ID: 900663241

View in Genome Browser
Species Human (GRCh38)
Location 1:3796491-3796513
Sequence TGGCAGGCACCCACCCACCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 1, 2: 3, 3: 71, 4: 279}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900663237_900663241 -5 Left 900663237 1:3796473-3796495 CCATGGCGCCTCAGCTGCTGGCA 0: 1
1: 0
2: 1
3: 26
4: 286
Right 900663241 1:3796491-3796513 TGGCAGGCACCCACCCACCAGGG 0: 1
1: 1
2: 3
3: 71
4: 279
900663231_900663241 21 Left 900663231 1:3796447-3796469 CCAAGACTCTGACACCGCTGCCG 0: 1
1: 0
2: 0
3: 8
4: 86
Right 900663241 1:3796491-3796513 TGGCAGGCACCCACCCACCAGGG 0: 1
1: 1
2: 3
3: 71
4: 279
900663233_900663241 7 Left 900663233 1:3796461-3796483 CCGCTGCCGCCGCCATGGCGCCT 0: 1
1: 0
2: 2
3: 30
4: 275
Right 900663241 1:3796491-3796513 TGGCAGGCACCCACCCACCAGGG 0: 1
1: 1
2: 3
3: 71
4: 279
900663234_900663241 1 Left 900663234 1:3796467-3796489 CCGCCGCCATGGCGCCTCAGCTG 0: 1
1: 0
2: 0
3: 10
4: 145
Right 900663241 1:3796491-3796513 TGGCAGGCACCCACCCACCAGGG 0: 1
1: 1
2: 3
3: 71
4: 279
900663230_900663241 25 Left 900663230 1:3796443-3796465 CCGGCCAAGACTCTGACACCGCT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 900663241 1:3796491-3796513 TGGCAGGCACCCACCCACCAGGG 0: 1
1: 1
2: 3
3: 71
4: 279
900663235_900663241 -2 Left 900663235 1:3796470-3796492 CCGCCATGGCGCCTCAGCTGCTG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 900663241 1:3796491-3796513 TGGCAGGCACCCACCCACCAGGG 0: 1
1: 1
2: 3
3: 71
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900663241 Original CRISPR TGGCAGGCACCCACCCACCA GGG Exonic
900663241 1:3796491-3796513 TGGCAGGCACCCACCCACCAGGG + Exonic
901519633 1:9773355-9773377 TGGCTGGAGCCCACCTACCACGG - Exonic
901969912 1:12899535-12899557 TGCAAGGCACCAACTCACCAAGG + Intronic
902015260 1:13302245-13302267 TGCAAGGCACCAACTCACCAAGG - Intergenic
902144576 1:14387591-14387613 TGGGAGGCACCCCCCAAGCAGGG - Intergenic
902520586 1:17013428-17013450 TGGCAGGAACCCAGCCTCCAGGG + Intergenic
902987258 1:20162382-20162404 CAGCAGGCACCCCCCCACCTTGG - Intronic
903330422 1:22594342-22594364 TGACAGCCCCCCACACACCATGG + Intronic
904557247 1:31373215-31373237 TGGCTGGTCCCCACCCACCTCGG - Intronic
904852400 1:33468781-33468803 TGGCTGTCCCCCACCCCCCAAGG + Intergenic
905027418 1:34860247-34860269 TGGCAGGCACACAGCCAGCAGGG + Intergenic
905177538 1:36147181-36147203 TTACAGGCACCCAACCACTACGG - Intronic
905881920 1:41469457-41469479 TGACATGAACCCACACACCAGGG - Intergenic
905929672 1:41778356-41778378 TGTCAGGAACCCTACCACCAGGG - Intronic
906909774 1:49935572-49935594 TGGGAGGCACCCCCCCAGTAGGG + Intronic
907400979 1:54224640-54224662 TGTCTCCCACCCACCCACCACGG + Intronic
908665161 1:66481650-66481672 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
908827961 1:68151767-68151789 TGGAAGGCACCCAATCATCAAGG + Intronic
908876808 1:68686899-68686921 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
909560482 1:77004769-77004791 TGGGAGGCACCCCTCCAGCAGGG - Intronic
913160394 1:116139943-116139965 GGGCAGCCACCCACAGACCAAGG + Intergenic
913999896 1:143684593-143684615 TGACTGCCACCCACCTACCAAGG - Intergenic
914423417 1:147551414-147551436 TGGCAGGCACACACCTATTAGGG + Intronic
915163174 1:153933645-153933667 AGGCAGGCACCCCCCGACGAGGG - Exonic
915572486 1:156751944-156751966 GGGCGGGCACCCACCGACCGCGG - Intronic
915937573 1:160098357-160098379 TGGCAGGCACCTGCCCGGCAGGG + Intronic
