGAGTAGGAGGG - Intergenic
1170441107 20:16379615-16379637 GAGGAGAAGAGGGACCTGGAAGG - Exonic
1170532997 20:17313381-17313403 CAGGAGCAGCAGGAGTGGGAGGG - Intronic
1170699998 20:18695417-18695439 AAGGGGAAGGGGGAGGCGGAGGG - Intronic
1171011956 20:21513748-21513770 CGGGGGAGGGGGGAGTTGGGGGG + Exonic
1171213883 20:23337675-23337697 CAGAGGTATGGGGAGTTGGAGGG + Intergenic
1172285694 20:33738845-33738867 GAGGAGCAGGAGGAGATGGAGGG + Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172536908 20:35680992-35681014 AAGGAGAAGGGGTAGAAGGAGGG - Intronic
1172560566 20:35884351-35884373 CAGGAGGAGGAGGAGCTGGGAGG + Intronic
1173180279 20:40801371-40801393 AAGGAGAAGGAGGATTTGGATGG + Intergenic
1173571413 20:44079137-44079159 CAGGGGAGTGGGGAGTAGGAGGG + Intergenic
1173914435 20:46696430-46696452 AAGTAGAAGGGGGAGTTTCACGG - Intergenic
1174649318 20:52111075-52111097 CAGGAGAAGGGGAAGCGGCAGGG + Intronic
1174735195 20:52959601-52959623 CTGGAGAAGAGGGGCTTGGACGG - Intergenic
1175224905 20:57439288-57439310 CAGGAGGAGGGGGGGTGGGAGGG - Intergenic
1175239887 20:57539339-57539361 CAGGGGAAGGGAGATTTGAAGGG - Intergenic
1175452097 20:59077937-59077959 GAGGAGGATGGGGAGTAGGAGGG + Intergenic
1175466308 20:59192868-59192890 CAGGAGAAGTGGCAGGTGTACGG + Exonic
1175545975 20:59778098-59778120 CCAGAGAAGAGGGAGTTGGCTGG - Intronic
1175625222 20:60484010-60484032 CAGGAGAGTGGGGAGGGGGAGGG - Intergenic
1175730959 20:61353672-61353694 GAGGAGGAGGGGGAGGAGGAGGG - Intronic
1175790409 20:61736983-61737005 CAGGAGAAGGTCGAGGTGCAGGG + Intronic
1175904553 20:62372938-62372960 CAGGAGAGGGAGGGGTGGGAGGG - Intergenic
1175919644 20:62444709-62444731 CAGGGGATGGGAGAGGTGGATGG + Intergenic
1177012470 21:15745050-15745072 CAGGAAAAGAAGGAGTGGGAAGG - Intronic
1177758338 21:25373772-25373794 GAGGAGGAGGGGGAATGGGAGGG - Intergenic
1178266522 21:31147442-31147464 GAGGAGAAGGTGGTTTTGGAAGG - Intronic
1178510422 21:33200788-33200810 CAGGAGAGGGGGGAATCAGAGGG - Intergenic
1178750394 21:35297175-35297197 CAGCAGAAGCGGGAGATGGAGGG - Intronic
1178799491 21:35779164-35779186 GAGGAGAAGGGGAAGCGGGAGGG + Intronic
1178928079 21:36792448-36792470 AAGGAGAAGGGGGGGAGGGAAGG + Intronic
1179013345 21:37573874-37573896 CCGCAGGAGGGGGAGTGGGAAGG + Intergenic
1179081827 21:38178614-38178636 GAGGAGGAGGGGGAGGAGGAGGG + Intronic
1179391514 21:40996491-40996513 AAGGAGGTGGAGGAGTTGGAAGG + Intergenic
1179893176 21:44347918-44347940 TAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1180031379 21:45210818-45210840 CAGGAAAAGGAGGAGCTGGCAGG + Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180230405 21:46423796-46423818 GAAGAGAAGGGGGAGTGGGAGGG + Intronic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180472905 22:15676972-15676994 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1180723994 22:17930975-17930997 CCGGAGGAGGGGGCGTTGGGAGG - Intronic
1180984531 22:19896668-19896690 CAGGACAATGGGGACTTGCACGG + Intronic
1181050462 22:20235905-20235927 CAGAAGAAGATGGAGTGGGACGG - Intergenic
1181425524 22:22835202-22835224 GAGGAGAAAGGGGAGGTGGGGGG - Intronic
1181429770 22:22872072-22872094 GAGGAGAAAGGGGAGGTGGGAGG - Intronic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1181813626 22:25420851-25420873 GAGGAGAAGGAGGAGGCGGAGGG + Intergenic
1181924369 22:26346539-26346561 CAGGAGCAGCATGAGTTGGATGG + Intronic
1182132529 22:27867239-27867261 CAGGAGATGGAGGAGGTGGGGGG + Intronic
1182314046 22:29431520-29431542 CAGGGGATAGGGGTGTTGGAGGG + Intergenic
1182358742 22:29734580-29734602 CAGGAGAAGCGGGGGCTGGGAGG + Intronic
1182886395 22:33777636-33777658 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183158299 22:36092653-36092675 GAGGAGAAGGGGGAATGGGGAGG - Intergenic
1183487583 22:38097701-38097723 CAGGAGAGAGGGGAGGAGGATGG + Intronic
1183493355 22:38128236-38128258 CTGGAGAAGAGGGAGTCGGGAGG + Intronic
1184291894 22:43501813-43501835 GAGGAGGAGGGGGAGAAGGAGGG - Intronic
1184326259 22:43789310-43789332 AAGGAGAAGGTGGAGGAGGAAGG + Intronic
1184462447 22:44646876-44646898 CAGCAGATGGGGGAGGGGGAGGG + Intergenic
1184526672 22:45027990-45028012 GAGGAGAAGGAGGAGGTGGAAGG + Intergenic
1185091590 22:48778635-48778657 CAGGAGGAGAGGGAAGTGGAGGG + Intronic
1185311799 22:50160199-50160221 GGGGAGAAGGGGGAGGAGGAAGG - Intronic
949219023 3:1607214-1607236 GAGGAGGAGGAGGAGCTGGAGGG + Intergenic
