ID: 900667037

View in Genome Browser
Species Human (GRCh38)
Location 1:3822537-3822559
Sequence ATTCGCTGCCTGGCATAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900667027_900667037 14 Left 900667027 1:3822500-3822522 CCCAAACTGGGTCCTGAGCAGGG 0: 1
1: 0
2: 1
3: 14
4: 161
Right 900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 73
900667032_900667037 2 Left 900667032 1:3822512-3822534 CCTGAGCAGGGCCCCAGGGCTCA 0: 1
1: 1
2: 16
3: 48
4: 436
Right 900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 73
900667033_900667037 -9 Left 900667033 1:3822523-3822545 CCCCAGGGCTCAGCATTCGCTGC 0: 1
1: 0
2: 1
3: 12
4: 166
Right 900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 73
900667034_900667037 -10 Left 900667034 1:3822524-3822546 CCCAGGGCTCAGCATTCGCTGCC 0: 1
1: 0
2: 1
3: 16
4: 139
Right 900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 73
900667029_900667037 13 Left 900667029 1:3822501-3822523 CCAAACTGGGTCCTGAGCAGGGC 0: 1
1: 0
2: 1
3: 14
4: 162
Right 900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 73
900667025_900667037 21 Left 900667025 1:3822493-3822515 CCAGATTCCCAAACTGGGTCCTG 0: 1
1: 0
2: 2
3: 27
4: 210
Right 900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900667037 Original CRISPR ATTCGCTGCCTGGCATAAAG AGG Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
906365697 1:45207356-45207378 ATCCTCTGCCTGGCACATAGTGG + Intronic
906746949 1:48228727-48228749 ATGCAGTGCCTGGCATACAGTGG + Intronic
909255943 1:73422026-73422048 ATTTGTTGCCTGTCATAGAGGGG + Intergenic
1063258415 10:4355009-4355031 ATCAGCTGCCTGGCATACTGTGG - Intergenic
1073023230 10:100464956-100464978 TTTCTCTGCATGGCATAAAGGGG - Intronic
1073559588 10:104485528-104485550 GATCAGTGCCTGGCATAAAGTGG + Intergenic
1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG + Intronic
1083017808 11:59474624-59474646 ATCCGCTGCCTCCCAGAAAGGGG + Intergenic
1084619028 11:70255935-70255957 GCCCGGTGCCTGGCATAAAGTGG + Intergenic
1089553627 11:119301694-119301716 CTTCTCTACATGGCATAAAGCGG + Exonic
1099095882 12:78373720-78373742 TTTTGCTTCCTGCCATAAAGTGG - Intergenic
1099230365 12:80016351-80016373 ATTCGGTGTGTGGCAAAAAGGGG + Intergenic
1104390653 12:128388302-128388324 ATTCGCTGCCTGGCAGCCATCGG - Intronic
1105738087 13:23293009-23293031 ATTTCCTGCTTGGCATAGAGAGG - Intronic
1113313477 13:109154982-109155004 ATTCTGTCCCTGCCATAAAGGGG - Intronic
1114636501 14:24190056-24190078 ATTCTTTGCCTGGCACAAAGAGG + Intronic
1121055523 14:90848942-90848964 ATCCTCTGCCTGGCTTAATGAGG - Exonic
1122858094 14:104569591-104569613 ATTCCCTGCCTGGCAGACACCGG - Intronic
1125156431 15:36591989-36592011 ACTGGATGGCTGGCATAAAGTGG - Intronic
1125735769 15:41924561-41924583 ATCCAGTGCCTGGCATACAGGGG + Intronic
1126340356 15:47634728-47634750 ATTCCCTGCCTGACAGACAGAGG - Intronic
1126691580 15:51292905-51292927 ATTCTCTGCTTGGCATTGAGGGG + Intronic
1128707352 15:69846594-69846616 ATGCAGTGCCTGGCATATAGTGG + Intergenic
1128866620 15:71119443-71119465 ACATGCTGCCTGGGATAAAGTGG - Intronic
1131847214 15:96500735-96500757 ATTAGCTGCCTTTCATGAAGGGG + Intergenic
1135663479 16:24316420-24316442 ATTCTCTGCCTGCTCTAAAGTGG + Intronic
1148476291 17:47930900-47930922 ATTCCATGCCTGGAAGAAAGAGG + Intergenic
1157236086 18:45966785-45966807 AGTCCCTGCCATGCATAAAGAGG - Intronic
1160355447 18:78224467-78224489 ATTCCTTGCCTGCCATGAAGAGG + Intergenic
1163626024 19:18390240-18390262 GTCCGGGGCCTGGCATAAAGTGG - Intergenic