919454246 1:197803058-197803080 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
921172974 1:212565588-212565610 TGGGTGGCACCCACCCAGCAGGG - Intronic
921307089 1:213808182-213808204 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
921807811 1:219476137-219476159 AGGCAGGCAGCCACCCAACCTGG + Intergenic
922026663 1:221756139-221756161 TGGAAGGCACCAACTCACCGAGG - Intergenic
923711667 1:236392608-236392630 TGGCAGGCACCCAACTACTTGGG - Intronic
923768001 1:236910802-236910824 TTACAGGCACCCAACCACCACGG + Intergenic
1062838138 10:649886-649908 TGACGGGCACCCCCCCACAAGGG - Intronic
1063250837 10:4272294-4272316 TGTCACCCACCCACCCACCCGGG + Intergenic
1063703425 10:8407938-8407960 TCACAGGCACCCTCCCATCATGG - Intergenic
1064671767 10:17722219-17722241 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1064802648 10:19093869-19093891 TGGGAGGCACCCCCCCAGCAGGG - Intronic
1065203611 10:23337675-23337697 TGGTAGGCACCAACTCAACAAGG + Intronic
1066080607 10:31928092-31928114 TTGCAGGCCTCCACCCACCCGGG - Intronic
1066164610 10:32772808-32772830 TGGCATACACACCCCCACCAGGG - Intronic
1067755423 10:49001136-49001158 TGTCACCCAGCCACCCACCATGG + Intergenic
1071248000 10:83786337-83786359 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1071352589 10:84762142-84762164 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1072685593 10:97534789-97534811 TGGGAGGCACACAGCCTCCAAGG + Intronic
1072708802 10:97702027-97702049 TGGCAGTCAGCAACACACCATGG + Intergenic
1072720055 10:97774832-97774854 TGGCAGGCTCCTGCCCTCCAGGG + Intergenic
1072895750 10:99365155-99365177 TGCCAGGTACCCACAGACCATGG + Intronic
1074044710 10:109826553-109826575 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1076539745 10:131206511-131206533 TGGCGGGCAGCCGCCCACGAGGG - Intronic
1076782524 10:132732050-132732072 AGGGAGGCCTCCACCCACCACGG + Intronic
1079134811 11:17770420-17770442 TGGCAGGGGCCCATCCACCCAGG + Intronic
1082558085 11:54586721-54586743 TGGGAGGCACCCCCCCACTAGGG - Intergenic
1082989512 11:59195254-59195276 AGACAGGCACCCAACCTCCAGGG + Exonic
1083277235 11:61603714-61603736 TGGCAGGGATCCAGCCTCCAGGG + Intergenic
1084118935 11:67057627-67057649 TGGCGTGCTCCCACCCTCCAAGG - Intronic
1084445855 11:69203066-69203088 TGGCAGGCACCCATGCACTGTGG + Intergenic
1084561782 11:69909675-69909697 CAGCAGGCGCCCACCCACCACGG + Intergenic
1085222005 11:74882788-74882810 TGGGAGGCACCCCCCCAGCAGGG - Intronic
1086544476 11:87951803-87951825 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1086836169 11:91625815-91625837 TGGGAAGCACACACCCACAATGG - Intergenic
1087067163 11:94037583-94037605 TGGGAGGCACCCCCCCAACAGGG + Intronic
1087211130 11:95447127-95447149 GGGCAGGCACACACCCAGCTGGG + Intergenic
1087921859 11:103876004-103876026 AAGCAGCCACCAACCCACCAAGG + Intergenic
1090259174 11:125306333-125306355 GGGCAGCCCCCCACCCCCCAGGG + Intronic
1091648045 12:2288626-2288648 AGGGAGGCACAGACCCACCACGG - Intronic
1091763280 12:3101824-3101846 TGGGAGCCTCCCAGCCACCAGGG - Intronic
1092903645 12:13083106-13083128 TTGCAGGCAGCCACCCACCCAGG + Exonic
1092945686 12:13451646-13451668 GGGCAGGCACCAGCCCCCCAGGG + Intergenic
1093217648 12:16382544-16382566 TGGGAGGCACCCCCCCAGTAGGG - Intronic
1093320193 12:17704789-17704811 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1093693765 12:22137259-22137281 TGGGAGGCACCCCCCCAGCAGGG + Intronic
