ID: 900667032

View in Genome Browser
Species Human (GRCh38)
Location 1:3822512-3822534
Sequence TGAGCCCTGGGGCCCTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 1, 2: 16, 3: 48, 4: 436}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900667032_900667040 25 Left 900667032 1:3822512-3822534 CCTGAGCAGGGCCCCAGGGCTCA 0: 1
1: 1
2: 16
3: 48
4: 436
Right 900667040 1:3822560-3822582 GCACCGCCAGCCCATCGTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 53
900667032_900667036 -8 Left 900667032 1:3822512-3822534 CCTGAGCAGGGCCCCAGGGCTCA 0: 1
1: 1
2: 16
3: 48
4: 436
Right 900667036 1:3822527-3822549 AGGGCTCAGCATTCGCTGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 126
900667032_900667038 3 Left 900667032 1:3822512-3822534 CCTGAGCAGGGCCCCAGGGCTCA 0: 1
1: 1
2: 16
3: 48
4: 436
Right 900667038 1:3822538-3822560 TTCGCTGCCTGGCATAAAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 162
900667032_900667037 2 Left 900667032 1:3822512-3822534 CCTGAGCAGGGCCCCAGGGCTCA 0: 1
1: 1
2: 16
3: 48
4: 436
Right 900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 73
900667032_900667042 30 Left 900667032 1:3822512-3822534 CCTGAGCAGGGCCCCAGGGCTCA 0: 1
1: 1
2: 16
3: 48
4: 436
Right 900667042 1:3822565-3822587 GCCAGCCCATCGTGTTGGACAGG 0: 1
1: 0
2: 0
3: 8
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900667032 Original CRISPR TGAGCCCTGGGGCCCTGCTC AGG (reversed) Intronic
900287439 1:1908484-1908506 TGACTCCTGGGGCCCTGCTGAGG + Intergenic
900407469 1:2498898-2498920 TGTGCCCGGGTGCCCTGCCCAGG + Intronic
900667032 1:3822512-3822534 TGAGCCCTGGGGCCCTGCTCAGG - Intronic
900716268 1:4146942-4146964 TGAGGCCTTGGGCCCTGCTGAGG + Intergenic
900762754 1:4483759-4483781 TGACTTCTGGGGCACTGCTCTGG + Intergenic
900963348 1:5939905-5939927 TGTGCCCTGGGGTCCTGGTGGGG - Intronic
901228963 1:7631346-7631368 AGAGCCCTGGGGCAGTGGTCTGG + Intronic
901777435 1:11569959-11569981 TGAGTCCTGGGGCCCTGCCCTGG - Intergenic
901796918 1:11684853-11684875 TGAGGGCTGGGTCCCTGCCCCGG - Intronic
902197556 1:14809093-14809115 ATAGACCTGGGGCCCTGTTCTGG - Intronic
902236584 1:15061465-15061487 TGCAGCCTGGGGCCCTGCTCAGG + Intronic
902548528 1:17205572-17205594 TGAGCCCTGGGGTCAGGCTTTGG + Intronic
902621041 1:17651342-17651364 TGGGCCCTGGGGCCTTGGGCTGG + Intronic
902755893 1:18548900-18548922 TGAGCCATGAGGCCCTGGACTGG - Intergenic
902916121 1:19640784-19640806 TTAGCCCTGAGCCCCAGCTCTGG + Intronic
904254000 1:29243178-29243200 TGAGCCCCCGGGCCCGGCCCAGG + Intronic
905207161 1:36349542-36349564 CGGGGCCTGGGGCCCTGCCCAGG - Intronic
905362518 1:37430521-37430543 TGGGCCCTGGAGCCCCACTCAGG + Intergenic
906153379 1:43600521-43600543 TGGGCCCTGTGGCCACGCTCGGG - Intronic
906939612 1:50244717-50244739 TGAGCCCTGGGGCTCAGAGCTGG - Intergenic
908511307 1:64852026-64852048 TGAGCGCCGGGTCCCTGCACAGG + Intronic
909564996 1:77044228-77044250 TGTGCCCTGGTGACCAGCTCAGG + Exonic
910352848 1:86319323-86319345 TGAGCCCTGGACATCTGCTCAGG + Intergenic
910430172 1:87152218-87152240 GGAGGCCGGCGGCCCTGCTCGGG - Intronic
911280781 1:95925244-95925266 TGACCTCTGGGGCCCTTCCCTGG - Intergenic
912380499 1:109245460-109245482 TGAGCCCTGGGCCCCTCCGCAGG - Intergenic
912499245 1:110111076-110111098 TGAGCCGGGGGTGCCTGCTCAGG + Intergenic
913540726 1:119818278-119818300 TGAGCCCTGAGGACATGCTGTGG - Intergenic
913961086 1:143338687-143338709 AGGGCCCGGGTGCCCTGCTCAGG - Intergenic
914055440 1:144164260-144164282 AGGGCCCGGGTGCCCTGCTCAGG - Intergenic
914123706 1:144802102-144802124 AGGGCCCGGGTGCCCTGCTCAGG + Intergenic
915080767 1:153350145-153350167 AGAGCACTGGGAGCCTGCTCTGG - Intergenic
915310260 1:155002845-155002867 GGGGGCTTGGGGCCCTGCTCCGG - Exonic
915356845 1:155260477-155260499 TGAGCCCTGGGCCCCAGGACTGG + Intronic
915462199 1:156076862-156076884 TGCGCCCGGGGGCCCAGCGCGGG + Exonic
915564708 1:156706939-156706961 CCAGCCCTGGGTCCCTGCCCTGG + Intergenic
915586756 1:156848023-156848045 TGAATTCTTGGGCCCTGCTCAGG + Intronic
915634719 1:157178166-157178188 CCTGCCATGGGGCCCTGCTCTGG + Intergenic
916455824 1:164970059-164970081 TGAGCCCTGGAGTCTGGCTCGGG - Intergenic
917602776 1:176594565-176594587 TGGGCCCTGGGGATCCGCTCAGG + Exonic
918116784 1:181504626-181504648 GGAGCCCTGGGGGCCTGGCCTGG - Intronic
920251612 1:204625898-204625920 TCAGCCTTGGGGCCCAGCTCTGG + Intronic
921047858 1:211490270-211490292 TGAGAACTGAGGCCCTGCGCCGG + Intronic
922057406 1:222054706-222054728 TGGGCCCTGGGGACATGCTGAGG - Intergenic
922741591 1:228017142-228017164 TGAGCCTTGGCTTCCTGCTCTGG + Intronic
