ID: 900667025

View in Genome Browser
Species Human (GRCh38)
Location 1:3822493-3822515
Sequence CAGGACCCAGTTTGGGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 210}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900667025_900667031 -8 Left 900667025 1:3822493-3822515 CCAGATTCCCAAACTGGGTCCTG 0: 1
1: 0
2: 2
3: 27
4: 210
Right 900667031 1:3822508-3822530 GGGTCCTGAGCAGGGCCCCAGGG 0: 1
1: 0
2: 2
3: 49
4: 418
900667025_900667030 -9 Left 900667025 1:3822493-3822515 CCAGATTCCCAAACTGGGTCCTG 0: 1
1: 0
2: 2
3: 27
4: 210
Right 900667030 1:3822507-3822529 TGGGTCCTGAGCAGGGCCCCAGG 0: 1
1: 0
2: 2
3: 58
4: 472
900667025_900667038 22 Left 900667025 1:3822493-3822515 CCAGATTCCCAAACTGGGTCCTG 0: 1
1: 0
2: 2
3: 27
4: 210
Right 900667038 1:3822538-3822560 TTCGCTGCCTGGCATAAAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 162
900667025_900667036 11 Left 900667025 1:3822493-3822515 CCAGATTCCCAAACTGGGTCCTG 0: 1
1: 0
2: 2
3: 27
4: 210
Right 900667036 1:3822527-3822549 AGGGCTCAGCATTCGCTGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 126
900667025_900667037 21 Left 900667025 1:3822493-3822515 CCAGATTCCCAAACTGGGTCCTG 0: 1
1: 0
2: 2
3: 27
4: 210
Right 900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900667025 Original CRISPR CAGGACCCAGTTTGGGAATC TGG (reversed) Intronic
900667025 1:3822493-3822515 CAGGACCCAGTTTGGGAATCTGG - Intronic
901070924 1:6517900-6517922 CATGACGCATTTTGGGAGTCGGG - Intronic
901978470 1:13014279-13014301 CAGGTTATAGTTTGGGAATCTGG + Intronic
902003613 1:13214659-13214681 CAGGTTATAGTTTGGGAATCTGG - Intergenic
902022840 1:13360398-13360420 CAGGTTATAGTTTGGGAATCTGG - Intergenic
904015024 1:27413058-27413080 CAGGACAGACTTTGGGATTCAGG - Intronic
904266154 1:29319562-29319584 CAGGCCTGAGTTTTGGAATCTGG + Intronic
904904704 1:33886488-33886510 AAGAATCCAGTTAGGGAATCAGG + Intronic
904988552 1:34572923-34572945 CAGGTCCCACTTTGGGAGTGGGG - Intergenic
905059605 1:35128415-35128437 CAGGACACAGTTGGAGAAACTGG - Intergenic
905278461 1:36834012-36834034 CAGGCCCCAGTCTGGGAACCAGG + Intronic
906364709 1:45197131-45197153 CATGAACCTGTTTGGGAACCTGG + Intronic
908098365 1:60764189-60764211 AAAGACCTAGTTAGGGAATCAGG + Intergenic
908888350 1:68815760-68815782 CAGGACCCAGTCTGAAAAACAGG - Intergenic
909409255 1:75330239-75330261 CAGCACACATTTTGGGAATGGGG - Intronic
909863396 1:80636301-80636323 CAAGACACAGTTGGAGAATCTGG + Intergenic
909905183 1:81185692-81185714 AAGGACCCAGTTGGGGAAGAAGG + Intergenic
912444596 1:109725468-109725490 CAGGACACAGTTGGAGAAACTGG - Intronic