1093781911 12:23146565-23146587 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1094744824 12:33332579-33332601 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1097176257 12:57145154-57145176 TCTCAGGCCACCACCCACCAGGG - Intronic
1097455335 12:59792799-59792821 TGGCAGCCACCCCTCCCCCAGGG + Intergenic
1098464012 12:70765749-70765771 TGGGAGGCACCCCCCCAGAAGGG + Intronic
1100558488 12:95722390-95722412 TGGAAGCCATCCACCCTCCATGG - Intronic
1102007031 12:109595641-109595663 TGCCAGGCCCCCAGGCACCAGGG - Intronic
1104187599 12:126447752-126447774 TGGCAGGTATCCACCCAACTTGG + Intergenic
1105311477 13:19216126-19216148 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1108502339 13:51080098-51080120 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1109312373 13:60710478-60710500 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1109719521 13:66259042-66259064 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1110380458 13:74844467-74844489 TCACAGGCACACACCCACAAAGG + Intergenic
1113720696 13:112553694-112553716 TGGCAGGCCCCGTCCCAGCAGGG + Intronic
1114807705 14:25857261-25857283 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1114828286 14:26107138-26107160 TAGGAGGCACCCCCCCAGCAGGG + Intergenic
1115078005 14:29414467-29414489 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1115719778 14:36147940-36147962 TGGGAGGCACCCCCCGAGCAGGG - Intergenic
1116322887 14:43492904-43492926 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1117528988 14:56640231-56640253 TGGGAGGCACCCTCCCAGTAGGG + Intronic
1117663612 14:58033266-58033288 TGGGAGGCACCCCCCCAGCAGGG + Intronic
1118164325 14:63321246-63321268 TGGCAGGCACATGCACACCATGG - Intergenic
1119156299 14:72414958-72414980 TGGGAGGCACCCCCCCAGTAGGG - Intronic
1119408631 14:74414145-74414167 TGGAAGGCACACACCATCCAGGG - Intronic
1122153622 14:99737752-99737774 CGGCTGTCACCCACCCAGCAGGG - Intronic
1122800097 14:104225116-104225138 TGGTGGGCATCTACCCACCATGG - Intergenic
1124230912 15:27945484-27945506 TGGAGGGCGCCCACCCACCCCGG - Intronic
1124640536 15:31393447-31393469 TAGGATGCACCCACCCGCCAGGG + Intronic
1125226737 15:37404727-37404749 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1126933911 15:53684924-53684946 TGGGAGGCACCCCCCTAGCAGGG + Intronic
1127259400 15:57317298-57317320 TGGCAGGCACTCTCCCACAGAGG - Intergenic
1128073005 15:64808863-64808885 TGGGCTGCGCCCACCCACCATGG - Intergenic
1128382697 15:67125124-67125146 GGGGATGCACCCAGCCACCAGGG - Intronic
1128942228 15:71798426-71798448 TGGGAAGCACCCCCCCAGCAGGG - Intronic
1129264211 15:74385394-74385416 TGGCTGGCAGCCTCCCACCTGGG + Intergenic
1129510152 15:76115668-76115690 TGACAGGCCCCCACCCAAGAAGG - Intronic
1131331283 15:91501347-91501369 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1131526660 15:93158260-93158282 TGGCAGGCACCCTGCCTGCAGGG + Intergenic
1132577859 16:672180-672202 AGGTAGGCACCCACCCTCCCTGG + Exonic
1133101246 16:3481481-3481503 GGGCAGGCACACAGTCACCAGGG - Intronic
1134102245 16:11460646-11460668 TGCCAGGCAGCCCTCCACCAGGG + Intronic
1134979129 16:18593233-18593255 CTCCAGGCACCCACCCACCCTGG + Intergenic
1135389289 16:22075729-22075751 TAGAAGGCACCCACCCACACTGG + Intronic
1135435475 16:22424314-22424336 TGGCAGGCACCCCCCAACTCCGG + Intronic
1136227232 16:28867042-28867064 TCTCAGTCACCCACCCTCCAAGG - Intronic
1137021825 16:35435707-35435729 TGTCAGGCACTCTGCCACCATGG - Intergenic
1138519722 16:57563997-57564019 GGGCCGGCACCCACCCTCCTTGG - Intronic