923568012 1:235091241-235091263 TGAGCCCTGGTTTCCTGCTGTGG - Intergenic
924893082 1:248306308-248306330 TGCGCCATGGGGCCGTGCTGGGG + Intergenic
1063410920 10:5835865-5835887 TGAGCCCTAGGGCTCGGCACAGG - Intronic
1063481880 10:6383527-6383549 TGTGGCCTCAGGCCCTGCTCTGG + Intergenic
1065927248 10:30445729-30445751 TTAGCTCTAGGGCCCTGCACAGG + Intronic
1066005951 10:31146362-31146384 TGCTCCCTGGATCCCTGCTCAGG + Intergenic
1067029532 10:42871088-42871110 AGGGCCCAGGTGCCCTGCTCAGG - Intergenic
1067796500 10:49325661-49325683 TCTGCCAGGGGGCCCTGCTCTGG - Exonic
1069854556 10:71432799-71432821 TGGGCCGTGGGTCCCAGCTCGGG - Intronic
1070014527 10:72512784-72512806 TGACCTCTGGGGCTCAGCTCAGG + Intronic
1070494872 10:77012382-77012404 TGAGCCCTGGGCCCTTGGTGGGG + Intronic
1071486722 10:86107257-86107279 GGAGCCCTGTGGCCCTGCCCTGG + Intronic
1072301628 10:94067607-94067629 TTAGCCCTGGGGTGTTGCTCAGG - Intronic
1072620535 10:97076259-97076281 CCAGCCCTGGCTCCCTGCTCAGG + Intronic
1072745051 10:97933964-97933986 AGAGCCCTGGTTCCCTGCCCAGG - Intronic
1073456492 10:103639948-103639970 GGAGCCCTGAGGACATGCTCAGG + Intronic
1073479967 10:103780193-103780215 TGCACACTGGGGGCCTGCTCTGG - Intronic
1074002545 10:109387402-109387424 GGTGGCCTGGGTCCCTGCTCTGG + Intergenic
1075105770 10:119539092-119539114 TGAGCCTCTGGGACCTGCTCTGG - Intronic
1075256456 10:120929362-120929384 GGAGCCCTGAGGCTGTGCTCTGG - Intergenic
1076003337 10:126929454-126929476 TGAGCCCCAGGCCCCTTCTCTGG - Intronic
1076322663 10:129594981-129595003 TGAGACGTGGGGCGCTGCTCCGG - Intronic
1076397468 10:130151207-130151229 TGAGCCATCGTGCCCGGCTCTGG + Intronic
1076574720 10:131456615-131456637 TGATCCCTGAGGGCCTGCTCTGG - Intergenic
1076621773 10:131793505-131793527 TGAGCCACCGCGCCCTGCTCTGG + Intergenic
1076720722 10:132391559-132391581 TGATCCCAGGGGCCCTGGGCTGG + Intergenic
1077044505 11:538399-538421 TGAGGCCTGGGGCCTTGCACTGG + Intronic
1077096718 11:802110-802132 TGAGCACTGGAGCCATGCCCGGG + Intronic
1077394808 11:2315628-2315650 TGAGCCCTGAGACCCTGCGGAGG + Intronic
1077502426 11:2915432-2915454 TGTGCCCTGAGGCCCTGGCCAGG + Intronic
1077579374 11:3407150-3407172 TGAGCCCTTGGCCCCTGCTCAGG + Intergenic
1078182366 11:9022763-9022785 TAAGCCCTGGGACCCTCCTTTGG - Intronic
1079064291 11:17276406-17276428 CGATCCCTGGGGCTCTGCCCGGG + Intronic
1079121436 11:17688097-17688119 AGAGCCCTGGCCCCCTCCTCAGG + Intergenic
1082179673 11:49102567-49102589 TGAGCCCGGGTGCCCGGCTTAGG - Intergenic
1083302987 11:61748474-61748496 TGTGCCCTTGGGCCCTAGTCCGG + Intergenic
1083474961 11:62909622-62909644 TCAGCCCCAGGGCCCTGCTCAGG - Exonic
1083593940 11:63910147-63910169 AGTGCCCAGTGGCCCTGCTCTGG - Exonic
1083617701 11:64034788-64034810 GGAGCACTGGGGCCCTGGTGGGG + Intronic
1083702681 11:64490122-64490144 TGAGCCCTGAGACCCTCCTCTGG - Intergenic
1083752174 11:64766781-64766803 TGAGCCCCTGGGCTCTGCTGGGG - Intronic
1084036493 11:66514537-66514559 TGAGCCCCGGACCCCAGCTCTGG + Exonic
1084236407 11:67790693-67790715 TGAGCCCTTGGCCCCTGCTCAGG + Intergenic
1084333188 11:68441613-68441635 TGTGCTCGGGGGCCCTGCTTGGG - Intronic
1084567932 11:69942222-69942244 TGGGCCATGGGGCCCTGCCATGG - Intergenic
1084836008 11:71802300-71802322 TGAGCCCTTGGCCCCTGCTCAGG - Intergenic
1085777274 11:79378283-79378305 GGGGGCCTGGGGCCCTTCTCTGG + Intronic
1086649697 11:89272928-89272950 AGAGAGCTGGGGCCTTGCTCTGG + Intronic
1086685609 11:89730345-89730367 TGAGCCCGGGTGCCCGGCTTAGG + Intergenic
1089604782 11:119635581-119635603 TGAGCCCAGGGGCCGTGGTTAGG - Intronic
1089614439 11:119687316-119687338 CCATCCCTGAGGCCCTGCTCTGG + Intronic
1090004031 11:122984501-122984523 AGCGCCCCAGGGCCCTGCTCGGG - Intergenic
1090090862 11:123696619-123696641 TGGGCCCTGCTGCCCTGATCAGG + Intergenic
1090391982 11:126394706-126394728 TGAGGCACGGGGCCCTGCCCTGG + Intronic
1090533509 11:127615674-127615696 TGAGCCCTGGAGCCCCCCTGTGG - Intergenic
1090951362 11:131476374-131476396 TGGGCCCTGTGGCCATGCTTAGG + Intronic
1091587071 12:1822481-1822503 TGGGCCCTGGGGCCGGGCTCAGG - Intronic
1091800570 12:3322051-3322073 AGAGGCCTGGAGCCCAGCTCAGG - Intergenic
1091954675 12:4628561-4628583 TGGGCCCTGGGGCCCTGGCAAGG + Exonic
1092184856 12:6471096-6471118 CCAGCCCTGGTGCCCTGCTCTGG + Intergenic
1092407313 12:8230100-8230122 TGAGCCCTTGGCCCCTGCTCAGG + Intergenic
1094829749 12:34294694-34294716 TGATCCCCTGGGCCCTGCGCAGG + Intergenic
1094831749 12:34303447-34303469 GGATCCCTAGGGCCCTGCTCGGG - Intergenic
1094834516 12:34316022-34316044 GGATCCCCGGGTCCCTGCTCAGG + Intergenic
1094836042 12:34322546-34322568 GGATCCATGGGGCCCTGCGCAGG + Intergenic