949539804 3:5023473-5023495 TGGGAGACGTGGGAGTTGGAAGG + Intergenic
949551555 3:5116197-5116219 GAGGAGGAGGGGGAGGGGGAGGG - Intergenic
949977800 3:9476809-9476831 CTTGGGAAGGGGGAGTAGGATGG - Exonic
949985510 3:9537622-9537644 CAGGAGAAGGTGGACTTGGAAGG - Intronic
950192509 3:10987414-10987436 CAGGAGAAGAGGGAGGATGAGGG + Intergenic
950219858 3:11186159-11186181 CAGGAAAAGGTGGAGTTGTCCGG - Intronic
950527549 3:13533235-13533257 CAGGACAAGGGGGGGTGGCAGGG - Intergenic
950539323 3:13600555-13600577 CTGGAGAAGGGAGAGTAAGAGGG + Intronic
951516731 3:23567878-23567900 AAGGAGAGGGGGAAGTTGGCAGG + Intronic
951649943 3:24940446-24940468 CAAGAGAAGGGGGGATAGGAAGG + Intergenic
951795928 3:26538234-26538256 AAGGAGAAGGGGGAGGGGAAGGG + Intergenic
952080489 3:29752139-29752161 CAGCAGGAAGGGGAGCTGGAAGG + Intronic
952882723 3:37994750-37994772 CAGGGGATGGGGGTGTTGGAGGG - Intronic
952954833 3:38550463-38550485 GAGGAGATGGAGGAGCTGGAGGG + Exonic
952968208 3:38633955-38633977 AAGGGGATGGGGGAGATGGAAGG - Intronic
953173148 3:40525404-40525426 CAGGAGAAGAGGGACTGGGGTGG - Intronic
953536685 3:43782383-43782405 CAGGAGGGTGGGGAGTTGCAGGG + Intergenic
953900992 3:46843983-46844005 GAGGATAAGGAGGATTTGGAAGG - Intergenic
954157547 3:48694951-48694973 GAGGAGAAGGAGGAGAGGGAGGG + Intronic
954411839 3:50374305-50374327 CAGGAGGAGGGGGAGGAGAAAGG + Intronic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
954710868 3:52504514-52504536 GAGGAGAAGGAGGAGACGGATGG - Exonic
954748114 3:52798490-52798512 GAGGAGAAAGGGGAGGAGGAGGG - Intronic
954808330 3:53232908-53232930 GAGGAGAGGAGGGACTTGGAGGG - Intronic
955006870 3:54976802-54976824 CACCAGAAGTGGGAGTGGGAGGG + Intronic
955307421 3:57848310-57848332 GAGGAGAAGGGGGAGAAGAAGGG - Intronic
955403301 3:58609022-58609044 CAGGAGTTGGGGGAGCTGGCAGG + Intronic
955726782 3:61941713-61941735 CAAAAAAAGGGGAAGTTGGAGGG - Intronic
955984782 3:64561258-64561280 CAGAAGGAGGGGGAGATAGAAGG - Intronic
956535211 3:70267987-70268009 GAGGAGAAAGGGGAGGTGAAAGG - Intergenic
956656863 3:71560887-71560909 CTGGAGCTGAGGGAGTTGGAAGG + Intronic
956698293 3:71937150-71937172 CAGGTGGAGGTGGAGGTGGAAGG - Intergenic
956718340 3:72097926-72097948 TTGGAGAAGGGGGAGCTGCAGGG + Intergenic
956778618 3:72587166-72587188 CAGCAGATGGGGGAGCTGAAGGG - Intergenic
956806767 3:72821978-72822000 CAGGAGAGCCAGGAGTTGGATGG - Intronic
956874146 3:73445334-73445356 TAGGAGAAGCAGGAGTTGGATGG + Intronic
957181056 3:76877910-76877932 GAGGAGAAGGGAGAGAAGGAAGG + Intronic
957426780 3:80050721-80050743 CAGGAGGAGGAGGAGGTAGAAGG + Intergenic
957511041 3:81187545-81187567 CAAGAGAGGGAGGAGGTGGAAGG - Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
958811524 3:98865444-98865466 GGGTTGAAGGGGGAGTTGGAGGG + Intronic
959344661 3:105178484-105178506 CAGGAGACTGAGGAATTGGAAGG + Intergenic
960325883 3:116295537-116295559 CAGGAACAGAGGGAATTGGAGGG + Intronic
960334431 3:116399082-116399104 CAAGAGAAGGTAGAGGTGGAAGG + Intronic
960574793 3:119218875-119218897 CAGGAGAAGCAGGAGTGGGTGGG - Intronic
960702381 3:120451062-120451084 CAGCAGAAGGGGGAGGAGAATGG - Exonic
961372584 3:126440630-126440652 CAGGAGCAGGGGCAGGGGGAGGG - Intronic
961476120 3:127147403-127147425 GAGGAGACGGGGGAGATGGAGGG + Intergenic
961487508 3:127227264-127227286 GAGGAGGAGGGGGAGGGGGAGGG - Intergenic
961513211 3:127416499-127416521 AATGAGAAGGGGGAGGAGGAGGG + Intergenic
961521030 3:127467461-127467483 CAGGAGGAAGGGGAGGTGGATGG - Intergenic
961651822 3:128420749-128420771 CAGGAGCAGGGGGCCCTGGAGGG - Intergenic
961925207 3:130472157-130472179 CAGGGAATGGGGAAGTTGGAGGG + Intronic
963115843 3:141728310-141728332 GAGGAGAAGGGAGAGTTCCATGG + Intergenic
963405378 3:144856620-144856642 GAGGAGAAGGGGGAGGGGGAGGG - Intergenic
963906773 3:150779436-150779458 CAGGAGCAGAGGGCGCTGGAGGG + Intergenic
963938869 3:151081439-151081461 CAGGGGAAGTGGGAGGGGGAGGG - Intergenic
964371929 3:156009019-156009041 CAGAGGAAGGGAGAATTGGACGG + Intergenic
964508177 3:157422006-157422028 AGGGAGAAAGGGCAGTTGGAGGG - Intronic
964671368 3:159229763-159229785 GAGGAGGAGGGGGAGGAGGAGGG - Intronic
964810398 3:160657263-160657285 ATGGAGAAGGGGGGCTTGGAAGG - Intergenic
965123645 3:164595675-164595697 CAGCAGAGAGGGGAGCTGGAGGG + Intergenic
966350799 3:179031947-179031969 GAGGAGGAGGGGGAGGGGGAGGG - Intronic
966350817 3:179031977-179031999 GAGGAGGAGGGGGAGGAGGAGGG - Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966884925 3:184372096-184372118 AAGGGGATGGGGGCGTTGGAAGG + Exonic