1139282197 16:65780531-65780553 TTGGAGGCCCCCCCCCACCAAGG - Intergenic
1139421019 16:66849657-66849679 AGGCAGGGTCCCACCCTCCATGG + Intronic
1139923906 16:70475281-70475303 ACGCAGGCACCCACCCACCCTGG - Intronic
1140896717 16:79331241-79331263 TGGCAGTCACACACACTCCAAGG - Intergenic
1142205022 16:88778815-88778837 TGGGAGCCACCCACACACCCAGG + Intronic
1143023760 17:3929494-3929516 TGCCAGGCACCCACCCCCATGGG + Intronic
1143527713 17:7482112-7482134 AGGCAGGCCCCCACCCAGCAGGG - Exonic
1144575728 17:16428234-16428256 TGGCAGGCTCCCACTCAGCCAGG + Intronic
1145766390 17:27460871-27460893 TGGCTGGCAGCCACCTAGCAAGG + Intronic
1146731045 17:35194158-35194180 AGGCAGGCCCCCACCCAGCAGGG + Exonic
1146752569 17:35394666-35394688 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1146891281 17:36507993-36508015 TGGCAGGGGCCCAGCCACCCTGG - Intronic
1147054942 17:37826747-37826769 TAGCAGGCAGCCACTCAGCATGG - Intergenic
1147314074 17:39611212-39611234 TGGCAGGAACCCCCCAACCAAGG - Intergenic
1147626908 17:41906442-41906464 TGACAGGACCCCACCCACCCAGG + Intronic
1150012438 17:61517550-61517572 TGGCAAGCACCCAGCTACCTGGG + Intergenic
1150070485 17:62146103-62146125 TGGCAGGCACCAGCTCCCCAGGG + Intergenic
1150302314 17:64056669-64056691 TGTGAGCCACCAACCCACCAGGG + Intronic
1151715961 17:75831192-75831214 CCCCAGGCACCCTCCCACCAGGG + Intronic
1152144791 17:78561671-78561693 GGGCAGGCACCCCGCCTCCATGG - Intronic
1152267694 17:79305823-79305845 GGGCAGGCAGCCTCCCTCCAAGG + Intronic
1153036737 18:770662-770684 TTACAGGCACCCACCCACCCTGG - Intronic
1153058904 18:976135-976157 TGGGAGGCACCCCCCCAACAGGG - Intergenic
1153228103 18:2912928-2912950 AGGCAGGCAGCCAGCTACCATGG + Intronic
1154115456 18:11609723-11609745 AGGCAGGCCCCCACCCAGCAGGG - Intergenic
1154395144 18:13981142-13981164 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1155008101 18:21747773-21747795 TCCCAGGTAGCCACCCACCAGGG + Intronic
1156176928 18:34557646-34557668 TGGGAGGCACCCCCCCAGCAGGG - Intronic
1157102908 18:44745961-44745983 TGGAAGGCACACACACACCCAGG + Intronic
1158083857 18:53626466-53626488 TCGCTGGCTCCCTCCCACCAGGG + Intergenic
1160485652 18:79290018-79290040 TGGGAGGCACCCCCCAAGCAGGG - Intronic
1161630568 19:5353166-5353188 TTGCTGGCTCCCACCCACCCTGG + Intergenic
1161646088 19:5454378-5454400 TGGCAGGCGCCCAACCACAGGGG + Intergenic
1162332264 19:10037647-10037669 TGTCACCCTCCCACCCACCATGG + Intergenic
1162401950 19:10451829-10451851 TGATAGGCACCCGCCCACAAGGG - Intronic
1162778540 19:12995047-12995069 TGACATGCACCGTCCCACCATGG - Intergenic
1164753098 19:30670484-30670506 TGGCAAGCACCTACTCAACACGG + Intronic
1164993671 19:32703486-32703508 TTACAGGCATGCACCCACCATGG + Intronic
1165322877 19:35097002-35097024 TCCCAGGCAGCCACCCACCCAGG - Intergenic
1165618000 19:37219100-37219122 CTGCAGTCACCCAGCCACCATGG - Intronic
1166384802 19:42374987-42375009 TGCCAGGCGCCCTCCCACCCTGG - Intronic
1168165831 19:54546954-54546976 TGGCAGGCACACTCCCAGCCTGG + Intergenic
925087132 2:1116941-1116963 CGCCAGGCACCCACACGCCAGGG - Intronic
925104137 2:1275140-1275162 TGGCAGCAAGCCACCCACCAGGG + Intronic
925446556 2:3931176-3931198 TGGTAAGCTCCCACCCAACAGGG - Intergenic
925848192 2:8052544-8052566 TAGGAGCCAACCACCCACCATGG - Intergenic
926217573 2:10914769-10914791 GGACAGGCACCCCCACACCAAGG - Intergenic
927213309 2:20651629-20651651 TGGCAGGCACTCTCCCGACAGGG + Intergenic