1094836900 12:34326317-34326339 GTATCCCTGGGGCCCTGCGCAGG + Intergenic
1096243856 12:49973701-49973723 TGGGTCCTGGGGCCCAGCCCGGG - Intronic
1096787884 12:54028184-54028206 TGAGTCCCAAGGCCCTGCTCAGG + Intronic
1098188625 12:67924706-67924728 TGAGCCACGGCGCCCAGCTCAGG - Intergenic
1100839125 12:98594065-98594087 TGGGCCCTGGGGAGCTGCTGCGG - Exonic
1101738427 12:107481364-107481386 TGACCCCGGAGGCCCTGCCCAGG + Intronic
1101758234 12:107638351-107638373 TGCACCTTGGGGCCCTGGTCTGG - Intronic
1101913017 12:108874832-108874854 TGATGCCTGGGGTCCTTCTCTGG + Intronic
1102465537 12:113129067-113129089 TGATCCCTGGAGCCCAGCACAGG - Intronic
1102547909 12:113670025-113670047 TCTGCCCAGCGGCCCTGCTCGGG + Intergenic
1103611965 12:122129527-122129549 AGAGCCCTTGGGCCCTCCTAGGG + Intronic
1103714442 12:122935795-122935817 TGTGACCTGGAGCCCTGCTGTGG - Intronic
1103874536 12:124116847-124116869 TGAGCCATGGCGCCCGGCTGGGG + Intronic
1104633522 12:130424316-130424338 TGGGCCCTGGTGGCCTCCTCAGG - Intronic
1104773376 12:131378664-131378686 ACACCCCTGGGGCCCTGCGCCGG - Intergenic
1104811122 12:131621036-131621058 TCAGCCCTGGGGCTCTGGGCGGG - Intergenic
1104980525 12:132571379-132571401 TGGGCCCGGGGGCTCTGCTGCGG + Exonic
1107482454 13:40795927-40795949 TGATCCCTGGGTCCCTTGTCTGG + Intronic
1108612656 13:52099386-52099408 TGAGCCATGGCGCCCGGCCCCGG - Intronic
1108676472 13:52741172-52741194 TCATCCCTGGGGCACTGCTGAGG + Intergenic
1113513495 13:110873387-110873409 GGAGCTCAGGGGCCCTGCTGGGG - Intergenic
1113881798 13:113631026-113631048 TGTGCCCTGGGGCCCTGTCTGGG - Intronic
1114460813 14:22885045-22885067 GGGGCTCTGGGGCCCTGGTCAGG + Intronic
1114613414 14:24056249-24056271 TGGGACCTGGGGCTCAGCTCAGG + Intronic
1114633112 14:24172197-24172219 TGCTCCCTCGGGACCTGCTCTGG + Exonic
1117252394 14:53950587-53950609 TGAGCCCTGCGGTCCTTCGCTGG - Exonic
1117585012 14:57192407-57192429 TGAGCCCTGGGCAACTGCACAGG + Intergenic
1118720357 14:68589596-68589618 TGGTCCCAGGGGCCCTGCACAGG + Intronic
1119266233 14:73264634-73264656 TCAGCCCAGGGACCCAGCTCAGG + Exonic
1119324747 14:73753171-73753193 TGAGCCCTGAGGCCCTTCTGTGG - Intronic
1119379772 14:74221132-74221154 TGAGCCCCGGGGCTCAGGTCTGG + Intergenic
1120997881 14:90430235-90430257 AGAGCCCTGGATCCCTGCTTTGG + Intergenic
1122008622 14:98727250-98727272 CGCATCCTGGGGCCCTGCTCAGG + Intergenic
1122228702 14:100294265-100294287 TGGGGCCTGGGGCGCTGGTCAGG + Intronic
1122616367 14:103020604-103020626 TGGTCCCTGGGGTGCTGCTCTGG - Intronic
1122745997 14:103897526-103897548 TCAGCCCAGCGGCCCTGGTCTGG - Intergenic
1122804068 14:104247884-104247906 TCAGCCCAGGGTCCCTCCTCGGG + Intergenic
1122850025 14:104523064-104523086 AGAGCCCTGAGGCCCAGCTTGGG + Intronic
1122919390 14:104873846-104873868 TGAGGCCTGGGGCCGGGCTCGGG - Intronic
1123000447 14:105291188-105291210 TGCGGCCTCTGGCCCTGCTCTGG - Intronic
1123995127 15:25713076-25713098 GGAGCCTAGGGGCCCTGCTGAGG - Intronic
1124240484 15:28024132-28024154 GCAGCCCTGGCTCCCTGCTCGGG + Intronic
1124635535 15:31362325-31362347 AAAGCCCTGGAGCCCTGCCCTGG + Intronic
1124964727 15:34424307-34424329 CGATCCCTGGGGCCCTCCTCAGG - Intronic
1124981343 15:34570533-34570555 CGATCCCTGGGGCCCTCCTCAGG - Intronic
1125546214 15:40507419-40507441 TGAGCTCTGGGGTCCTGCCCGGG - Intergenic
1125713316 15:41804553-41804575 TGAGACCTGTGTCCCTGCCCTGG + Intronic
1127798152 15:62455664-62455686 TGTTCCCAGGTGCCCTGCTCGGG + Intronic
1128623294 15:69171677-69171699 TGAGCCACCGCGCCCTGCTCTGG + Intronic
1128680367 15:69647195-69647217 TGACCCCTGGCTCCCTGCTGAGG + Intergenic
1129270236 15:74415720-74415742 GGAGGCCTTGGGCCCTGCTGAGG - Intronic
1129704282 15:77785574-77785596 CCAGCCCTGGAGCCCTGGTCGGG - Intronic
1130222072 15:82028034-82028056 TCAGCCATTGGCCCCTGCTCAGG - Intergenic
1130849690 15:87780947-87780969 TGAGCCATGGGGCCTTGCGTTGG + Intergenic
1131526335 15:93155711-93155733 TTAGCCCTGTGGCCCTGATATGG + Intergenic
1132116346 15:99138884-99138906 AGAGCGCTGGGCCTCTGCTCGGG + Intronic
1132641588 16:980814-980836 TGAGCCCTGGGCGCCTGCGGAGG - Intronic
1132925029 16:2424799-2424821 TGGGCCCTGGGCCCCTGCCTAGG + Intergenic
1133347987 16:5083210-5083232 TGAGCCCTTGGCCCCTGCTCAGG + Intronic
1134053987 16:11157685-11157707 TGAGGCCTGGGTCCTTGCCCGGG - Intronic
1136153118 16:28365044-28365066 GGAGCCCAGGGGCACTGCCCGGG + Intergenic
1136209967 16:28750229-28750251 GGAGCCCAGGGGCACTGCCCGGG - Intergenic
1137248795 16:46728198-46728220 TGAGCCCTTGGCCCCAGCACTGG + Intronic
1137416201 16:48283073-48283095 AGAGCCTTAGGGCCTTGCTCTGG - Intronic
1137607531 16:49796518-49796540 ACAGGGCTGGGGCCCTGCTCAGG + Intronic