966897655 3:184457729-184457751 AAGGGGAAGGGGAAATTGGAGGG + Intronic
967420368 3:189265707-189265729 CAGAAGGAGGGGGAGTAGGAAGG - Intronic
967865253 3:194184767-194184789 GAGGAGAAGGGGAAGTTTGGAGG + Intergenic
967987693 3:195107529-195107551 GAGGAGGAGGGGGAGGAGGAGGG + Intronic
967987709 3:195107564-195107586 GAGGAGGAGGGGGAGGAGGAGGG + Intronic
967987715 3:195107576-195107598 GAGGAGGAGGGGGAGGAGGAGGG + Intronic
967987720 3:195107588-195107610 GAGGAGGAGGGGGAGGAGGAAGG + Intronic
967987732 3:195107612-195107634 GAGGAGGAGGGGGAGGAGGAGGG + Intronic
967987747 3:195107648-195107670 GAGGAGGAGGGGGAGGAGGAAGG + Intronic
968085848 3:195873602-195873624 CAGGAGAAGTGGGGGTTGGTGGG - Intronic
968135123 3:196215342-196215364 TAGGAGGAGGGGAAGCTGGAGGG + Intronic
968339312 3:197941467-197941489 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
968378991 4:72709-72731 CAGGAGAAATGGAAATTGGAAGG - Intronic
968651256 4:1761146-1761168 CAGGAGATGGGGGCGGGGGAGGG - Intergenic
968652097 4:1764181-1764203 CTGGAGAACGGCGAGTCGGAAGG + Intergenic
969194909 4:5553227-5553249 CAGGAGCAAGTGGAGTTGGTGGG + Intronic
969263267 4:6046895-6046917 CTGGGGCAGGGGGTGTTGGAGGG - Intronic
969853099 4:9977545-9977567 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
969853103 4:9977551-9977573 CAGGAGCAGGGGGAGGGGGAGGG - Intronic
970234485 4:13944761-13944783 CAGCAGATGGGGGAGTCAGAAGG + Intergenic
971105215 4:23517342-23517364 AAGGAGAAGGAGGAGTGGGAAGG - Intergenic
971503757 4:27344256-27344278 GAAGGGAAGGGGGAGTTGAAGGG - Intergenic
972180020 4:36452581-36452603 CAGAAAAAGGGAGAGTTGGAAGG + Intergenic
972278897 4:37584689-37584711 CAGCAGAAGGCGGGGATGGAGGG + Intronic
972346453 4:38196515-38196537 CAGGAGAAGGGGGAGTTGGAGGG + Intergenic
972350959 4:38235919-38235941 CATGAGATGGGCGAGTTGTAGGG + Intergenic
972633149 4:40859183-40859205 CAGGAGGAGGCAGAGTTGGCAGG - Intronic
972856477 4:43113735-43113757 GAGGAAAAGGGAGAGTGGGAAGG + Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
974597688 4:64036622-64036644 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
976264809 4:83180528-83180550 CAGGGTAAGGGGAAGTTGGGGGG - Intergenic
976389796 4:84496762-84496784 CAGGAGAAGAGTGAGATGAAGGG - Intronic
976475645 4:85479592-85479614 AAGGAGAATGTGGAGCTGGATGG + Intronic
976555912 4:86451572-86451594 CAGGAGGAGTGGGAGTGGTACGG + Intronic
976704692 4:88008025-88008047 GAGGAGGAGGAGGAGGTGGAAGG + Exonic
976888865 4:90020466-90020488 CAGAAGAAGAGGGATTAGGAAGG - Intergenic
977809754 4:101346183-101346205 CAGGGGGAGGGGGAGGGGGAGGG + Intronic
978628917 4:110720075-110720097 CAGGTGAAGGGGGCATAGGATGG - Intergenic
978636303 4:110811122-110811144 GAGGAGAAGGGGTTTTTGGAGGG + Intergenic
978702314 4:111662601-111662623 GAGGAGGAGGGGGAGGGGGATGG + Intergenic
979101986 4:116629552-116629574 CAGGAGGAGGAAGAGGTGGATGG - Intergenic
980729134 4:136804664-136804686 CAGCAGAGAGGGGAGATGGAGGG - Intergenic
980943255 4:139295239-139295261 TGGGAGATGGGGGAGTTGAAGGG - Intronic
981005944 4:139875314-139875336 CAGGAGAAGGTGGAAGTGGTGGG + Intronic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
982282195 4:153694802-153694824 GAGGAGCAGGGGGACTGGGATGG - Intergenic
982418782 4:155168937-155168959 TAGGAGAAGGGAGATTTGGAAGG - Intergenic
982834072 4:160100982-160101004 CATGGGGAGTGGGAGTTGGAAGG - Intergenic
983550837 4:169015890-169015912 CAGGAGAGGGGGGAGCGGGGAGG - Intergenic
985171258 4:187152806-187152828 CAAGAGAAGGGGGAGATGAATGG + Intergenic
985552725 5:541619-541641 GAGGAGCAGGGGAAGGTGGAGGG - Intergenic
985616166 5:923177-923199 CAGGAGAAGGGGGTGCTGGGGGG + Intergenic
985718234 5:1474802-1474824 CAGGGGAAGGGCCAGTTGGTGGG + Intronic
985777314 5:1851568-1851590 GAGGAGATGGGGGAGGTGGGAGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986007318 5:3678721-3678743 GAGGAGAAGGTGGTGATGGAGGG - Intergenic
986196106 5:5537443-5537465 GGGGAGAAGAGGGAGATGGATGG + Intergenic
986221730 5:5774769-5774791 GAGGAGAAGGAGGAGGGGGAGGG - Intergenic
987228355 5:15867309-15867331 CAGGAGAAGGTGGAGATGATAGG - Intronic
987332550 5:16869919-16869941 AAGGGGAAGGGGGAGGGGGAGGG + Intronic
987606392 5:20141316-20141338 CACAAGAAGGGAGAGTAGGAAGG + Intronic
989438548 5:41442975-41442997 AAGGAGAAGGAGGAGATGCAGGG + Intronic
990047785 5:51456228-51456250 GAGAAGAAAGGGGAGTTGCAAGG - Intergenic