912780907 1:112547061-112547083 GAGGAGCCAATTTGGGAATAGGG - Intronic
914907918 1:151761879-151761901 GAGGTCCCAATCTGGGAATCAGG - Intronic
916623843 1:166532052-166532074 CAGGACACAGTTGGAGAAACTGG + Intergenic
917167457 1:172128341-172128363 AAAGACCCAGTTTGGGAAACTGG - Intronic
920654782 1:207867405-207867427 AAGGAGCCAGGTTGGGGATCGGG + Intergenic
920661581 1:207920134-207920156 GATGACCCAGATTGGGAATTCGG + Intergenic
922389105 1:225120278-225120300 CACCACCCAGTCTGGTAATCTGG - Intronic
922940778 1:229463542-229463564 CATGACCCAGTTTGCTGATCAGG - Exonic
923367424 1:233276573-233276595 CAGGACCCAGTGTGGTGATTTGG - Intronic
923936308 1:238764127-238764149 CAGGTTATAGTTTGGGAATCTGG + Intergenic
1065916892 10:30360221-30360243 CAGGACCCAGTGAGGGAAACAGG + Intronic
1067343122 10:45419888-45419910 GAGGACCCAGGCTGGGGATCGGG + Intronic
1069638521 10:69940455-69940477 CAGCACCCAGTTGTGAAATCTGG - Intronic
1069789767 10:71012153-71012175 CTGGGCCCAGTTCGGGAAACAGG + Intergenic
1070593246 10:77815260-77815282 CTGGCCCCAGTAGGGGAATCGGG - Intronic
1074358958 10:112809948-112809970 AAGGACCTGGTTTTGGAATCAGG + Intronic
1074881493 10:117663035-117663057 CATGACCATGTTTGGGAATCTGG + Intergenic
1075056727 10:119224212-119224234 GAGAGCCCAGTCTGGGAATCTGG - Intronic
1077681426 11:4244407-4244429 CAGGACCCCATCTGGGATTCAGG - Intergenic
1079958813 11:26896939-26896961 CTCCACCCAGTTTGGGAATCTGG + Intergenic
1081039630 11:38194220-38194242 CAGGACTCGCTTTAGGAATCTGG - Intergenic
1082969425 11:59003866-59003888 CAGGTTACAATTTGGGAATCTGG - Intronic
1083914000 11:65728163-65728185 CAGGACCATGGTTGGGAAGCTGG + Intergenic
1084731267 11:71075284-71075306 CAGAACCCAGGCTGTGAATCAGG + Intronic
1084830396 11:71764239-71764261 CAGGTTATAGTTTGGGAATCTGG - Intergenic
1086786221 11:90972419-90972441 CGGGACCCAGTGAGGAAATCGGG + Intergenic
1087971806 11:104493494-104493516 CAGGACACAATTGGGGAAACTGG + Intergenic
1091629151 12:2146215-2146237 CAAGAACCAGTTTGAGAAGCAGG + Intronic
1093326620 12:17783166-17783188 CAGGACTTACTTTGTGAATCTGG + Intergenic
1093960886 12:25271599-25271621 CACGGCCCAGCTTTGGAATCAGG + Intergenic
1095266296 12:40162099-40162121 CAGGACACAGTTGGAGAAACTGG - Intergenic
1097577555 12:61413695-61413717 AAGGACCCTGTTTCTGAATCAGG + Intergenic
1100979833 12:100155306-100155328 CATGACCCAGTGAGGGAAACAGG + Intergenic
1102572019 12:113832569-113832591 CAGGACCCGCTATGGCAATCCGG + Intronic
1103886635 12:124207338-124207360 CAGAACTGAGGTTGGGAATCTGG + Intronic
1105345915 13:19572617-19572639 TAGGGCACAGTTTGGGAAGCAGG - Intergenic
1105462926 13:20608521-20608543 CAGGACCCTGTCTGGAAAGCTGG + Intronic