1137789617 16:51164116-51164138 TGAGCTCTGGGGTGCTGCTGTGG + Intergenic
1138030974 16:53559120-53559142 TAAGCCCTGAAGCCCAGCTCTGG - Intergenic
1138415261 16:56867971-56867993 TGACCACTGGGGCCATGGTCGGG + Intronic
1139259696 16:65579705-65579727 GGAGGCCCAGGGCCCTGCTCAGG + Intergenic
1141159766 16:81621503-81621525 TGAGCCATGGGGCACAACTCAGG - Intronic
1141170419 16:81687257-81687279 TGAGACCTGGGCCCCTCCTGGGG + Intronic
1141506858 16:84483627-84483649 TGAGCCCTGTTGGCTTGCTCGGG - Intronic
1141543433 16:84745205-84745227 TCAGCCCCGGGGCCCCCCTCTGG - Exonic
1141564622 16:84893029-84893051 TGTGCCCTGGGTCCCAGCACAGG - Intronic
1142150378 16:88510008-88510030 TAAGGCCTGGGGCCCAGCCCAGG - Intronic
1142262514 16:89049595-89049617 TCAGCCCTGGGGCTGGGCTCTGG - Intergenic
1142277974 16:89132903-89132925 TGGGCCCTGGTGCCCTGGCCGGG - Intronic
1143390175 17:6555646-6555668 TGAGCCCCGGTGCCCAGCTCAGG + Intronic
1144236309 17:13263568-13263590 TGAGCCCTGCGGCCTTGATTTGG - Intergenic
1144772973 17:17769991-17770013 TGAGCGGGGGGGCCCTGCCCAGG + Intronic
1144828434 17:18119342-18119364 TGCGGCCTGGGGGCCGGCTCCGG + Exonic
1144959296 17:19035872-19035894 TGAGCCTTGGGGCCCGGGACGGG - Intronic
1144975863 17:19138652-19138674 TGAGCCTTGGGGCCCGGGACGGG + Intronic
1145010531 17:19365205-19365227 AGAGCCCTCGGGCCCTGCTGAGG + Intronic
1145123556 17:20281846-20281868 TGACCCCTAGGACCATGCTCAGG - Intronic
1146651520 17:34609786-34609808 AGAGCCCTGGGGCTCTGCAGAGG - Intronic
1146890991 17:36506476-36506498 TCAACACAGGGGCCCTGCTCTGG + Exonic
1147664713 17:42139209-42139231 TGAAGCCTGGGGCCCTTCTGTGG - Intronic
1148022937 17:44565647-44565669 TGAGCCCTGGTGACCTTGTCAGG + Intergenic
1148053294 17:44779660-44779682 TGAGCTCCGGGGCCCTGCTGGGG + Intronic
1148341712 17:46877186-46877208 CGGGTCCTGTGGCCCTGCTCAGG + Intronic
1148437264 17:47694238-47694260 CGACCCCTGGGGCCCAGCCCGGG - Intronic
1148946661 17:51268307-51268329 TGAGCCATGGCGCCCGGCCCAGG + Intronic
1149693571 17:58598704-58598726 CCAGCCCTGGGGTCCTGCTTAGG + Intronic
1150218841 17:63484635-63484657 TGAGCCCTGGTACCCTGTCCTGG + Intergenic
1150483685 17:65529956-65529978 TGAGCCCTGGGGTCTGGCTTTGG - Exonic
1150737223 17:67751223-67751245 TCAGTCCTGTTGCCCTGCTCTGG - Intergenic
1151553377 17:74834631-74834653 AGAGCCCTGGGGCTCTGCGGGGG + Intronic
1152204737 17:78968473-78968495 TGAGCCATGGGGCCCTGAGCAGG + Intergenic
1152228612 17:79103811-79103833 AGAGCCCTGGGCCCCAGGTCCGG - Intronic
1152268143 17:79308181-79308203 AGAGACCTGGGGCCCGGCTTGGG - Intronic
1152392562 17:80011397-80011419 TGAGCCCTGGGGCCAGGGTCAGG - Intronic
1152705877 17:81843401-81843423 CCAGCCCTGGGGCCCGGCACAGG - Exonic
1153059705 18:982471-982493 TGAGCCTTGGCTCCCAGCTCAGG + Intergenic
1153640603 18:7153747-7153769 TGAGTCCTGGGCCGCTGCTCTGG + Intergenic
1155106845 18:22675307-22675329 TGAGCCTTGGGGACCAGCTCAGG + Intergenic
1155809919 18:30219360-30219382 AGAGCACTGGGGTCTTGCTCTGG + Intergenic
1156447924 18:37250541-37250563 TGGTCCCTCGGCCCCTGCTCAGG + Intronic
1157518751 18:48330226-48330248 CGTGCCCAGGTGCCCTGCTCTGG - Intronic
1158627908 18:59087793-59087815 TGAGCCATGGAGCCCAGCCCAGG - Intergenic
1158978049 18:62730403-62730425 AGAGCACTGGAGCCCTTCTCTGG + Intronic
1160583979 18:79902773-79902795 TGAGGCCTGGGGGCCGGCTGCGG + Exonic
1160909772 19:1469146-1469168 CGGCCCCTGGGGCCCGGCTCCGG - Exonic
1160919649 19:1513562-1513584 AGTGCGCTGGGGCCCTGCGCTGG - Intronic
1160970802 19:1766969-1766991 GGAGCCCGGGGCCCCTCCTCTGG - Intronic
1161105437 19:2441531-2441553 CGAGCCCTGCGGCCCTGCTGGGG + Intronic
1161580387 19:5077599-5077621 TGAGCCATGCGGCCCTCCTCTGG - Intronic
1162034021 19:7929619-7929641 TGAGCACAGGGACTCTGCTCTGG + Intronic
1162490322 19:10987611-10987633 TGAGCTCTGGGGCCCATCCCGGG - Intronic
1162716374 19:12636914-12636936 TGAGCCATCGCGCCCAGCTCAGG - Intronic
1162914372 19:13866057-13866079 GAAGCCCTGGCGCCCTGCGCGGG + Intronic
1162926967 19:13935686-13935708 TGAGGCCTGGGGGCCTGGGCTGG + Intronic
1162927961 19:13939601-13939623 TGAGCCATGGAGCCCAGCCCAGG - Intronic
1163130566 19:15270205-15270227 CAAGCACTGAGGCCCTGCTCGGG + Intronic
1163248745 19:16113201-16113223 TGAGCTCTGTAGCCCTGCTAGGG + Intronic
1163466310 19:17470278-17470300 CCAGGCCTGGGGCCCTGGTCTGG + Intronic
1163851479 19:19666585-19666607 TGAGCCACCGGGCCCGGCTCTGG + Intergenic
1165395540 19:35561732-35561754 TGAGGCTTGGGTCCCTGCCCTGG + Intronic
1165484009 19:36084401-36084423 AGATCCCTGGGGCTCTGTTCTGG + Intronic
1165766542 19:38354944-38354966 TCAGCCTAGGGGCCCTCCTCAGG - Intronic