927653959 2:24929694-24929716 GGGCAGGCTCCAACCCTCCAGGG - Intergenic
927844370 2:26463825-26463847 TGGCAGGCACCTTCCCACCAAGG - Intronic
927914623 2:26927174-26927196 TGGCAGGCACCGGCCCAGCATGG - Intronic
928083213 2:28328012-28328034 TGCCAGTCACTCACTCACCAAGG + Intronic
928759098 2:34560716-34560738 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
931048733 2:58386817-58386839 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
931843436 2:66177899-66177921 TGGGAGGCAACCCCCCAGCAGGG + Intergenic
934040480 2:88124109-88124131 TGGCTGGCAGCCAGGCACCAAGG + Intronic
934112716 2:88757468-88757490 TAGCAAGCACCCAGCCGCCAAGG - Intergenic
934962979 2:98694084-98694106 CCCCAGCCACCCACCCACCATGG + Intronic
936401726 2:112169737-112169759 AAGCAGGCAGCCACACACCAAGG + Intronic
936782795 2:116054219-116054241 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
937809412 2:126183315-126183337 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
938138907 2:128780895-128780917 TGACAGGCACCGATCCACCATGG - Intergenic
938341743 2:130540518-130540540 AGGCTGGCACCCAGCCACCCTGG - Intronic
938348086 2:130580191-130580213 AGGCTGGCACCCAGCCACCCTGG + Intronic
939039265 2:137168318-137168340 TGGCTGGCCCCCAACCACTATGG + Intronic
940043806 2:149388451-149388473 CTGCAGGCACCCACCCAAAAGGG - Intronic
940836075 2:158523345-158523367 CGGGAGGCACCCCCCCAGCAGGG + Intronic
941724392 2:168845359-168845381 TTCCAGGCACCCACCCTTCAAGG + Intronic
942026184 2:171912952-171912974 TGGCTTCCCCCCACCCACCAAGG - Intronic
942363354 2:175196337-175196359 TGGAAGGAGGCCACCCACCAAGG + Intergenic
943549377 2:189319900-189319922 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
943954015 2:194162821-194162843 TGGTAGGCACACACACACCCGGG + Intergenic
946432553 2:219633376-219633398 TGGTAGGCACCGCCCCATCAGGG - Exonic
948142662 2:235685254-235685276 AGGGAGGAACCCACACACCAGGG - Intronic
948342903 2:237269641-237269663 TGGCAGGGAACCACCCAGAATGG - Intergenic
948771329 2:240252663-240252685 TGGCCGCCACCCACCCAGCTGGG - Intergenic
949023473 2:241754048-241754070 TGGCAGGCACGCGCCCCTCAGGG - Intronic
1168852152 20:984460-984482 TGGCAGGGACACACTGACCAAGG - Intronic
1168882323 20:1217468-1217490 TGGGAGGCACCCCCCCAGTATGG + Intergenic
1170574135 20:17649833-17649855 TCACAGGCCCCCTCCCACCACGG + Intronic
1172564118 20:35915124-35915146 AGGGAGGCACCCACTCACCCAGG + Intronic
1173563132 20:44020545-44020567 TGGCAGCCACACTCCCAGCAGGG + Intronic
1174121442 20:48268692-48268714 TGGATGGCCCCTACCCACCATGG - Intergenic
1176102434 20:63370560-63370582 TGGCACTCACCCACCCACCAAGG - Intronic
1176140649 20:63543296-63543318 TGGCAGGCACAGGCCCACCTGGG + Exonic
1176759833 21:10770480-10770502 TAGGAGGCACCCAACCAGCAGGG + Intergenic
1177674440 21:24278159-24278181 TGGGAGGCACACACACACAAAGG - Intergenic
1178981217 21:37267087-37267109 TGGCGGGAACGCACCCACCTTGG + Intronic
1179913574 21:44462595-44462617 TGGGAGGCAGCCACACAACAAGG - Intergenic
1180148853 21:45937407-45937429 CAACAGTCACCCACCCACCAAGG + Intronic
1180504863 22:15985368-15985390 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1181618770 22:24073045-24073067 AGCCAGGCACTGACCCACCATGG - Intronic
1181671653 22:24428095-24428117 TGGTAAGCAGCCACCCAGCACGG - Intronic
1182429534 22:30291675-30291697 TGGTCCTCACCCACCCACCAAGG - Intronic
1183107063 22:35622417-35622439 TCCCAGGAACCCACCCACCAGGG + Intronic
1183373613 22:37449503-37449525 TGGGAGGCAGCCATCCATCATGG - Intergenic
