ID: 900671431

View in Genome Browser
Species Human (GRCh38)
Location 1:3857215-3857237
Sequence TCGCGCACGCGCAGAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900671431_900671447 17 Left 900671431 1:3857215-3857237 CCAGGGCCTCTGCGCGTGCGCGA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 900671447 1:3857255-3857277 CCGCGCCTGCGCACAAGGGGAGG 0: 1
1: 0
2: 1
3: 4
4: 69
900671431_900671448 18 Left 900671431 1:3857215-3857237 CCAGGGCCTCTGCGCGTGCGCGA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 900671448 1:3857256-3857278 CGCGCCTGCGCACAAGGGGAGGG 0: 1
1: 0
2: 2
3: 6
4: 56
900671431_900671443 12 Left 900671431 1:3857215-3857237 CCAGGGCCTCTGCGCGTGCGCGA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 900671443 1:3857250-3857272 CCAGGCCGCGCCTGCGCACAAGG 0: 1
1: 0
2: 0
3: 17
4: 133
900671431_900671444 13 Left 900671431 1:3857215-3857237 CCAGGGCCTCTGCGCGTGCGCGA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 900671444 1:3857251-3857273 CAGGCCGCGCCTGCGCACAAGGG 0: 1
1: 0
2: 0
3: 6
4: 58
900671431_900671433 -6 Left 900671431 1:3857215-3857237 CCAGGGCCTCTGCGCGTGCGCGA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 900671433 1:3857232-3857254 GCGCGACCCCGCCCCACCCCAGG 0: 1
1: 0
2: 3
3: 47
4: 426
900671431_900671445 14 Left 900671431 1:3857215-3857237 CCAGGGCCTCTGCGCGTGCGCGA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 900671445 1:3857252-3857274 AGGCCGCGCCTGCGCACAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900671431 Original CRISPR TCGCGCACGCGCAGAGGCCC TGG (reversed) Intergenic
900522176 1:3111100-3111122 TGGCTCACGTGCAGGGGCCCAGG + Intronic
900671431 1:3857215-3857237 TCGCGCACGCGCAGAGGCCCTGG - Intergenic
902560138 1:17272216-17272238 CCGAGCATGCGCAAAGGCCCGGG + Intronic
904236718 1:29121698-29121720 GCCCGCACCCGCAGAGGCTCGGG + Exonic
904587695 1:31589036-31589058 TCGCACCCGCTCAGTGGCCCCGG + Intergenic
921604763 1:217139717-217139739 GCGGGCCCGCGCAGAGGCCGGGG + Intergenic
924489395 1:244520635-244520657 TCAGGCACACGCAGAGGCCCAGG + Intronic
924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG + Intronic
1068184162 10:53564015-53564037 TATCGCAGGCCCAGAGGCCCAGG + Intergenic
1072191450 10:93079904-93079926 TCGCCCACCCGCAGCAGCCCTGG - Intergenic
1073061322 10:100735491-100735513 TCCCGGCCGCGCAGAGGCTCCGG - Intergenic
1076116878 10:127907168-127907190 GCGGGGACGCGCAGAGGCCGTGG - Exonic
1076868947 10:133183296-133183318 TGGCGCACACGCAGAGACTCTGG + Intronic
1077058177 11:606017-606039 TCGGGCAGGAGCAGTGGCCCTGG + Intronic
1078801166 11:14644704-14644726 TCGCGCACCCGCTGCGGCTCCGG + Exonic
1081994680 11:47355610-47355632 TTGCGTACGCACAGGGGCCCGGG + Intronic
1083419760 11:62546212-62546234 TCGCGGAGGCGCGGAGGCGCTGG + Intronic
1085030748 11:73269546-73269568 TGGAGCACATGCAGAGGCCCGGG + Intronic
1086728856 11:90223113-90223135 TCGCGCAGGCGCAGAGGAGAAGG + Exonic
1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG + Intergenic
1096220964 12:49828047-49828069 TCGCGCACACTCCGTGGCCCCGG - Intronic