1165809833 19:38605650-38605672 TGAGCCCGGGGGTGCTGGTCCGG - Exonic
1166148544 19:40853589-40853611 TTGGCCCTGGAGCCCTGCACAGG + Intronic
1166152683 19:40885374-40885396 TTGGCCCTGGAGCCCTGCACAGG + Intronic
1166177493 19:41085261-41085283 TTGGCCCTGGAGCCCTGCACAGG - Intergenic
1166718708 19:44985437-44985459 TGAGCACTGGGCTCCTCCTCTGG + Intronic
1167272475 19:48513699-48513721 AAAGCCCTGGGCCCCTGCTGGGG - Intergenic
1168404922 19:56105672-56105694 TGAGCCCTGGAGCCCTGGCCCGG - Intronic
1202694923 1_KI270712v1_random:116937-116959 AGGGCCCGGGTGCCCTGCTCAGG - Intergenic
925160497 2:1680515-1680537 TGAGCCCCGGTGCCCGACTCAGG + Intronic
925826211 2:7850598-7850620 AGAGCCCTGGGGCCATCCTAAGG + Intergenic
926423385 2:12719076-12719098 TGAGCCCAGGGGCCCAGCGCAGG + Intronic
927210566 2:20636522-20636544 GGAGCCCTGGAGGCCTGCACTGG - Intronic
927717171 2:25360301-25360323 CGAGTCCATGGGCCCTGCTCAGG - Intergenic
928170151 2:28998273-28998295 TGAGGCCAGGGGCCCTGACCAGG - Intronic
928737199 2:34306081-34306103 CGTCCCCTGGGGCCCTTCTCAGG - Intergenic
929439622 2:41955037-41955059 TGAGCCCTGGTGACCGGTTCAGG + Intergenic
929520467 2:42645661-42645683 AGAGACTTAGGGCCCTGCTCTGG - Intronic
929584087 2:43102480-43102502 TGAGGCCTGTGGTCCTGCTTGGG - Intergenic
932268200 2:70386483-70386505 GGAGCCCTGTGATCCTGCTCTGG + Intergenic
932424379 2:71619850-71619872 TGAGCCCTGAGGCCCTCCTCAGG + Intronic
932456168 2:71851392-71851414 TGGGCTCTGGGCCCCTGCTGAGG + Intergenic
932770811 2:74499796-74499818 GCAGCCCCGTGGCCCTGCTCTGG - Intronic
933759858 2:85665789-85665811 TGAGTCCTGGGGCACAGCACAGG + Exonic
934276091 2:91573985-91574007 AGGGCCCGGGTGCCCTGCTCAGG - Intergenic
936016030 2:108959645-108959667 TGCGCCCTGGGACTCAGCTCTGG + Intronic
937339430 2:121081693-121081715 TGTGCCCTGGGGACCCGCTTGGG - Intergenic
938290261 2:130145169-130145191 TGAGCCCCGGCGCCCAGCCCTGG - Intergenic
938398571 2:130968495-130968517 TGTGCCCTGAGCCCCTGTTCTGG + Intronic
938466269 2:131527776-131527798 TGAGCCCCGGCGCCCAGCCCTGG + Intronic
940014787 2:149092765-149092787 TGAGGCAGAGGGCCCTGCTCAGG + Intronic
940052905 2:149482852-149482874 TGATCCTTGGAGCCCTGGTCAGG - Intergenic
940419373 2:153461509-153461531 TGAGGACTGGGGCCCCTCTCCGG + Intergenic
944688261 2:202136766-202136788 TGCGCTGTGGGGCCCTTCTCTGG - Intronic
947581603 2:231323038-231323060 TGAGCCACCGTGCCCTGCTCGGG - Intronic
947751277 2:232533989-232534011 CCAGCCCTGGGGCCCTGGTGCGG + Exonic
948642543 2:239384899-239384921 GGAGCCCTGAGCCCCTCCTCAGG - Intronic
948889208 2:240898638-240898660 TCAGCCCTGGGACTCTGTTCAGG - Intergenic
1168935946 20:1665327-1665349 TGGGCCCCAGGGCCCTGCTGGGG - Intergenic
1169265382 20:4164177-4164199 TGAGGCCTGGGGCCCTGCTCTGG + Intronic
1172142994 20:32736895-32736917 TGAGCCATGGTGCCCAGCTCTGG - Intronic
1172267332 20:33627549-33627571 TGAGCCCAGGGGTCCAGCTTGGG - Intronic
1172526059 20:35601182-35601204 TGAGCCCTGGGGGCGGGGTCGGG + Intergenic
1173173011 20:40742356-40742378 TGAGCCTTGGGACCCAGCACAGG + Intergenic
1173225996 20:41162797-41162819 TCAGCCCTGCTGCCCTGCTTAGG + Intronic
1174377114 20:50133489-50133511 TGCACCCAGTGGCCCTGCTCTGG + Intronic
1174456923 20:50655365-50655387 TGTGCCCTGGGGCGCTGGGCAGG - Intronic
1174860811 20:54089366-54089388 TGAGCCCCGGGGCCATCCACTGG + Intergenic
1174875479 20:54222745-54222767 TGAGCCCTGGTGCCATGCATTGG + Intronic
1175340549 20:58226676-58226698 TGAGCTTTGGGGTCCTGCTGTGG + Intronic
1175571469 20:60026022-60026044 TGAGGCCTGGTGCCTGGCTCTGG - Intronic
1175572456 20:60034425-60034447 TGAACTCTGGGTCTCTGCTCTGG - Intergenic
1175857999 20:62133136-62133158 TCAGCTCTGGAGCCCAGCTCCGG - Intronic
1175897962 20:62347779-62347801 TGACTTCTGGGGTCCTGCTCAGG - Intronic
1176030495 20:63009011-63009033 AGAGCCCTGGCTCCCTGCTGGGG - Intergenic
1176044182 20:63083905-63083927 GAAGCCCCGGGGCCCTGGTCCGG - Intergenic
1177669710 21:24209101-24209123 TGAGCTGTGGGGCCCCTCTCTGG - Intergenic
1178305369 21:31486536-31486558 TGTGCCCTGAGGTGCTGCTCTGG + Intronic
1178792248 21:35711402-35711424 TGAGCCATGGTTCCCTGCACAGG + Intronic
1179604353 21:42503893-42503915 TGACCACTGAGGCCCTGCACTGG + Intronic
1179787920 21:43740289-43740311 GGAGCCATGGAGCCCTCCTCTGG + Intronic
1179928631 21:44552129-44552151 TGTCCCCTGGAGCCCTGGTCAGG + Intronic
1181023112 22:20113662-20113684 TGAGCCCTCCTGCCCTGCTGAGG - Intronic
1181674375 22:24442177-24442199 TGGGACCTGGGCCCATGCTCTGG - Exonic
1181773757 22:25145136-25145158 TGAGGCCTGGGGCCCAGCGTGGG + Intronic
1182466551 22:30520432-30520454 GGAGGCCTGGGTCTCTGCTCTGG - Intergenic
1182718049 22:32375990-32376012 TGGGCTGTGGGGTCCTGCTCTGG - Intronic