1184169188 22:42749019-42749041 TGGCCAGCACCCACACACCCTGG - Intergenic
1184286999 22:43477475-43477497 TGGCAGGGACCCAGCCTCCCAGG - Intronic
1184782005 22:46654283-46654305 GGGCATGGACCCGCCCACCAAGG + Intronic
1184925062 22:47630885-47630907 TTGCTGTCACCCACCCTCCAGGG - Intergenic
1185012473 22:48322200-48322222 TCACAGGCACCCAGACACCAAGG - Intergenic
1185244290 22:49765115-49765137 TGGCAGGCCCCCACCCAGGTGGG + Intergenic
1203333797 22_KI270739v1_random:36678-36700 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
949718827 3:6965138-6965160 TGGCAGGCTCTCTCCCACCTAGG - Intronic
951572932 3:24084356-24084378 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
953177922 3:40568599-40568621 GAGCAGGCACCCACCCACAAAGG + Intronic
954497432 3:50978422-50978444 TGGGAGGCACCCCCCCAGCAGGG - Intronic
954570483 3:51637009-51637031 TGGCTGGCACCCTCTCACCAAGG + Intronic
954633105 3:52057416-52057438 TGGCAGGCGCCCGCCTACCGCGG - Intergenic
954986931 3:54802795-54802817 TGGGAGGCACCCCCCCAGTAGGG + Intronic
955014082 3:55051382-55051404 TGGGAGGCACCCCCCCAGCAGGG - Intronic
957061851 3:75488869-75488891 TGGAAGGCACCCCCCCACTAGGG - Intergenic
960881300 3:122348126-122348148 GGGTAGGTGCCCACCCACCATGG - Intergenic
960966030 3:123105321-123105343 TGGTAGGCACCCACCTGCCTGGG - Intronic
961395029 3:126580576-126580598 AGGTCGGCACCCACCCACCCTGG + Intronic
961649818 3:128411660-128411682 TGGCAGGCCCCCGACCAGCAGGG + Intergenic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
962911180 3:139851558-139851580 ATGCATGCACCCACCCACCCAGG - Intergenic
965963094 3:174452365-174452387 AGTCAGGCACCCACCCACCCTGG + Intronic
968797314 4:2716130-2716152 TGGCAAGCACACAGTCACCACGG - Intronic
968952886 4:3703677-3703699 TGCCAGGCACGTCCCCACCAAGG + Intergenic
969506044 4:7588413-7588435 TGGCAGAAACCCAGCCCCCAAGG - Intronic
970283310 4:14481477-14481499 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
970440960 4:16080910-16080932 CCGCAGCCACCCACCCATCAGGG + Intronic
970985052 4:22147150-22147172 TGGGAGGCACCCCCCGAGCAGGG + Intergenic
971116022 4:23647022-23647044 TGGGAGGCACCCCCCAAGCAGGG - Intergenic
971758576 4:30734889-30734911 TTGGAGACACCCACCCAGCAGGG - Intronic
973579228 4:52325065-52325087 TGGGAGGCACCCCCCAAGCAGGG - Intergenic
974967053 4:68773621-68773643 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
976529505 4:86135400-86135422 TGGGAGGCACCGCCCCAGCAGGG + Intronic
979432424 4:120647739-120647761 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
979576130 4:122294122-122294144 TGGCAGCGCCCCACCCCCCAGGG - Intronic
981163062 4:141522096-141522118 TGGCAGTATCCCAACCACCATGG - Intergenic
982581109 4:157180167-157180189 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
982619990 4:157692218-157692240 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
982675232 4:158367952-158367974 TGGGAGGCACCCCCCCAGTAGGG - Intronic
982691201 4:158549856-158549878 TGGGAGGCACCCCCCCAGTAGGG - Intronic
982836468 4:160125486-160125508 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
985747922 5:1657616-1657638 TGGCAGGCATCCACCCACCAAGG - Intergenic
989292764 5:39788377-39788399 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
989662333 5:43813581-43813603 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
992620087 5:78584561-78584583 TGGGAGGCACCCCCCCAGCAGGG - Intronic
993871741 5:93261764-93261786 TGGGAGGCACCCCCTCAGCAGGG + Intergenic