1096602799 12:52742319-52742341 GCGTGCACCCTCAGAGGCCCGGG + Intergenic
1097455389 12:59793029-59793051 TCACGCACTCTCAGAGACCCAGG - Intergenic
1102025928 12:109714349-109714371 GCACGCACCCGCAGCGGCCCCGG - Exonic
1106087775 13:26558209-26558231 TCCCGGACGCGGAGCGGCCCGGG - Intronic
1106269218 13:28138185-28138207 GCGCGCACGCGCAGCGGCGACGG + Intergenic
1106425465 13:29624932-29624954 TCACGCATGCACAGAGACCCAGG + Intergenic
1106546069 13:30732108-30732130 CAGAGCACGTGCAGAGGCCCGGG - Intronic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1110706261 13:78603706-78603728 GCGCGCGCGCGCAGACGCACGGG - Intergenic
1112579323 13:100664634-100664656 ACCCGCACGTGCAGAGCCCCTGG - Intronic
1113565598 13:111317869-111317891 AAGTGCAGGCGCAGAGGCCCGGG - Intronic
1113820364 13:113209012-113209034 GCGCGCGCGCCCCGAGGCCCTGG - Intronic
1119367837 14:74110535-74110557 TGGCGCACGCCCATAGTCCCAGG + Intronic
1119483382 14:74973644-74973666 TCGCTCTGCCGCAGAGGCCCTGG - Intergenic
1121443164 14:93961802-93961824 TCTCCCACTCACAGAGGCCCAGG - Intronic
1121883970 14:97525768-97525790 TGGCACATGTGCAGAGGCCCTGG + Intergenic
1125200778 15:37099270-37099292 TCGCACACACGCAGAGGCACGGG + Intronic
1125518279 15:40334927-40334949 TCACGCACGGGCACAGCCCCTGG - Exonic
1133104751 16:3500221-3500243 TCGCGCACGCGCAGACGGCTCGG - Intergenic
1133242824 16:4425853-4425875 CGGCGCAGGCGCAGAGTCCCCGG + Exonic
1142474308 17:180546-180568 TGGCGCGCGAGCAGAGGACCAGG - Intronic
1142549915 17:732344-732366 ACGCGCGCGCGCCGCGGCCCCGG + Intergenic
1142741549 17:1934608-1934630 TCGCCCACCCACAGAAGCCCAGG + Intergenic
1144656902 17:17042649-17042671 TCGCGCGCGCTGTGAGGCCCGGG + Intronic
1147684058 17:42276429-42276451 CCGCTCACGCGCGGAGGCCCAGG + Intronic
1147967261 17:44199912-44199934 TCGCGCCCGCGCAGAGGGAGGGG - Intronic
1152183657 17:78840735-78840757 GCGCGCCCGCGGAGAGGCCGGGG - Intronic
1152781506 17:82229126-82229148 TCGCGCGCGGGCCGGGGCCCAGG + Intronic
1160763740 19:798053-798075 TCGGGCCCGCGGCGAGGCCCCGG - Intronic
1162043293 19:7983340-7983362 TGGAGCACTTGCAGAGGCCCTGG - Intronic
1162585290 19:11554472-11554494 TCCCTCAAGGGCAGAGGCCCCGG - Intronic
929280510 2:40072786-40072808 TCGGGCATGTGCAGAGACCCAGG - Intergenic
930209294 2:48617836-48617858 CCGCGCAGGCGCAAAGGGCCAGG + Exonic
935334549 2:102004303-102004325 TAGAGCACGCACTGAGGCCCAGG - Intronic
936493526 2:112996728-112996750 TCAGGCATGCACAGAGGCCCAGG - Intergenic
1170026139 20:11891204-11891226 TCGGGCCCGCGCGGAGGTCCTGG + Intronic
1175789799 20:61734101-61734123 TCGCGCACCCACAGAGGAGCCGG - Intronic
1175927550 20:62478273-62478295 TCTCGCCCGCACCGAGGCCCCGG - Intergenic
1178482520 21:32991876-32991898 TGGAGCACAGGCAGAGGCCCGGG + Intergenic
1181177869 22:21047961-21047983 TGGGGCAGGTGCAGAGGCCCTGG + Exonic
1181401508 22:22652841-22652863 GCGCGCACGTGCACTGGCCCAGG + Intergenic
953627286 3:44581193-44581215 TCGCGCGCGCTGTGAGGCCCGGG - Intronic
953886615 3:46717780-46717802 TCGCGCGCGGGCAGCGCCCCCGG - Exonic