1183062951 22:35346813-35346835 TCAGCACTGGGTCCCAGCTCAGG - Intronic
1183405796 22:37630012-37630034 TGAGCCCCCAGCCCCTGCTCTGG + Exonic
1183641615 22:39096313-39096335 TGAGCACTGGGGTCAGGCTCAGG - Intergenic
1183656629 22:39189427-39189449 TGATCCCTGGGTCTCTGCACTGG - Intergenic
1184227036 22:43135016-43135038 TGAGCCCTGTGGCCCTAGCCTGG - Intronic
1184249866 22:43253880-43253902 TGAGACCGAGGGCCCTGCCCTGG + Intronic
1184548815 22:45192841-45192863 CGAGCCCTGGAGCACTCCTCGGG - Intronic
1184594727 22:45506822-45506844 TGAGCACTGGGCACCTGGTCAGG + Intronic
1184661517 22:45967632-45967654 GGAGCCCAGGGCCCCTGCTTGGG - Intronic
1184715455 22:46279415-46279437 TGAGCCTTGGGCCCCTCATCTGG - Intronic
1184721117 22:46314056-46314078 TGAGGCCTGGAGTGCTGCTCAGG + Intronic
1184744342 22:46447589-46447611 TGAGCCCTGCGTCCCTCCTACGG - Intronic
1184775349 22:46620362-46620384 TGAGCCCTGCTGCCCTGCTCTGG + Intronic
1184860987 22:47173237-47173259 CGAGGCCTGGGGCCCTTCTGGGG + Intronic
1185045951 22:48528859-48528881 GGGGCCCAGAGGCCCTGCTCTGG + Intronic
1185048201 22:48539754-48539776 TGAGCCCTGTGGCCTTCCTGCGG - Intronic
1185092481 22:48783847-48783869 TGAGCCCTTGGGCCGTCCTGGGG + Intronic
1185148220 22:49150585-49150607 TGCCACCTGGGGCCCTCCTCAGG - Intergenic
1185242259 22:49752919-49752941 TGAGCCCTGGAGACCTGCTGTGG - Intergenic
950485035 3:13268146-13268168 TGAGCTCTTGGGCTCTGCTCAGG - Intergenic
951811572 3:26706314-26706336 TGAGCCCTGGGATGCTGCTGTGG - Intronic
952124730 3:30287052-30287074 TGAGGCCTGGGGCACTGTTTTGG + Intergenic
952328325 3:32340844-32340866 TGAGGCTTGGGTCCCTGCACAGG - Intronic
953378964 3:42452187-42452209 AGAGCCCTGGGACCCTTCCCTGG + Intergenic
954124619 3:48521167-48521189 TGGGCTCTGGGTCCCTGCTGAGG - Intronic
954174966 3:48837194-48837216 TGAGCCCAGGAGCCCAGCTATGG + Intronic
954941140 3:54374373-54374395 TCTGACCTGGAGCCCTGCTCAGG + Intronic
957052352 3:75420473-75420495 TGAGCCCTTGGCCCCTGCTCAGG + Intergenic
958486421 3:94716626-94716648 TGAGCCCTCAGGCCAAGCTCAGG - Intergenic
958876089 3:99619018-99619040 TGAGATCTGGGGCCTAGCTCTGG - Intergenic
960341339 3:116478907-116478929 GGAGCCCTTGGGCCCAGCCCAGG - Intronic
961269759 3:125680173-125680195 TGAGGCCTGGGGCCCATCTAGGG - Intergenic
961302493 3:125931079-125931101 TGAGCCCTTGGCCCCTGCTCAGG - Intronic
961377289 3:126475522-126475544 GGGCCGCTGGGGCCCTGCTCGGG + Exonic
961885976 3:130096704-130096726 TGCGCCCTTGGCCCCTGCTCAGG + Intronic
961981577 3:131084784-131084806 TGAGGCCTGAGGCCCACCTCTGG + Intronic
964344690 3:155744353-155744375 TGCGCCCGGTGACCCTGCTCAGG - Intronic
964489803 3:157223774-157223796 TGAGCTCTGACACCCTGCTCTGG + Intergenic
967365513 3:188682107-188682129 TGAGGCCTTGAGACCTGCTCAGG + Intronic
968008584 3:195259134-195259156 TGGCCCCTGCGGCCCTGCTCAGG - Intronic
968496354 4:919417-919439 AGAGACCTGTGGCCCTGCTAAGG - Intronic
968568814 4:1328765-1328787 AGAGGCCCGGGGTCCTGCTCCGG + Intronic
968995161 4:3940848-3940870 TGAGCCCTTGGCCCCTGCTCAGG + Intergenic
969359109 4:6650224-6650246 TGAGCCCAGAGGAGCTGCTCAGG - Intergenic
969571426 4:8010951-8010973 TCAGCCCCAGGGCCCTTCTCTGG - Intronic
969618612 4:8267896-8267918 TGAGCTCTTGGGCCCTTCCCAGG + Intergenic
969758826 4:9167944-9167966 TGAGCCCTTGGCCCCTGCTCAGG - Intergenic
969818803 4:9705414-9705436 TGAGCCCTTGGCCCCTGCTCAGG - Intergenic
973959847 4:56098960-56098982 TGAGCCATGGTGCCCAGCCCGGG + Intergenic
976255957 4:83101034-83101056 AGAGCACTGGGGCCTTGCTGTGG - Intronic
980253414 4:130347394-130347416 TGGGCCCTGGGGACATGCTGGGG + Intergenic
981089169 4:140714910-140714932 TGAGCCCAGGAGACCAGCTCGGG + Intronic
982276473 4:153641061-153641083 TAAGCCCTGGGCTCCTGCCCCGG + Intergenic
983208256 4:164933127-164933149 GGAGCCCTGGGACTCTGCGCTGG - Intergenic
985534753 5:457736-457758 TGGCTCCTGGGTCCCTGCTCTGG + Intronic
985551218 5:534538-534560 CCAGCCCTGGGGCCCTGCAGAGG + Intergenic
985647135 5:1090259-1090281 GGAGCCCTAGAGCCCTGCCCTGG - Intronic
985667124 5:1187079-1187101 GGAGCCCTGTGGCCCCGCTGGGG + Intergenic
985827752 5:2205282-2205304 TGAACCCTGGAGCACTGCTCTGG + Intergenic
986017051 5:3766447-3766469 TGAGCCCTGGGTTCCTGTCCTGG + Intergenic
987057886 5:14212358-14212380 GGAGCCCTGGGGAGCTGCACTGG - Intronic
991524799 5:67544506-67544528 AGTGCCATGGGGCTCTGCTCAGG - Intergenic
994665234 5:102697016-102697038 TGAACCCTGTGTGCCTGCTCTGG + Intergenic
995689067 5:114803235-114803257 TGTTCCCTTGGGCCCTGCTCAGG + Intergenic
997263917 5:132483934-132483956 GGGGCCCAGGGGCCCTGCTACGG + Exonic
997439554 5:133899571-133899593 TGAGATCTGGGGTCCTGCTCAGG - Intergenic