990186703 5:53217963-53217985 GAGGAGAAGGGGGAAGAGGAGGG + Intergenic
990199225 5:53352672-53352694 CAGGAAAATGGGTAGTTTGAAGG - Intergenic
990589644 5:57249751-57249773 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
990589750 5:57249968-57249990 GAGGAGGAGGGGGAGGGGGAAGG - Intronic
990637989 5:57750752-57750774 CAGCAGATGGGGGAGCTGGTAGG + Intergenic
990771828 5:59255432-59255454 CAGGTAATGGGGGAGATGGAGGG + Intronic
990774269 5:59287335-59287357 AAGGAGAAGGAAGAGTGGGAAGG + Intronic
991460134 5:66849413-66849435 GAGGGGAAAGGGGAGGTGGAGGG - Intronic
992550237 5:77852658-77852680 GAGGAGAGAGGGGAGGTGGAAGG + Intronic
992990767 5:82280651-82280673 GAGGGGAATGTGGAGTTGGAGGG + Intronic
993716132 5:91277361-91277383 GAGGAGAAGGGGGAGGGGGAGGG + Intergenic
994106989 5:95960256-95960278 CAGGAGAGGAGAGAGTCGGAAGG - Intronic
994301916 5:98157469-98157491 CAGCAGATGGGGGAGTCAGAGGG + Intergenic
994389879 5:99179502-99179524 AAGGAGAAGGGTGAGCAGGAGGG + Intergenic
994541301 5:101101649-101101671 GAGGAGGAGGGGGAGGGGGAAGG + Intergenic
995385865 5:111588154-111588176 CAGGGGAAGGTGGAGTCAGAGGG - Intergenic
995410192 5:111848643-111848665 CAGGGGATGGGGGGGTTGGGGGG - Intronic
995470602 5:112498088-112498110 CAGAAGAAAGGGGAGAAGGAAGG - Intergenic
996860705 5:128062544-128062566 CAGGTGAAAGGGAAGTAGGATGG + Intergenic
997107791 5:131041008-131041030 CTGGAGAAGGGGGTGTGGAATGG + Intergenic
997128307 5:131250943-131250965 CAACAAAAGGGGGAATTGGAGGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998499038 5:142616004-142616026 CTGGAGAAGGTGGAGATGCATGG - Intronic
998613738 5:143717342-143717364 AAGAAAAATGGGGAGTTGGAGGG + Intergenic
999135413 5:149315721-149315743 CATGTGCTGGGGGAGTTGGAGGG + Intronic
999265623 5:150265064-150265086 TTTGAGAAGGGGGAGATGGAGGG - Intronic
1000055499 5:157602577-157602599 CAGAAGAAGGGGGATGAGGAAGG + Intergenic
1000113872 5:158135215-158135237 CAGGAGAAAGGGGATGGGGAAGG + Intergenic
1000240302 5:159402701-159402723 CAGGGGTAGGGGGAGTAGAATGG + Intergenic
1000294507 5:159901410-159901432 GAGGAGAAGGGGGAGGGAGAGGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001023220 5:168201485-168201507 CAGGAGAAAGGGGAGTAGACGGG - Intronic
1001104712 5:168843282-168843304 CAGGTGAAGAGGAAGGTGGAGGG + Intronic
1001192635 5:169644787-169644809 CAGGGGGTGGGGGAGTTGCAAGG - Intronic
1001316126 5:170642302-170642324 CAGAAGCAGGGGGACCTGGAAGG + Intronic
1001391792 5:171385700-171385722 GAGGAGAAAGGAGAGTGGGAAGG - Intergenic
1001671208 5:173475471-173475493 CAGGAGGAGAGGGATTTGGTGGG - Intergenic
1001748222 5:174108316-174108338 CAGCAGCAGGGGGAGAGGGAGGG + Exonic
1002076970 5:176714093-176714115 AGGGAGAAAGGGGTGTTGGAAGG + Intergenic
1002721829 5:181265924-181265946 CAGGAGACGGGGGACCAGGATGG + Intergenic
1003730832 6:8821952-8821974 CCAGAGAAGGGGGACTTGGTGGG - Intergenic
1004003687 6:11619868-11619890 CAGGAGAAGGGCCAGATGGCTGG + Intergenic
1004119669 6:12808822-12808844 GAGGAGGAGGGGGAGGGGGAAGG - Intronic
1004266431 6:14152007-14152029 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1005095008 6:22104692-22104714 CAAGAGAATGGGGACTTGGAGGG + Intergenic
1005659770 6:27984699-27984721 CAGCAGCAGAGGGAGTTGGGAGG + Intergenic
1005710697 6:28501532-28501554 GAGGGGGAGGGGGAGGTGGAGGG - Intergenic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006404665 6:33838004-33838026 CAGGAGAGAGGGGAGCTGCAGGG + Intergenic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006512692 6:34530212-34530234 AGGGAGATGGGGGAGGTGGAGGG - Intronic
1006562972 6:34929771-34929793 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1006689026 6:35863618-35863640 CATGGGGAGGGGGAGGTGGAGGG + Intronic
1006909696 6:37555842-37555864 CAGGAGAAGGTGGGGTGGGTGGG + Intergenic
1007227773 6:40327027-40327049 CAGGAGAGGTGGGAGTTAAATGG + Intergenic
1007287109 6:40755567-40755589 CAGGTGAAGGGGGAGGAGGAGGG - Intergenic
1007291049 6:40787045-40787067 AAGGAGAATGTGGAGGTGGAGGG - Intergenic
1007362992 6:41371984-41372006 TAGGAGATGGGGGAGGAGGATGG + Intergenic
1007642683 6:43355236-43355258 CAGGAGAAGGTGGGTGTGGATGG + Exonic
1008073381 6:47119956-47119978 AAGGAGGAGGGGGAGGAGGAGGG + Intergenic
1008482755 6:52003632-52003654 CAGGTGAAGGAAGAGTTTGAAGG - Intronic
1009035856 6:58116441-58116463 CGGGAGGAGGAGGAGTTGGTTGG + Intergenic
1009392600 6:63163345-63163367 GAGGGGGAGGGGGAGTGGGAGGG - Intergenic