995329905 5:110934702-110934724 TGGGAGGCACCCCCACAGCAGGG + Intergenic
996419033 5:123241886-123241908 TGGGAGGCACCTCCCCAGCAGGG - Intergenic
997399998 5:133594971-133594993 TGGCTGGCAACCACCTACCCCGG + Intronic
997862609 5:137431589-137431611 TGGCACCAAGCCACCCACCAGGG - Intronic
998279988 5:140796708-140796730 TGCCCTGCACCCACCGACCACGG - Exonic
998281187 5:140808931-140808953 TGGCCCACACCCACCGACCATGG - Exonic
998286853 5:140870844-140870866 TGGCCCGCACCCACCGACCGCGG - Exonic
998287493 5:140877216-140877238 TGGCCCGCACCCACCGACCGCGG - Exonic
998288163 5:140884012-140884034 TGGCCTGCACCCACCGACCGCGG - Exonic
999413975 5:151378838-151378860 TGGCTGGCACACAGCCACCTGGG + Intergenic
1000473257 5:161672635-161672657 TGGCAGGCACATATACACCATGG - Intronic
1001075878 5:168627689-168627711 GGGCAGGCAGGCACCCACCCAGG - Intergenic
1001658033 5:173369021-173369043 TGGCATGCACCCACCTACTTGGG - Intergenic
1002200443 5:177524780-177524802 TGAGAGGCCCCCACCCACCATGG - Exonic
1003568418 6:7239899-7239921 TGGGAGGGACACAGCCACCAAGG + Intronic
1005656455 6:27943489-27943511 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1006210215 6:32387075-32387097 TGGGATGCCCCCACACACCAAGG + Intergenic
1008074484 6:47131570-47131592 AGGCAGGCTGCCACCAACCATGG + Intergenic
1008236586 6:49058369-49058391 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1010294774 6:74183010-74183032 TGGCAGGCACCCCAACACCTGGG + Intergenic
1011338109 6:86283539-86283561 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1012540423 6:100355430-100355452 TGGGAGGCAGCCCCCCAGCAGGG + Intergenic
1013182753 6:107731973-107731995 TGGCAGAGACACAACCACCAAGG - Intronic
1013216441 6:108032066-108032088 TCACAGGCTCCCACCCACAAGGG - Intergenic
1014165829 6:118223626-118223648 TGCCAAGCACAGACCCACCAAGG - Intronic
1014605862 6:123472807-123472829 TGGGAGGCAACCCCCCAGCAGGG + Intronic
1014954053 6:127594008-127594030 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1015179582 6:130346815-130346837 TGGGAGGCACCCCCCCAGTAGGG + Intronic
1018884342 6:167920392-167920414 CGGCAGGCACTCGGCCACCACGG + Intronic
1019279784 7:193817-193839 TGGCAGGTGCCCACCCCCAAGGG + Intronic
1019293254 7:260775-260797 GGACAGGCAGCCACACACCAGGG - Intergenic
1019331159 7:461547-461569 GGGCAGGCACCCTCCCAGCGGGG + Intergenic
1020330304 7:7011209-7011231 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1022528900 7:31054784-31054806 TGCCTGAGACCCACCCACCATGG + Intronic
1026019883 7:66698420-66698442 TGCAAGGTCCCCACCCACCATGG + Intronic
1026153719 7:67809697-67809719 TGGGAGACAACCACCCACAAAGG - Intergenic
1026931306 7:74224367-74224389 TGGCAGCCGCCCAGCCTCCAGGG + Intronic
1027477115 7:78646987-78647009 TTACTGTCACCCACCCACCAAGG - Intronic
1027792418 7:82650575-82650597 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1028399751 7:90412249-90412271 TGTCAGGCACTCACACAGCAAGG - Intronic
1030132018 7:106209443-106209465 TGGGAGGCACCCCCCCAACAGGG + Intergenic
1030269920 7:107660474-107660496 TGGCAGGCTCCCAGAGACCACGG + Intergenic
1032425609 7:131820060-131820082 TGGCAGCCAAGCACCCATCAGGG - Intergenic
1034418634 7:150977934-150977956 GGGCGGGCCCCCACCCACCCCGG + Exonic
1034907183 7:154960207-154960229 TGGCATTCACCCTCCCACCGTGG + Intronic
1036110855 8:5900491-5900513 TGGCAGGCGCCCACCTACTTGGG + Intergenic
1036737490 8:11331234-11331256 AGGCAGGCCCCCACCCAGCAGGG - Exonic