1107417569 13:40215701-40215723 CAGGACCCACTTTGGGAGAAGGG - Intergenic
1107478463 13:40764045-40764067 TAGGACACAGTTTGGGAGCCAGG - Intronic
1110290174 13:73796588-73796610 AAGGACCCAGTTTGGGAGGAAGG - Intronic
1112847547 13:103662818-103662840 CAGGACCCAGGGTGGCAATGAGG - Intergenic
1116966959 14:51025030-51025052 CAGGAACCAGTTGGAAAATCAGG + Intronic
1118340357 14:64890884-64890906 CAACACCCAGTATGGGGATCTGG + Intergenic
1119429597 14:74557850-74557872 CAGGACACAGGTTGTGGATCAGG - Intronic
1119542571 14:75450421-75450443 CAGGAAACAGTGTGGGAAGCAGG - Intronic
1121214494 14:92236841-92236863 CAAGACACTGTTTGGGAATGTGG + Intergenic
1121977158 14:98415933-98415955 GAGGACCCAGTGGGGGACTCAGG + Intergenic
1124489983 15:30149749-30149771 CAGGACCCAGTGAGGGAAACGGG - Intergenic
1124753549 15:32388578-32388600 CAGGACCCAGTGAGGGAAACGGG + Intergenic
1126103160 15:45131563-45131585 CAGGGCCCTGCTTGGGGATCAGG - Exonic
1126679957 15:51192989-51193011 CAGGTCCCAGTTTGGGGTTATGG - Intergenic
1127281970 15:57500462-57500484 CAGGCCCCAGTTTGCTCATCTGG + Intronic
1129039116 15:72670595-72670617 CAGGACCCAGTGAGGGAAAAAGG - Intergenic
1129210713 15:74066314-74066336 CAGGACCCAGTGAGGGACACGGG + Intergenic
1129378255 15:75148592-75148614 CAGGACACAGTTGGAGAAACTGG + Intergenic
1129399628 15:75274445-75274467 CAGGACCCAGTGAGGGAAAAAGG - Intronic
1129403298 15:75299015-75299037 CAGGACCCAGTGAGGGACACGGG - Intergenic
1129544459 15:76380117-76380139 CTGGAAACAGTTTGGAAATCAGG - Intronic
1129727909 15:77910929-77910951 CAGGACCCAGTGAGGGAAATGGG + Intergenic
1129839971 15:78737931-78737953 CAGGACCCAGTGAGGGAAATGGG - Intergenic
1130258904 15:82338987-82339009 CAGGACCCAGTGAGGGAAACAGG + Intergenic
1130269770 15:82440116-82440138 CAGGACCCAGTGAGGGAAATGGG - Intergenic
1130282404 15:82530567-82530589 CAGGACCCAGTGAAGGAAACGGG - Intergenic
1130462109 15:84167417-84167439 CAGGACCCAGTGAGGGAAATGGG - Intergenic
1130473730 15:84246340-84246362 CAGGACCCAGTGAGGGAAACGGG - Intergenic
1130481145 15:84360404-84360426 CAGGACCCAGTGAGGGAAACGGG - Intergenic
1130490568 15:84427356-84427378 CAGGACCCAGTGAGGGAAATGGG + Intergenic
1130502156 15:84506126-84506148 CAGGACCCAGTGAGGGAAATGGG + Intergenic
1130596016 15:85250954-85250976 CAGGACCCAGTGAGGGAAACAGG - Intergenic
1131189265 15:90300994-90301016 CAGGACCCAGTGGGGGAAGCAGG - Intronic
1132185062 15:99796985-99797007 CAGGACCCAGTGAGGGAAATGGG - Intergenic
1132431927 15:101767570-101767592 CAGGACCCAGTGAGGGAAATGGG + Intergenic
1139141187 16:64264463-64264485 CTGGAGCCAGATTGGGAAACTGG + Intergenic
1141034869 16:80618254-80618276 CAGGAGCCAGTTTGGGCCTCAGG + Intronic