1010666166 6:78632072-78632094 CAGGAGAGGAGGGAGGTGGTGGG + Intergenic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1011063197 6:83294758-83294780 GAGGAGCAGGGGGAGTCGGGGGG - Intronic
1011130755 6:84049787-84049809 CAGGAGAAGGGGGGATAGGCAGG + Intronic
1011221346 6:85057636-85057658 TAGGAGAAGGAGGAATTGAAAGG - Intergenic
1012206841 6:96472220-96472242 CAGGGGAAGGGGGATTGGGGAGG - Intergenic
1012494375 6:99818510-99818532 AAGAAGAAGGGGGAGGGGGAGGG - Intergenic
1012711728 6:102615798-102615820 CAGGAGTAGTGGGTGATGGATGG - Intergenic
1013301420 6:108808474-108808496 CTGGAGAAGGGGGTGGTGCATGG - Intergenic
1013309577 6:108880724-108880746 AAGGAGAAGAGGGAGAGGGAAGG - Intronic
1013322399 6:109007592-109007614 CCAGAGAAGGGCGAGTGGGATGG - Intronic
1014755973 6:125302105-125302127 GAGGAGGAGGAGGAGTTGGAAGG - Intergenic
1014869961 6:126581925-126581947 GAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1014869967 6:126581937-126581959 GAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1015389705 6:132667827-132667849 CTGAAGAAAGGGGAGGTGGAAGG - Intergenic
1015491076 6:133826114-133826136 AAAGAGAAGGGGGAGTTTCAGGG - Intergenic
1015659500 6:135559326-135559348 CAGGGGAAGGGGGAATAGGAAGG + Intergenic
1016692231 6:146951105-146951127 CAGGAGAAGGGGGATGCGGGGGG - Intergenic
1017014445 6:150088839-150088861 GAGGGGAAGGGGGAGAGGGAGGG + Intergenic
1017016914 6:150108463-150108485 AAGGAGCAGGTGGAGTTGGGGGG + Intergenic
1017814736 6:158008587-158008609 TGGGAGAAGGTGGAGTTGGTGGG + Intronic
1018843045 6:167532203-167532225 CAGCAGATGGGGGAGCTAGAAGG - Intergenic
1018948461 6:168363385-168363407 GAGGGGGAGGGGGAGATGGATGG + Intergenic
1019148896 6:169991252-169991274 AAGGAAAAGAGGGAGGTGGAGGG + Intergenic
1019162978 6:170081185-170081207 GAGGAGGAGGGGGAGGAGGAGGG + Intergenic
1019281580 7:203017-203039 CAGGTGTAGAGGGAGATGGAGGG + Intronic
1019494936 7:1333395-1333417 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1019494945 7:1333417-1333439 GAGGAGAAGGGGGAGGAGGGGGG - Intergenic
1019531666 7:1506524-1506546 GAGGAGGAGGGGGAGGGGGAGGG - Intergenic
1019666120 7:2253010-2253032 CAGGAGTTGGGGGAGCAGGAGGG - Exonic
1020372191 7:7444424-7444446 CAGGAGAAGATGGAGCTGCAGGG - Exonic
1020410718 7:7888876-7888898 GAGGAGGAGGGGGAGGGGGAGGG + Intronic
1020547681 7:9554385-9554407 GAATGGAAGGGGGAGTTGGATGG - Intergenic
1020577361 7:9949914-9949936 GAGGAGGAGGGGGAGGGGGAGGG + Intergenic
1021075341 7:16297418-16297440 CAGGAGCAGGGAGAGTGGTAAGG + Intronic
1021211980 7:17864782-17864804 GAGGAGAAGGGGGAGGGGAAAGG + Intronic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1021778100 7:24073618-24073640 CAGGGGATGGGGGAGTTGACGGG - Intergenic
1021993804 7:26160845-26160867 CAGGAAGAGGTGGAGCTGGATGG - Intronic
1022969927 7:35507576-35507598 CAGCATGAGGGGAAGTTGGAGGG - Intergenic
1023526174 7:41106268-41106290 CTGGAGAAGGGGCGGTGGGAGGG - Intergenic
1023760817 7:43463740-43463762 CAGGAGGAGGCGGAGGTGGAGGG + Exonic
1024184863 7:46939725-46939747 CGGCAGAAGAGGAAGTTGGAGGG + Intergenic
1024196446 7:47063966-47063988 GAGGAGGAGGAGGAGGTGGAGGG - Intergenic
1024196455 7:47064001-47064023 GAGGAGGAGGAGGAGGTGGAGGG - Intergenic
1024196559 7:47064898-47064920 GAGGAGGAGGAGGAGGTGGAGGG - Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1025978673 7:66390008-66390030 GCAGAGAAGGGGGAGGTGGAGGG - Intronic
1026144928 7:67738478-67738500 CAGGGGCAGAGAGAGTTGGAGGG - Intergenic
1026269285 7:68822461-68822483 CATGAGAAGGGGAGGTTGCAGGG - Intergenic
1026321328 7:69269906-69269928 CCGGAGGAGGTGGAGGTGGAGGG + Intergenic
1026410354 7:70114975-70114997 GAGGAGAAGGGGGTGGTGTAGGG + Intronic
1026530067 7:71189523-71189545 GGAGAGAAGGGGCAGTTGGAGGG + Intronic
1026679041 7:72451396-72451418 TGGGGGAAGGGGGAGTAGGAGGG + Intergenic
1026800617 7:73397785-73397807 AAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1027137052 7:75631915-75631937 CAGGAAATGGGGAAGTGGGAGGG + Intronic
1027204260 7:76084711-76084733 GCAGAGAAGGGGGAGGTGGAGGG - Intergenic
1027414924 7:77964480-77964502 CAGGCGCAGGGGGAGTTGGCTGG - Intergenic
1027464922 7:78503566-78503588 GAGGAGGAGGGGGAGGAGGAGGG - Intronic
1027941742 7:84691077-84691099 GAGGAGGAGGGGGAGGAGGAGGG + Intergenic
1029139467 7:98400337-98400359 CAAGAGGAGGGGGAGGGGGAGGG + Intronic
1029354377 7:100040647-100040669 AAGGAGAAGGGGGAAGAGGACGG + Exonic