1040060699 8:43100616-43100638 GCGCATGCACACACCCACCACGG - Intronic
1041018017 8:53610233-53610255 TGGGAGGCACCCCCACAGCAGGG + Intergenic
1041371299 8:57163908-57163930 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1041541568 8:58990773-58990795 GGGCAGGCACTCACCTACCTAGG + Intronic
1042967211 8:74367149-74367171 TTGCAGCCAGCCACCTACCATGG + Intronic
1044061893 8:87648741-87648763 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1048809958 8:138276726-138276748 GGGCACACACCCACACACCAGGG + Intronic
1049182573 8:141230570-141230592 TGGCGGCCCCCCAGCCACCAGGG - Intronic
1049330064 8:142045706-142045728 TGGCATGTGCCCACCCTCCAGGG + Intergenic
1049540895 8:143208284-143208306 CGGCAGGCACTCACCCACAGCGG - Intergenic
1049591737 8:143465875-143465897 CAGCAGGCAGCCACCCTCCAGGG + Intronic
1049605883 8:143528995-143529017 TGCCAGCCACCCCGCCACCATGG - Intronic
1051896815 9:21995913-21995935 TGGCACACACCCACCCACTCAGG - Intronic
1051896984 9:21996971-21996993 TGGCACGCACACACACACAATGG - Intronic
1053159658 9:35805286-35805308 ACACAGGCACCCAGCCACCAGGG - Intronic
1054425488 9:65062720-65062742 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1055380977 9:75706504-75706526 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1055853449 9:80659387-80659409 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1056051515 9:82774625-82774647 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1056436178 9:86577835-86577857 TGGCTAGGAGCCACCCACCACGG - Intergenic
1056843495 9:90017909-90017931 TGGAAGGCATCCACTCCCCAGGG + Intergenic
1057126319 9:92618799-92618821 TGGCTGGCAGCCAGCAACCAAGG + Exonic
1058086796 9:100756406-100756428 TGGCAGGCATCCAGCACCCAGGG - Intergenic
1058214436 9:102216495-102216517 TGGCAGCCACCTACACACCAAGG + Intergenic
1058975544 9:110122480-110122502 TGGCAGCCACCTACCCCCTAGGG - Intronic
1059922039 9:119169845-119169867 TGGGAGGCACCCCGCCAGCAGGG + Intronic
1060753860 9:126194660-126194682 TGGAAGGCACTCACCAAGCATGG + Intergenic
1062123421 9:134846601-134846623 GGGCATGCACCCTCCCTCCAGGG - Intergenic
1203397907 Un_KI270519v1:44594-44616 TGGGAGGCACCCACCCAGCAGGG + Intergenic
1186041231 X:5481175-5481197 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1186537882 X:10368576-10368598 TGGCAGGTTTCCACCCACCATGG + Intergenic
1188146380 X:26618827-26618849 TAGCAGGGAACCACCCATCAAGG - Intergenic
1188935950 X:36175577-36175599 TGGGAGGCACCACCCCAGCAGGG - Intergenic
1189026279 X:37398216-37398238 TGGGAGGCACCCCCCCAGTAGGG + Intronic
1189049889 X:37633835-37633857 TGGGAGGCACCCCCCCAGCAGGG - Intronic
1190030652 X:46969702-46969724 TGGCAGGCACCCAGCTACTCAGG + Intronic
1190807603 X:53853853-53853875 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1191205402 X:57828101-57828123 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1192755098 X:74039343-74039365 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1194417164 X:93628054-93628076 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1195088923 X:101440383-101440405 TGGGAGGCACCCCCCCAGCAGGG - Intronic
1195249100 X:103025867-103025889 TGGGAGGCACCCCCCCAGTAGGG - Intergenic
1195983722 X:110606557-110606579 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1200574132 Y:4867087-4867109 TGGGAGGCACCCCCCCAGTAGGG + Intergenic
1200583103 Y:4973970-4973992 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1202026476 Y:20528920-20528942 TGGGAGGCACCCCCCCAGTAGGG + Intergenic