1145347255 17:22048931-22048953 CAGGGCCCAATTGGGGACTCAGG - Intergenic
1148028942 17:44606923-44606945 CAGCACCCCGTTTGGGAAACAGG - Intergenic
1148141673 17:45333508-45333530 CTGGAGCCAGTTTGGGGAGCTGG - Intergenic
1149738972 17:59025105-59025127 CAGAACCATGTTTGGGAATCTGG + Intronic
1152266627 17:79298703-79298725 CAGGGCCCAGCTGGGGAAGCTGG + Intronic
1153661888 18:7332871-7332893 CAGGCCTCAGTTTGCGCATCTGG - Intergenic
1156301563 18:35840945-35840967 CACCACCCAGATTGGTAATCTGG + Intergenic
1157291909 18:46415667-46415689 CTTGGCCCAGGTTGGGAATCTGG - Intronic
1157381522 18:47222552-47222574 CAGGACCAAGTGTTGGAACCAGG - Intronic
1157772434 18:50361112-50361134 CTGGACCCAGTGGGGGAATGTGG + Intergenic
1159187972 18:65003190-65003212 TATGACCCAGTTTGGTCATCTGG + Intergenic
1160869396 19:1270146-1270168 CAGGACCTAGGCCGGGAATCGGG - Intronic
1161981806 19:7633851-7633873 CAGGAGCCAGTGGGGGAACCTGG - Intronic
1162527583 19:11215448-11215470 GAGGAGCCCGTTTGGGAATCCGG - Exonic
1164157113 19:22603569-22603591 CAGGACCCAGTGAGGGAAACAGG - Intergenic
1165634505 19:37329264-37329286 CACCACCCAGCTTGGGTATCTGG + Intronic
1166154314 19:40899473-40899495 CAGGACAGTGGTTGGGAATCTGG + Intergenic
1166173796 19:41051107-41051129 CAGGACAGTGGTTGGGAATCTGG - Intergenic
1166373938 19:42316597-42316619 CAGGGCTCAGGTTGGGCATCAGG + Intronic
1167260123 19:48453643-48453665 CAGGACCCAGTTTTGGCTGCTGG + Exonic
1168265882 19:55223787-55223809 CAGGGACTAGTTTGGGAATGTGG + Intergenic
927495207 2:23547274-23547296 CCGGACCCAGGCTCGGAATCGGG - Intronic
928170198 2:28998511-28998533 CAGCACCCAGGTTGGCAATGGGG + Intronic
928913691 2:36448870-36448892 CAGGAGGGAGCTTGGGAATCTGG - Intronic
932277983 2:70465667-70465689 CAGAACTGAGTGTGGGAATCTGG + Exonic
933093080 2:78145868-78145890 CAGTACCCACTTTGGGGACCTGG + Intergenic
935024818 2:99266752-99266774 CAGGACACAGTTGGAGAAACTGG + Intronic
936630742 2:114200200-114200222 CAAGCCCCACTTTTGGAATCTGG + Intergenic
937960295 2:127453140-127453162 CAGGACACTGTTAGGGAGTCAGG - Intronic
938185413 2:129227541-129227563 CAGGACCCAGAGTGGGAGGCAGG - Intergenic
942054954 2:172173447-172173469 GATGACCCAGTTTGGGGATGGGG - Intergenic
942347832 2:175021276-175021298 CAGGACCAAGTTTTGGAGACTGG + Intergenic
943571693 2:189581538-189581560 GAGGCCCCAGTTTGGGGATACGG - Intronic
945936687 2:215909555-215909577 CACCACCCAGATTGGTAATCTGG + Intergenic
946058265 2:216919759-216919781 AAGGACTCAGTTTGGGGCTCAGG + Intergenic
946526596 2:220527406-220527428 GGGGACCTAGTTTGGGAAACTGG - Intergenic
947671191 2:231936665-231936687 CAGGACCAAGTGTGGGTTTCAGG - Intergenic