1029374241 7:100168379-100168401 CATGGGAAGGGAGAGATGGATGG - Intronic
1029422208 7:100477561-100477583 CAGGAGAGGTGGGGGGTGGACGG + Exonic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030124477 7:106141489-106141511 GGGGAGAAGGGGGAGGTAGAGGG - Intergenic
1030124490 7:106141518-106141540 GGGGAGAAGGGGGAGGTAGAGGG - Intergenic
1030124537 7:106141623-106141645 GGGGAGAAGGGGGAGGTAGAGGG - Intergenic
1030727391 7:112941077-112941099 CAGGAGAAGCGGGAGGTGAAGGG + Intergenic
1031280833 7:119797544-119797566 CAGGAGAGGGAAGAGTGGGAAGG - Intergenic
1031595084 7:123640678-123640700 GAGGAGGAGGGGGAGGGGGAGGG + Intergenic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1032071257 7:128808651-128808673 CAGGAGACGGAGGACTGGGAAGG + Intronic
1032669375 7:134069323-134069345 GAGGAGAAGGAGGAGAAGGAGGG - Intergenic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033565518 7:142574893-142574915 CAGGGGGAGGGGGAGGGGGAGGG - Intergenic
1033983964 7:147200057-147200079 AAGGAGGAGGGGGAGGGGGAGGG - Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034277403 7:149829838-149829860 CAGGAGGAGGGGATGATGGAGGG - Intergenic
1034473473 7:151269162-151269184 ATGGTGAAGGGGGAGTTAGAAGG + Intronic
1034720770 7:153290170-153290192 GAGGAGGAGGGGGAGGAGGAGGG + Intergenic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034944930 7:155255671-155255693 AAGGGGAAGGGGGAGAGGGAGGG + Intergenic
1035172316 7:157024160-157024182 GAGGAGCAGGGGGAGCGGGAGGG - Intergenic
1035760446 8:2064777-2064799 GAGGAGAAGGAGGAGGGGGATGG - Intronic
1035886452 8:3296352-3296374 CAGAGGAAGGGGGACTGGGAAGG + Intronic
1036163076 8:6406854-6406876 CAGGAGCAGGGGGTTTTGGTGGG - Intronic
1036295211 8:7529230-7529252 GAGGAGAAGGGGGAGGGGAAAGG - Intergenic
1036327359 8:7791788-7791810 GAGGAGAAGGGGGAGGGGAAAGG + Intergenic
1036448735 8:8846315-8846337 GAGGAGAAGGAGGAGTAGGAGGG + Intronic
1036722422 8:11188991-11189013 GGGGATGAGGGGGAGTTGGATGG - Intronic
1036948212 8:13115381-13115403 CAGCAGATGGGGGAGTGGCATGG + Intronic
1037154954 8:15688707-15688729 GAGGAGAAGGAGGAAATGGAAGG - Intronic
1037497001 8:19450085-19450107 GAGGAGGAGGGGGAGGAGGAAGG + Intronic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037769261 8:21789333-21789355 CAGGGGCAGTGGGGGTTGGAGGG - Intronic
1037802362 8:22042742-22042764 GAGGAGGAGGGGGAGGAGGAGGG - Exonic
1037843409 8:22261753-22261775 AAAGAGAATGGGGAGGTGGACGG + Intergenic
1037951332 8:23020088-23020110 CAGGAGGAGGGGAGGTTGGGGGG + Intronic
1038284986 8:26198570-26198592 GAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1038688960 8:29743710-29743732 CAGGAAAAGCGAGAGATGGATGG + Intergenic
1039031305 8:33312470-33312492 TAGGAGAGGGGGGATGTGGAAGG - Intergenic
1039241847 8:35565922-35565944 CAGGAGAAGGCAGAGTTGGCAGG - Intronic
1039842287 8:41302800-41302822 CAGGAGAAGGAGGAGCTGGTGGG - Intronic
1039845630 8:41323608-41323630 CAGGACAGGAGGGAGGTGGAGGG + Intergenic
1039884392 8:41646948-41646970 GAGGAGGAGGGGGAGGGGGAGGG - Intronic
1041401360 8:57448738-57448760 AAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1041557814 8:59177893-59177915 CAGTAGAATGGGGATTTGTAGGG - Intergenic
1041924398 8:63221581-63221603 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1043392312 8:79803696-79803718 AAGGAGAAGGGAGAGTTTAAAGG - Intergenic
1043824654 8:84911670-84911692 CATGAAATGGGGGAGTGGGAAGG - Intronic
1044121267 8:88399120-88399142 CAGGACAAGGGAGAGTTACAAGG + Intergenic
1044606938 8:94056259-94056281 AGGGAGCAGGGGCAGTTGGAGGG - Intergenic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1044932023 8:97260139-97260161 AAGGAGGAGGGGGAGGGGGAAGG + Intergenic
1044950110 8:97427644-97427666 CAGGAGAGGTGGCAGTAGGAAGG + Intergenic
1045474644 8:102542581-102542603 GAGGAGTAGGGGGAGGAGGAGGG - Intergenic
1045938497 8:107710975-107710997 CAGCAGATGGGGGAGTCAGAAGG + Intergenic
1046399883 8:113691788-113691810 GAGGAGGAGGGGGAGAGGGAGGG - Intergenic
1046399889 8:113691800-113691822 GAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1046399895 8:113691812-113691834 GAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1046399901 8:113691824-113691846 GAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1046399907 8:113691836-113691858 GAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1046399913 8:113691848-113691870 GAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1046399919 8:113691860-113691882 GAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1046399925 8:113691872-113691894 GAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1046399931 8:113691884-113691906 GAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1046983568 8:120362794-120362816 AAGGAGTAGGAGGAGATGGAGGG + Intronic