997638870 5:135435504-135435526 TGAGCCCATGGGCCCCTCTCTGG + Intergenic
997778206 5:136630227-136630249 TGAGCCCTGGGGCACTGTAGTGG + Intergenic
998060749 5:139116963-139116985 TGAGCTGTGTGGCCTTGCTCAGG - Intronic
998136212 5:139676060-139676082 TGGGCCCTGCAGCCATGCTCTGG + Intronic
999208160 5:149864954-149864976 TGAGCCATGGTGCCCAGCTGAGG - Intronic
1000542381 5:162555959-162555981 TGAGGCCTTGGGCCATGCTATGG + Intergenic
1001122595 5:168992628-168992650 GAAGGCCTGGGGTCCTGCTCAGG + Intronic
1001295667 5:170497102-170497124 AGAGCCCCAGAGCCCTGCTCAGG + Intronic
1002180960 5:177430996-177431018 TGAGGCGAGGGGCCCTGCTGGGG + Intronic
1002299106 5:178247614-178247636 TGGCCCCTGGGGCCCTGTCCTGG + Intronic
1002299508 5:178249263-178249285 TAAGCTCTGGGGACCTGCTGGGG - Intronic
1003015311 6:2463027-2463049 GGAGCCCGGGGGCCCAGCTGCGG + Intergenic
1003120198 6:3313038-3313060 TGAGCACTGAGCCTCTGCTCTGG - Intronic
1003154204 6:3577556-3577578 TGAGCCCTCAGGCCCTGCAGGGG - Intergenic
1003952141 6:11126329-11126351 TGAGCCATGGCGCCCAGCCCTGG + Intronic
1004473165 6:15947075-15947097 TCAGCACTGGGGCCCTGCTTGGG + Intergenic
1004516776 6:16327611-16327633 TGAGCCCCGGAGCCCTGCTGAGG + Exonic
1004662815 6:17725360-17725382 TGAGCCCTGGGGGCGTGCTCTGG + Intergenic
1005898273 6:30196480-30196502 TGGTCCCTGGCGCCCTGCCCAGG + Intronic
1006259061 6:32853430-32853452 TGAGCCGCTGGGCCGTGCTCTGG - Exonic
1007552957 6:42744286-42744308 TGAGCCCCCGGGCTCAGCTCTGG + Intergenic
1007763574 6:44148411-44148433 GGAGCCCTGGAGGGCTGCTCAGG - Intronic
1008060195 6:46989091-46989113 AGGTCCCTGGGGCTCTGCTCTGG + Intergenic
1011125058 6:83998383-83998405 AGAGTCCTGGGCCCCTCCTCTGG - Intergenic
1011260367 6:85464437-85464459 TGTGCCCTGGGTCACTGCTGAGG + Intronic
1013462907 6:110392843-110392865 AGTGCACTGGGGCACTGCTCTGG - Exonic
1014560589 6:122885256-122885278 TGGGCCCCTGGGCCCTGCTCAGG + Intergenic
1016481232 6:144484151-144484173 CAACCCCTGGGTCCCTGCTCTGG + Intronic
1016882169 6:148921902-148921924 TGGGGACTGGAGCCCTGCTCTGG - Intronic
1017230792 6:152071126-152071148 TGAGCACTGGGTCGCTGCTAGGG - Intronic
1018005444 6:159617810-159617832 TGAGGCCAGGGCCCCAGCTCCGG + Intergenic
1018696882 6:166397550-166397572 TGTGCTCCGGGGCCCTGCTGGGG + Intergenic
1018768999 6:166956159-166956181 TGCGCCCTGCAGCCCTGCGCGGG - Exonic
1018920397 6:168168339-168168361 TGAGGCCTGGGGAGCTGCTGCGG + Intergenic
1019048390 6:169165220-169165242 TGTGCCCTGAGGCAGTGCTCAGG + Intergenic
1019210508 6:170401122-170401144 TCAGCCCTGGGTCCCTGCCAGGG + Intronic
1019224583 6:170499765-170499787 TGAGGCTTGGGGCCCTTCTGTGG + Intergenic
1019758042 7:2787869-2787891 TGAGCCATGGTGCCCGGCCCTGG - Intronic
1020257032 7:6508182-6508204 TGGTTCCCGGGGCCCTGCTCAGG - Exonic
1020319424 7:6929171-6929193 TGAGCCCTTGGCCCCTGCTCAGG + Intergenic
1022197150 7:28080269-28080291 AGAGACTTGGGGCCTTGCTCTGG + Intronic
1022443452 7:30451891-30451913 TCACCCCCGGGGCCCAGCTCCGG + Exonic
1023519345 7:41035015-41035037 TGGGCACTGGGGCACTGATCTGG + Intergenic
1024299904 7:47879081-47879103 CTAGCCCTGGGTCCCTGCTTTGG - Intronic
1024614106 7:51093606-51093628 TGAGCCATTGTGCCCTGCTGTGG - Intronic
1024908018 7:54410430-54410452 TGAGATCTGGGGCCTTGGTCAGG - Intergenic
1024963442 7:55002267-55002289 TGAGCCCTGGAGCCCTGCGAGGG - Intergenic
1025075806 7:55942148-55942170 TGAGCCCTGGTGCCATGTTGAGG + Exonic
1025209056 7:57010266-57010288 CGAGCCCAGGGTCCCTGCTTGGG + Intergenic
1025662893 7:63566590-63566612 CGAGCCCAGGGTCCCTGCTTGGG - Intergenic
1026127125 7:67588793-67588815 TGAGCCCATGGGCCCTGCCTGGG - Intergenic
1026954821 7:74370570-74370592 TGGGCCCTGGGGGTCTTCTCTGG - Intronic
1028391442 7:90321430-90321452 TGCGCCCTGCGGCCCTGCTTTGG + Intergenic
1029345555 7:99976066-99976088 TGGGTCCTGGGGCCCTGCCCAGG + Exonic
1029346231 7:99980705-99980727 TGGGTCCTGGGGCCATGCCCAGG - Intergenic
1029539538 7:101174472-101174494 TGAGCCCGGGGGCACGGCCCAGG - Intronic
1029558946 7:101289810-101289832 TGGGTCCTGGGGCCATGCCCAGG + Intergenic
1032083999 7:128874234-128874256 GGAACACTGGGGCCCTGCTGTGG - Intronic
1033319627 7:140327949-140327971 TCTGCCTTGGGTCCCTGCTCGGG - Intronic
1034781814 7:153888053-153888075 AGAGCCCTGGGGGTCTGCTTGGG - Intronic
1034943173 7:155245104-155245126 AGAGGCCTTGGGCCCTGCTGAGG - Intergenic
1035543451 8:459770-459792 GGTGCCCTGAGGCCCTGCCCAGG - Intronic
1036596152 8:10214244-10214266 TCAGCCACGGGCCCCTGCTCCGG - Intronic
1036755145 8:11466632-11466654 GGAGCCCAGGGGCCCTGCTGGGG + Exonic
1037723322 8:21463352-21463374 TGAGCCATCGCGCCCAGCTCAGG - Intergenic