947990377 2:234482975-234482997 CAGGTGGCAGTTTTGGAATCAGG - Intergenic
1169749482 20:8977063-8977085 CAGCTCACAGTTTGGGAGTCGGG + Intergenic
1170481107 20:16765816-16765838 CAGGGCACAGTCTGGCAATCTGG - Intronic
1171506302 20:25637222-25637244 CAGGACACAATTTGAGAATATGG - Intergenic
1171520306 20:25770582-25770604 CAGGGCCCAGTTGGGGACTCAGG + Intronic
1171556613 20:26085911-26085933 CAGGGCCCAGTTGGGGACTCAGG - Intergenic
1174343371 20:49911976-49911998 CTGGACCCAGTCGGGGAATGGGG + Intronic
1174510160 20:51045274-51045296 CAGGACCCAAATTATGAATCTGG - Intergenic
1175042896 20:56072483-56072505 CAGGAGCCAGTGTGGGAAAGTGG + Intergenic
1175726560 20:61322527-61322549 CAGGACCCAGGAGGGGATTCAGG - Intronic
1179509771 21:41864914-41864936 CAGGACCCAGCTTGGCGTTCCGG - Intronic
1181432686 22:22892809-22892831 CAGAACCCAGGGTGGGGATCTGG + Intronic
1184870886 22:47237880-47237902 CTGGACCCAGGTGGGGAACCGGG + Intergenic
949669674 3:6384800-6384822 CAGGATGCAGTATGGGAAACGGG + Intergenic
949997831 3:9632641-9632663 CAGGACACAATTGGGGAAACTGG - Intergenic
950018100 3:9768360-9768382 CGGGACCCAGATGGGGAGTCAGG - Intronic
951297966 3:20962589-20962611 CAGGACACAGTTGGAGAAACTGG + Intergenic
951844061 3:27066416-27066438 CAGAATCCATTTTGGGAATTGGG - Intergenic
952285023 3:31960167-31960189 CAGCTCACAGTCTGGGAATCTGG + Intronic
952925571 3:38316988-38317010 CAGGACCCCATTTGGGAACTGGG + Intronic
953859400 3:46529976-46529998 CAGGACACAGATTGGGACACTGG + Exonic
954329232 3:49880724-49880746 CAGGACCCAGCTTGGGTGTAGGG - Intergenic
955364243 3:58298131-58298153 CAGCACCCAGTTTGGGGTTGGGG - Intergenic
956047983 3:65216724-65216746 CAGGAGCCAATTTAGGAAACTGG + Intergenic
957069774 3:75558106-75558128 CAGGTTATAGTTTGGGAATCTGG - Intergenic
961275078 3:125720009-125720031 CGGGACCAAGCTTGGGCATCAGG + Intergenic
963030982 3:140975726-140975748 TAAAACCCAGTCTGGGAATCAGG - Intronic
964483999 3:157168668-157168690 CAGGACCCATCAAGGGAATCTGG + Intergenic
964859191 3:161181714-161181736 CAGGACCCAGTTGGAGAAACTGG - Intronic
966253989 3:177897369-177897391 CAGGACCCAGTTTGGTTTTGTGG + Intergenic
972157249 4:36179694-36179716 CAGAGCCCAGTTTGGGAAATGGG + Intronic
977042559 4:92032227-92032249 CAGGACACAGTTGGAGAAACTGG - Intergenic
980339945 4:131532033-131532055 CACCACCCAGATTGGAAATCTGG + Intergenic
983296534 4:165874300-165874322 CATCTCCCAGTTTGGGAATAAGG + Intronic
985160954 4:187044032-187044054 CATGAACCAGTGTGGGAACCAGG + Intergenic
985461147 4:190108098-190108120 CAGGTTATAGTTTGGGAATCTGG + Intergenic
988139918 5:27224078-27224100 GAGGAAACATTTTGGGAATCTGG + Intergenic