1047364506 8:124199866-124199888 CAGGATGAGGGGGTGATGGAGGG + Intergenic
1047578994 8:126191728-126191750 CAGGTGAAGTGGGGGTTGGAGGG - Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048007653 8:130432066-130432088 AAGGAGGAGGGGGAGGGGGAAGG + Intronic
1048385298 8:133906869-133906891 CATGAGCTGGAGGAGTTGGACGG + Intergenic
1048449737 8:134523012-134523034 GAGGAGAAAGGGGTCTTGGAAGG - Intronic
1048468721 8:134688526-134688548 CACGAGAAAGGGGAGAAGGAAGG + Intronic
1048516576 8:135116812-135116834 GAGGAGAGGGGGGAGGGGGAGGG - Intergenic
1048542777 8:135357800-135357822 CAGCAGAGGTGGGAGTTGGAGGG + Intergenic
1048925101 8:139264468-139264490 CAGGAGCTGGGGTAGTTGGAAGG + Intergenic
1049199515 8:141333215-141333237 CAGGTGAAGGAGGAGATGGGTGG + Intergenic
1049478314 8:142807106-142807128 GATGAGGAGGGGGAGGTGGAAGG - Intergenic
1049515763 8:143054394-143054416 CAGGGGATGGTAGAGTTGGATGG - Intronic
1049547964 8:143243366-143243388 GAGGAGGAGGGGGAGGGGGAGGG + Intergenic
1049674024 8:143881838-143881860 GAGGAGGAGGGGGAGGAGGAAGG + Intergenic
1049674039 8:143881873-143881895 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1049762353 8:144337099-144337121 CAGGAGCTGGGGGAGGGGGAGGG + Intergenic
1049980834 9:902316-902338 GAGGAGGAGGGGGTGTAGGAAGG - Intronic
1049998497 9:1052175-1052197 GTGGAGGTGGGGGAGTTGGAGGG + Intronic
1049999548 9:1062366-1062388 CAGGAGAGGGGATAGTTGGGAGG - Intergenic
1050029518 9:1370680-1370702 CAAAAGAAGGGAGAGTGGGAAGG - Intergenic
1050690750 9:8223835-8223857 CAGGAGAAGAGGAAGGGGGAAGG + Intergenic
1050815827 9:9810042-9810064 CAGGAGGAAGGGGAGGTGGAAGG - Intronic
1052037443 9:23698743-23698765 AAGAAGAAGGGGGAGTGGGGCGG + Intronic
1052143356 9:25017328-25017350 TATGAGAAGGGGGAGGTGAAGGG - Intergenic
1052951812 9:34219726-34219748 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1053361221 9:37487947-37487969 CAGGGGAAGGGACAGTGGGAAGG + Intronic
1053459947 9:38260551-38260573 CGGGAGCAGTGGGAATTGGATGG + Intergenic
1053575557 9:39355561-39355583 CAGCAGGAGGGGGAGGAGGAGGG - Intergenic
1053840063 9:42183500-42183522 CAGCAGGAGGGGGAGGGGGAGGG - Intergenic
1054097118 9:60914248-60914270 CAGCAGGAGGGGGAGAGGGAGGG - Intergenic
1054118524 9:61189877-61189899 CAGCAGGAGGGGGAGAGGGAGGG - Intergenic
1054589233 9:66992687-66992709 CAGCAGGAGGGGGAGAGGGAGGG + Intergenic
1054849013 9:69827516-69827538 AAGGAGAAGGTGGAGGAGGAAGG - Intronic
1055080266 9:72261812-72261834 GAGGAGGAGGGGGAGGGGGAGGG - Intergenic
1055390841 9:75820989-75821011 CAGCAGAAGGGCGTGTTAGAAGG - Intergenic
1055559629 9:77510124-77510146 CTAGAGCTGGGGGAGTTGGAAGG - Intronic
1055707938 9:79028047-79028069 TAGGAGAAGGGAGAGGTGAAGGG + Intergenic
1055858267 9:80718052-80718074 CAGGAGTAGGGGAAATGGGAAGG - Intergenic
1056546844 9:87620554-87620576 AAGGAGTAGGGGGAGGGGGAGGG + Intronic
1056814617 9:89792264-89792286 CAGGGGTAGGAGGATTTGGATGG + Intergenic
1057082691 9:92184969-92184991 CAGGAGATGGGGGATGTGAAGGG + Intergenic
1057387136 9:94614183-94614205 GAGGAGCAGGGGGAGGAGGAGGG + Intronic
1057389417 9:94630313-94630335 CAGGAGTTGGGAGTGTTGGATGG - Intronic
1057493913 9:95544722-95544744 TAGGATAAGTGGGAGTTGGATGG - Intergenic
1058206791 9:102118587-102118609 CAGCAGATGGGGGAGTGAGAAGG + Intergenic
1058419553 9:104820869-104820891 TAGGAGAAGTGGGAGGTGAATGG - Intronic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1059228525 9:112695772-112695794 GAGGAGGAGGGGGAGGGGGAGGG + Intronic
1059297949 9:113289041-113289063 CTTTAGAAGGGGGAGTTGGCTGG - Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059411266 9:114133762-114133784 GAGGACCAAGGGGAGTTGGATGG + Intergenic
1059452329 9:114378146-114378168 CAGGAGCAGGGGGAGCTTGAGGG - Intronic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1059724466 9:116992399-116992421 CAGGAGAAGGGGTAGAGGCAAGG + Intronic
1060355727 9:122905300-122905322 GAGGAGGAGGCGGAGGTGGAGGG - Intronic
1061645688 9:131999219-131999241 CAGGGTAAGAGAGAGTTGGAAGG + Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061731418 9:132617303-132617325 AAGGAGATGGGGGAGGTGAAGGG - Intronic