1037996479 8:23356180-23356202 TGAGCCCTAGGGCTCTGTTCCGG - Intronic
1038581137 8:28750491-28750513 GGAGGCCTGGGGCCGGGCTCTGG + Intronic
1039277609 8:35950941-35950963 TGAGTCCTGGGCCCCTGCTGGGG - Intergenic
1039429599 8:37515559-37515581 TGGGCTCAGGGTCCCTGCTCTGG - Intergenic
1039527874 8:38232085-38232107 TAGGCCCTGGCGCCCCGCTCCGG - Intronic
1040322646 8:46326438-46326460 AGAGCCCTGGGCTCCTGCCCAGG - Intergenic
1041166287 8:55095946-55095968 GGAGCCCTGTGTACCTGCTCTGG + Intergenic
1041578709 8:59431657-59431679 TGAGCCCTGTGAGCCTGCCCTGG + Intergenic
1043509079 8:80931940-80931962 TGAGCAGTGAGGCCCAGCTCTGG + Intergenic
1048060472 8:130914720-130914742 ACATCCCTGGGGCTCTGCTCTGG - Intronic
1048362850 8:133713041-133713063 TGGGCCATGGTGCTCTGCTCTGG + Intergenic
1049199759 8:141334335-141334357 AGAGCCCTGGGGCTCAGCTCAGG + Intergenic
1049208901 8:141376332-141376354 AGTGGCCTGGGGCCCTGCACGGG - Intergenic
1049225571 8:141449009-141449031 TGAGCTCTGGGCCACTGCTGGGG + Intergenic
1049465242 8:142748297-142748319 GGGGCCCTGGGTCCCTGCCCTGG + Intergenic
1049468486 8:142764537-142764559 TGAGCCCTGGCGCCAGGCTGTGG + Exonic
1050589472 9:7147660-7147682 TGAGCCCTGGGGCAGTCATCAGG + Intergenic
1050619707 9:7440124-7440146 TGTGCCCTGGGGACCTGCTCAGG - Intergenic
1050649805 9:7763782-7763804 TGAGACTTAGGGCCTTGCTCTGG - Intergenic
1050803254 9:9641886-9641908 TGAGTCCTGAGGCCTTCCTCTGG - Intronic
1051842545 9:21414611-21414633 TGCTCCCTGTGGCCCTTCTCAGG - Intronic
1053005052 9:34598892-34598914 TGTTCCCTGGAGCCCTGCTTGGG + Intergenic
1056848066 9:90057606-90057628 AGACCCCTGAGGCCCTGGTCTGG - Intergenic
1057064297 9:92034175-92034197 TCTGCCCTGGGGCATTGCTCAGG - Intronic
1057222100 9:93262936-93262958 TGGGCTCTGGGTCTCTGCTCTGG + Intronic
1057825936 9:98372054-98372076 TTAGACCTTGGTCCCTGCTCAGG + Intronic
1058815806 9:108681777-108681799 AGTGCCCTGGGTCCCTGCCCTGG + Intergenic
1059365318 9:113782246-113782268 TGGGGCCTGTGCCCCTGCTCTGG + Intergenic
1059366233 9:113788446-113788468 TGGGCTCTGGGCCCTTGCTCAGG + Intergenic
1059662954 9:116419644-116419666 TGAACCCTGGAGCCTTGCCCTGG - Intergenic
1060024639 9:120160936-120160958 TGTGCCCTGAAGCCCTGCACAGG + Intergenic
1060204615 9:121675203-121675225 TGAGCTCTGGGGCAATGCTGGGG - Intronic
1060418608 9:123451119-123451141 TTGGTCCTGGGGCCCTGCCCTGG - Intronic
1060449356 9:123722548-123722570 TGAGCCCTGGGTCCCTCTACTGG + Intronic
1060529505 9:124340022-124340044 TGACCCCAGGTGCCCTGCACCGG - Intronic
1061134216 9:128724052-128724074 TCAGCCCTGGGGTCCTGGTGCGG - Exonic
1061499162 9:130992313-130992335 TGCGGACTGGGGTCCTGCTCAGG + Intergenic
1061666817 9:132164838-132164860 GGAGCCCTGGGGCCCTGGCTGGG + Intronic
1061677110 9:132223709-132223731 TGGGCCCAGGTGCCCTGCCCTGG + Intronic
1061818745 9:133210923-133210945 TGTGGCCTGGGGCACTTCTCTGG + Intergenic
1061921163 9:133783372-133783394 TGAGCACTGGTGCCCTCATCTGG + Intronic
1061998969 9:134206530-134206552 TGGGCCCCGGCTCCCTGCTCTGG + Intergenic
1062018955 9:134307274-134307296 TCTGCCCTGGGGCCCTGGTGGGG + Intergenic
1062094390 9:134695411-134695433 TGGGCCCTGGGACCCTCCACAGG + Intronic
1062327094 9:136017614-136017636 TGAGCACCGGGGGCCCGCTCAGG - Intronic
1062396406 9:136354624-136354646 TCAGCCCTGGGGCCCGGACCAGG + Intronic
1062401773 9:136375947-136375969 GGAGCCCTGGTGCCCTGGCCTGG - Intronic
1062559921 9:137136904-137136926 AGAGACCTGGGGCACTGCCCTGG - Intergenic
1062571099 9:137185745-137185767 TGTGGTCTGGGGCTCTGCTCTGG - Intronic
1062609827 9:137368887-137368909 ACAGCCCTGGGGCCCCGCCCCGG - Intronic
1185590659 X:1274606-1274628 TGAGCCATGGCGCCCAGCCCTGG + Intronic
1186161223 X:6778995-6779017 GGAGCCCTTGTGCCATGCTCTGG - Intergenic
1186274754 X:7927259-7927281 GGAGCCCTGGGGCCCAGCAAGGG - Intronic
1188642783 X:32527152-32527174 AGAGCCCTGGGACCCTGCAATGG - Intronic
1190064356 X:47229872-47229894 TAAGCCCTGGGGCCCTGAAATGG + Exonic
1190641164 X:52483345-52483367 TGAACCCTGGGGTCCGTCTCAGG + Intergenic
1190646508 X:52529520-52529542 TGAACCCTGGGGTCCGTCTCAGG - Intergenic
1193012050 X:76687578-76687600 TGTGGCCTGGGGCACTTCTCTGG - Intergenic
1194796519 X:98218178-98218200 TGACCCCTGGGTTCCTGTTCTGG - Intergenic
1194916930 X:99718384-99718406 TGATCCCTGTGGTCCTGCACTGG - Intergenic
1199450810 X:147977213-147977235 TTAGCCCTGGGTCCCTGATATGG + Intergenic
1199601963 X:149546374-149546396 TGTCCCCTGGTGACCTGCTCAGG + Intronic
1199648423 X:149933110-149933132 TGTCCCCTGGTGACCTGCTCAGG - Intronic
1200062942 X:153491684-153491706 TGTGGCCTGGGGCCCTGTGCAGG + Intronic
1200143329 X:153912989-153913011 TGAGGGCTGGGGCCCTGCGACGG - Intronic