989297922 5:39851353-39851375 AAAGACTCAGTGTGGGAATCAGG + Intergenic
990527853 5:56645842-56645864 CATGACCCAGGTTGGGAAAGAGG + Intergenic
991167823 5:63584257-63584279 CAGGACTCACTTTATGAATCTGG - Intergenic
992824980 5:80539895-80539917 CAGGAAACAATTGGGGAATCTGG - Intronic
996775513 5:127128396-127128418 CAGGAACCAAGATGGGAATCTGG + Intergenic
996780835 5:127185036-127185058 CTGGACCCAGATTTTGAATCTGG - Intergenic
997637216 5:135421177-135421199 CAGGCCACAGATTGAGAATCTGG - Intergenic
999182144 5:149677256-149677278 CAGGACCCAGTGGGAGGATCAGG - Intergenic
999591239 5:153148803-153148825 AAGGAACCAGTTTAAGAATCTGG + Intergenic
1000741042 5:164970209-164970231 CAGGACACAATTTGAGAAACTGG - Intergenic
1001289614 5:170447513-170447535 CAGGACCCCGTTTGTGAAGGGGG + Intronic
1004432729 6:15560532-15560554 CAGGGCCCAGTTGGAGAAACTGG + Intronic
1005444086 6:25903213-25903235 AAAGACCGTGTTTGGGAATCAGG + Intergenic
1007571601 6:42895491-42895513 CAGGTTATAGTTTGGGAATCTGG + Intergenic
1007709011 6:43809784-43809806 CACGAGCCAGGTTTGGAATCTGG - Intergenic
1008549450 6:52613715-52613737 CAGGATCCAATTTGGGAAAATGG - Intergenic
1009466560 6:63977716-63977738 CAGGACCGAGTTTGTGTGTCAGG + Intronic
1011590942 6:88970375-88970397 CAGGACACAGTTGGAGAAACTGG + Intergenic
1015129757 6:129795857-129795879 CAGTTGCCATTTTGGGAATCTGG - Intergenic
1017102449 6:150860603-150860625 CAGGTTATAGTTTGGGAATCTGG - Intergenic
1018078337 6:160236575-160236597 CAGGACACAGTTGGAGAAACTGG + Intronic
1019233565 6:170588883-170588905 CAGGACACAATTGGGGAAACTGG - Intergenic
1019410607 7:904989-905011 CAGGCCCCAGTGTGGGAGGCCGG + Intronic
1021043223 7:15889646-15889668 GAGGAGCCAGACTGGGAATCTGG - Intergenic
1023125100 7:36947494-36947516 CATGGCCCAGATTGGGAATGTGG - Intronic
1023567527 7:41538420-41538442 CTGGGCCAAGTTTGGGAACCAGG - Intergenic
1025280800 7:57625537-57625559 CAGGGCCCAGCTGGGGACTCAGG + Intergenic
1025303930 7:57839970-57839992 CAGGGCCCAGCTGGGGACTCAGG - Intergenic
1025932389 7:66006516-66006538 CAGGTTATAGTTTGGGAATCTGG + Intergenic
1026528961 7:71180848-71180870 AAGAACTCAGTTTGGGAAGCAGG + Intronic
1027227733 7:76255018-76255040 CATCACCCAGCTTGGGAATCGGG + Intronic
1027553947 7:79638795-79638817 CTGGACTCAGTTTGGAAATAAGG + Intergenic
1028229340 7:88287648-88287670 CACCACCCAGATTGGTAATCTGG - Intronic
1030344741 7:108420126-108420148 CTGTACCCAGTTAAGGAATCTGG + Intronic
1030730643 7:112983751-112983773 CAGAGCCCTGTTTGGGAATCTGG + Intergenic
1034165970 7:149025284-149025306 CAGGACCCAGTGTTGTCATCAGG - Intronic
1035721477 8:1796550-1796572 GAGGCCCCAGTTTGGAAATCAGG + Intergenic