1062074730 9:134579750-134579772 GAGGAGGAGGGGGAGGGGGAAGG + Intergenic
1062143715 9:134976690-134976712 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1062212900 9:135374130-135374152 GAGGTGGAGGGGGAGTTGGGGGG - Intergenic
1062269667 9:135702699-135702721 CAGGGGCTGGGGGAGATGGAAGG - Intronic
1062411869 9:136429847-136429869 CAGGAGGAGGGGGCGTTAGGAGG + Intronic
1062469750 9:136697095-136697117 AAGGAGGAGGGGGAGGGGGAAGG - Intergenic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638424 9:137503636-137503658 AAGGAGAAGGGGGAGGAAGAAGG + Intronic
1185499223 X:584636-584658 GAGGAGAAGGGAGAGGAGGAGGG + Intergenic
1185499229 X:584648-584670 GAGGAGGAGGGGGAGGAGGAGGG + Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185566605 X:1099730-1099752 CAGGAGAAGGAGTAGGTGAAGGG + Intergenic
1185575491 X:1169031-1169053 AAAGAGAAGGAGGAGGTGGAGGG + Intergenic
1185581199 X:1212893-1212915 GAGGAGATGGGGGAGGGGGAGGG - Intergenic
1186042097 X:5492056-5492078 CAGGAGGAAGCGGAGGTGGAGGG - Intergenic
1186063693 X:5738912-5738934 CAGGCACAGAGGGAGTTGGAGGG + Intergenic
1186064102 X:5742947-5742969 GAGGAGAAGGAGGAGAAGGAGGG + Intergenic
1186355835 X:8788845-8788867 CAGGAGCTGGGGGAGGTGGAAGG - Intergenic
1186377578 X:9020971-9020993 CAGGAGCTGGGGGAGGTGGAAGG - Intergenic
1186864624 X:13707334-13707356 GGGGAGAAGGGAGAGTTGGAGGG + Intronic
1186908748 X:14139049-14139071 AAGGAGAAGGGGGAGAAGGCAGG + Intergenic
1187305902 X:18095014-18095036 CAGGAGAAGGGTGAGCTTGGTGG - Intergenic
1187636880 X:21238711-21238733 AAGGGGAAGGAGGAGTGGGAAGG + Intergenic
1187742078 X:22366646-22366668 AAAGAGAAGGGGGAGATGGAGGG + Intergenic
1187757209 X:22541026-22541048 AAGGAGAAGAGAGAGTTAGAGGG - Intergenic
1187885634 X:23886301-23886323 CCGGGGAGGTGGGAGTTGGAAGG + Intronic
1188331807 X:28881931-28881953 AAGGAGAAGAGAGAGATGGACGG + Intronic
1188717124 X:33474036-33474058 CAGGGGGAGGGGGAGTAGGTAGG + Intergenic
1188915809 X:35908829-35908851 GAGGAAAAAGGGGAGTAGGAGGG + Intergenic
1189374605 X:40457035-40457057 GAGGAGAAAGGGGAGTGAGAGGG - Intergenic
1190136004 X:47798608-47798630 GAGGAGAGGGGGGATGTGGAGGG - Intergenic
1190253835 X:48747811-48747833 CAGGGGCAGGGGGAGTGGCATGG - Intergenic
1190311800 X:49122272-49122294 CAGGAGAAGGGGCAGGTGGCGGG + Intronic
1190444665 X:50511951-50511973 CTTGAGAGGGGAGAGTTGGAGGG - Intergenic
1190806329 X:53840944-53840966 GAGGTGAAGGGGGAGTGGGGAGG + Intergenic
1191711241 X:64151961-64151983 GAGGAAAAGGGGGAGAGGGATGG + Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192008314 X:67241014-67241036 CAGGAGAAGGACGAGTAGCAAGG + Intergenic
1192269646 X:69566673-69566695 CTGGAGAAGGGGCAGGTGTAGGG + Intergenic
1192726216 X:73755620-73755642 CAGAAGAAGGGAGAGTGGGAGGG - Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193602856 X:83529660-83529682 CAGGGGTTGGGGGAGTTGCAGGG + Intergenic
1194320398 X:92439748-92439770 CAGAAGAAGGGATAGTAGGAAGG - Intronic
1194495618 X:94613661-94613683 GAGGAGAGGGAAGAGTTGGAAGG - Intergenic
1194749682 X:97670534-97670556 CAGCAGAAGGAGGAGATGAATGG - Intergenic
1194889876 X:99364979-99365001 AAGGGGAAGGAAGAGTTGGAAGG + Intergenic
1195142843 X:101980597-101980619 CAGGAGCAAGGACAGTTGGATGG - Intergenic
1195252595 X:103063567-103063589 CGGGAGATGGGGGAGTTGGGAGG + Intronic
1196193649 X:112818679-112818701 CGGGGTAAGGGAGAGTTGGAGGG + Intronic
1197612894 X:128658412-128658434 AAGGAGCAGCGGGAGTTGGGGGG + Intergenic
1197881960 X:131176305-131176327 TGGGAGTGGGGGGAGTTGGATGG + Intergenic
1198487507 X:137103116-137103138 TAGCAGAAGAGGGAGTTAGATGG - Intergenic
1198788241 X:140314154-140314176 AAGGAGAAGGTAGAGTGGGAAGG + Intergenic
1199783215 X:151082156-151082178 CAGGGAAAGGGCTAGTTGGAGGG + Intergenic
1199876398 X:151932280-151932302 AAGGGGAATGGTGAGTTGGAGGG - Intergenic
1199893086 X:152107584-152107606 AAGGGGAACGGTGAGTTGGAGGG + Intergenic
1199987916 X:152965547-152965569 CAGGAGAAGGCCGACATGGAAGG - Intronic
1200110745 X:153739719-153739741 CTGGTGAAGTGGGAGTCGGATGG + Intronic
1200154885 X:153970151-153970173 CAGGAGAAGGGAGGGAGGGAGGG + Intronic
1200154966 X:153970443-153970465 GGGGAGAAGGGGGAGGGGGACGG + Intronic
1201294953 Y:12454476-12454498 CAGAAGGAGGGGGAGGGGGAGGG + Intergenic
1201461769 Y:14233185-14233207 GAGGAGGAGGAAGAGTTGGAGGG - Intergenic
1202049015 Y:20761891-20761913 TTGGAGAAGGGGGAGTTTAACGG - Intronic