1164952007 19:32345158-32345180 ATTCGCAGCTTGGCGTTAAGGGG - Intergenic
925990423 2:9250187-9250209 ACACGCTGCCTGACACAAAGTGG + Intronic
941701935 2:168613077-168613099 GTTTGATGCCTGGGATAAAGGGG + Intronic
943395493 2:187328374-187328396 ATGTGCTGCCTGGCAGAATGTGG + Intergenic
943944121 2:194036614-194036636 ATTTGCTTCGTGGCTTAAAGAGG - Intergenic
946320044 2:218947807-218947829 GTTCACTGCCTGGCATGTAGAGG + Intergenic
1174442642 20:50568180-50568202 TTTCGCTGCCTGGTAGAAAATGG + Intronic
1179039571 21:37790408-37790430 TATTGCTGCCTGGCAAAAAGAGG - Intronic
1183260427 22:36791490-36791512 ATACGCTCCCTGGCACAAAGGGG - Intergenic
952076756 3:29706154-29706176 ATTCTCTTCCTGACATCAAGTGG - Intronic
954865138 3:53722673-53722695 ATTAGATGCTTGGCATTAAGTGG - Intronic
959499867 3:107093643-107093665 ACTGGCTGCCTGGCTAAAAGTGG - Intergenic
960473812 3:118099332-118099354 ATCAGCTGCCTGGCCTACAGTGG + Intergenic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
963085979 3:141436903-141436925 ATTTGCTGCATGGCTTACAGTGG + Intronic
972689273 4:41381101-41381123 ATTCAGTGCCTGGCATTCAGTGG - Intronic
972826193 4:42761898-42761920 GTTCTCTGCCTGGAATTAAGAGG - Intergenic
975768806 4:77698826-77698848 ATTCGATTTCTGGCATAAATGGG - Intergenic
981912655 4:149999646-149999668 TTTCTCTGCCTGGCAGAAGGTGG + Intergenic
986001695 5:3635499-3635521 ATTCGCTGCATTGCAGACAGCGG - Intergenic
990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG + Intergenic
993048407 5:82895592-82895614 ACTCAGTGCCTGGCATAGAGTGG - Intergenic
1000048311 5:157540124-157540146 ATGCCATGCCTGGCACAAAGTGG + Intronic
1001117004 5:168948224-168948246 ATGCACTGCCTGGCACACAGTGG + Intronic
1009306185 6:62092193-62092215 ATTCACTGTCTGACATGAAGGGG - Intronic
1009675815 6:66819212-66819234 ATTCAGTGCCTGTTATAAAGTGG - Intergenic
1009764020 6:68045049-68045071 TTAAGCTGACTGGCATAAAGAGG + Intergenic
1013305515 6:108843846-108843868 ATTCGCTGCCTGGGATAGGTGGG - Intergenic
1017919518 6:158859073-158859095 ACACACTGCCTGGCACAAAGTGG + Intergenic
1018764322 6:166920689-166920711 ATTGGCTTCCTGGCCTCAAGAGG + Intronic
1019867604 7:3727473-3727495 ATTCTCTCCCTGGCAAAAAGAGG - Intronic
1023660413 7:42466021-42466043 CTTCTCTGCCTGGCATTCAGTGG - Intergenic
1028582432 7:92421926-92421948 ATTCACTGCCTGTCACAAGGTGG - Intergenic
1035076549 7:156181428-156181450 GGTGGCTGCATGGCATAAAGTGG - Intergenic
1038184106 8:25257248-25257270 GCTCGATGCCTGGCATAGAGAGG - Intronic
1040421210 8:47242110-47242132 TTTCTCTGCCTGGAATAAATAGG - Intergenic
1042572667 8:70183856-70183878 ATTTGCTGCCTGGCACATAGTGG + Intronic
1043394704 8:79825265-79825287 CTTCCCTACCTGGCAGAAAGGGG + Intergenic
1045764703 8:105653345-105653367 ATTCTCTACCTGGCATATAGTGG - Intronic
1045906855 8:107355944-107355966 TTTCACTGCCTGGCACATAGTGG + Intronic
1051211754 9:14752377-14752399 ATTAGCTGGCTGGAATAGAGAGG + Intronic
1051671918 9:19519174-19519196 AATCTATGCCTGGCATAGAGAGG - Intronic
1052021082 9:23525915-23525937 AATGGTTGCCTAGCATAAAGAGG + Intergenic
1053428961 9:38029189-38029211 AGCCCCAGCCTGGCATAAAGGGG + Intronic
1188781958 X:34296159-34296181 TTTCACTGCCTGAAATAAAGTGG + Intergenic
1195430794 X:104787090-104787112 AAACGTTGCCTGGCACAAAGTGG - Intronic
1198754830 X:139971543-139971565 ATTCCATGCCTGGCATACGGTGG - Intergenic
1199418565 X:147616022-147616044 ATGCTGTGCCTGGCACAAAGTGG + Intergenic
1199605086 X:149571337-149571359 TTTGGCTTCCTAGCATAAAGAGG - Intergenic