954693837 3:52410114-52410136 ACGCGCACGCGCGGAGGGACGGG + Exonic
961440865 3:126952483-126952505 TCGCACACAGGCAGAGGCCCAGG + Intronic
966854683 3:184185991-184186013 TCGCGCACGCGCAGAGAGCGCGG + Intronic
968452472 4:681819-681841 GCGCGCACCTGCAGCGGCCCCGG - Exonic
968732438 4:2275931-2275953 TCGCCCACCAGCAGAGGCCACGG + Intronic
972437025 4:39044729-39044751 TCGCGCGCCCGGAGAGGCCGCGG - Intergenic
973635938 4:52862200-52862222 TCGCGCGCGCGGAGCGGCGCCGG + Intergenic
973759573 4:54103851-54103873 TCTCTCACGCGCAGAGCTCCGGG + Intronic
975666890 4:76741498-76741520 GCGCGCTCACGCAGTGGCCCGGG - Exonic
978238920 4:106492439-106492461 TCAGGCACACGCAGAGACCCAGG - Intergenic
979576036 4:122293606-122293628 TCGGGCACGCACAGAGACACAGG + Intronic
987108641 5:14664652-14664674 TCGCGCAGGGTCAGAGGCCGTGG + Intronic
990359774 5:55007030-55007052 TCAGGCATGCACAGAGGCCCAGG + Intronic
992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG + Intronic
994346902 5:98697736-98697758 TCAGGCACACACAGAGGCCCAGG - Intergenic
994596174 5:101838753-101838775 TTGTGCACGCGCAGAGGACAGGG - Intergenic
997654429 5:135544763-135544785 GCGCGCACGCCCCGCGGCCCGGG + Intergenic
1002778767 6:350561-350583 CCGCGCAGGTGCACAGGCCCCGG + Exonic
1003427549 6:6007669-6007691 GCGCGCACACGCCCAGGCCCCGG + Intergenic
1009643197 6:66363199-66363221 CCCCGCACTCTCAGAGGCCCAGG - Intergenic
1012616228 6:101283062-101283084 TCAGGCAGGCACAGAGGCCCAGG + Intergenic
1014019521 6:116571463-116571485 GGGCGCAGGCGCAGAGTCCCCGG - Exonic
1014137666 6:117907637-117907659 CCGGGAACGCGCAGAGGACCCGG - Exonic
1015724805 6:136289369-136289391 TCGGGCGCGCGCAGAGGTACGGG + Intronic
1018872431 6:167793628-167793650 ACGCCCATGCCCAGAGGCCCTGG - Intronic
1019936264 7:4260207-4260229 TCCCACACACACAGAGGCCCCGG - Intronic
1019936324 7:4260577-4260599 TCCCACACACACAGAGGCCCCGG - Intronic
1019936345 7:4260701-4260723 TCCCACACACGCAGAGACCCTGG - Intronic
1022275791 7:28854275-28854297 TCCCGCACGCCCCGCGGCCCCGG - Intergenic
1023037868 7:36148710-36148732 TCTCTCACACTCAGAGGCCCTGG + Intergenic
1023171015 7:37390475-37390497 TCCCAGACGCACAGAGGCCCAGG + Intronic
1026986707 7:74559466-74559488 TCCCGCACACACAGAGCCCCAGG + Intronic
1029738641 7:102479034-102479056 TGACGCATGCGCAGAGGCACTGG - Intergenic
1029773721 7:102671775-102671797 TGACGCATGCGCAGAGGCACTGG - Intergenic
1045510726 8:102810485-102810507 GCGCGCACTCGCCGAGGCCCAGG + Intergenic
1056470725 9:86902797-86902819 GCGCGCCCCCGCAGAGGCCGGGG - Intergenic
1056643317 9:88388730-88388752 GCGCGCCCGCCCCGAGGCCCAGG - Intronic
1060849310 9:126861028-126861050 TCGCGCTCGGGCAGCTGCCCTGG + Intronic
1061800995 9:133113360-133113382 CTGCGCACCCTCAGAGGCCCAGG + Intronic
1062272156 9:135714511-135714533 TCGCGGACGCGCGCAGCCCCCGG - Intronic
1187818141 X:23255873-23255895 TCAGGCACACACAGAGGCCCAGG + Intergenic
1189974384 X:46447183-46447205 CCGCGCACGCGCAGTAGCACGGG - Exonic
1190924079 X:54886079-54886101 TCAGGCACGCACAGAGTCCCAGG - Intergenic
1194635783 X:96343386-96343408 TCGGGCACGTGCAGAGACCCAGG - Intergenic