1042229299 8:66540572-66540594 CAGAACACAGGATGGGAATCAGG - Intergenic
1043706185 8:83353584-83353606 CAGGACACAGTTGGAGAAACTGG - Intergenic
1044316323 8:90753085-90753107 CAGGACCCAAATTGGGAAAAAGG + Intronic
1045568296 8:103343595-103343617 CAGGATCCAGTTTAGGTCTCAGG - Intergenic
1047494263 8:125398449-125398471 CAGGAACAGGTCTGGGAATCTGG - Intergenic
1048550196 8:135426934-135426956 CAAGACCTAGTTTGGAAAGCAGG - Intergenic
1049876209 8:145023100-145023122 CAGGTTATAGTTTGGGAATCTGG + Intergenic
1056340943 9:85631171-85631193 CTGCACCCACTTTGGGAATGAGG + Intronic
1057467208 9:95325161-95325183 CAGGACACAATTTGAGAAACTGG - Intergenic
1057726651 9:97572818-97572840 CAGGACACAGTTTGGGAACCAGG + Intronic
1061062144 9:128255787-128255809 CAGGACCCAGTGAGAGAAACAGG + Intergenic
1061155156 9:128855590-128855612 CAGGTTATAGTTTGGGAATCTGG - Intronic
1061374690 9:130216943-130216965 CAGGAGCCAGTTTGTGAATTGGG + Intronic
1061736513 9:132664097-132664119 CATGACCCATTCTAGGAATCAGG + Intronic
1062359107 9:136179013-136179035 CAGGCCCCAGTTTCGGACTCTGG - Intergenic
1186579382 X:10800961-10800983 CAGGAACCATTTTGGTATTCTGG + Intronic
1186600338 X:11030066-11030088 CAGAACAAAGTTTGGGGATCTGG + Intergenic
1189415254 X:40807029-40807051 GAGGAGCCAGTTTGTCAATCAGG + Intergenic
1191579220 X:62741649-62741671 CAGGTTATAGTTTGGGAATCTGG - Intergenic
1191822981 X:65333288-65333310 CAGGACACAGTTGGAGAAACTGG - Intergenic
1192339631 X:70252883-70252905 GAGGAAACAGTTTGGGACTCTGG - Intergenic
1192542419 X:71985431-71985453 CAGGACACAATTTGAGAAACTGG - Intergenic
1194147974 X:90287010-90287032 CAGGACACAGTTAGAGAAACTGG + Intergenic
1194870120 X:99119531-99119553 CAGGAGCCTGTTTGGGGATGGGG - Intergenic
1196456626 X:115895747-115895769 CAGGACCCAGCTAGGCCATCAGG + Intergenic
1196773035 X:119314835-119314857 CAGGACACAATTTGAGAAACTGG + Intergenic
1200052603 X:153442966-153442988 CAGGACCTAGTTTGGGAATGTGG - Intergenic
1200260080 X:154610256-154610278 CAGGTTATAGTTTGGGAATCTGG + Intergenic
1200752570 Y:6960254-6960276 CAGGTTATAGTTTGGGAATCTGG + Intronic
1202270514 Y:23067849-23067871 CAGGACACAGTTAGAGAAACTGG - Intergenic
1202295513 Y:23352833-23352855 CAGGACACAGTTAGAGAAACTGG + Intergenic
1202367666 Y:24178197-24178219 CAGGACCCAGTGAGGGAAACAGG - Intergenic
1202377170 Y:24247715-24247737 CAGGACCCAGTCAGGGAAATGGG + Intergenic
1202423508 Y:24701593-24701615 CAGGACACAGTTAGAGAAACTGG - Intergenic
1202447281 Y:24968492-24968514 CAGGACACAGTTAGAGAAACTGG + Intergenic
1202493610 Y:25422406-25422428 CAGGACCCAGTCAGGGAAATGGG - Intergenic
1202503117 Y:25491926-25491948 CAGGACCCAGTGAGGGAAACAGG + Intergenic