ID: 900671432

View in Genome Browser
Species Human (GRCh38)
Location 1:3857221-3857243
Sequence GCGGGGTCGCGCACGCGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 382}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900671432_900671445 8 Left 900671432 1:3857221-3857243 CCTCTGCGCGTGCGCGACCCCGC 0: 1
1: 0
2: 0
3: 11
4: 382
Right 900671445 1:3857252-3857274 AGGCCGCGCCTGCGCACAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 69
900671432_900671448 12 Left 900671432 1:3857221-3857243 CCTCTGCGCGTGCGCGACCCCGC 0: 1
1: 0
2: 0
3: 11
4: 382
Right 900671448 1:3857256-3857278 CGCGCCTGCGCACAAGGGGAGGG 0: 1
1: 0
2: 2
3: 6
4: 56
900671432_900671444 7 Left 900671432 1:3857221-3857243 CCTCTGCGCGTGCGCGACCCCGC 0: 1
1: 0
2: 0
3: 11
4: 382
Right 900671444 1:3857251-3857273 CAGGCCGCGCCTGCGCACAAGGG 0: 1
1: 0
2: 0
3: 6
4: 58
900671432_900671443 6 Left 900671432 1:3857221-3857243 CCTCTGCGCGTGCGCGACCCCGC 0: 1
1: 0
2: 0
3: 11
4: 382
Right 900671443 1:3857250-3857272 CCAGGCCGCGCCTGCGCACAAGG 0: 1
1: 0
2: 0
3: 17
4: 133
900671432_900671447 11 Left 900671432 1:3857221-3857243 CCTCTGCGCGTGCGCGACCCCGC 0: 1
1: 0
2: 0
3: 11
4: 382
Right 900671447 1:3857255-3857277 CCGCGCCTGCGCACAAGGGGAGG 0: 1
1: 0
2: 1
3: 4
4: 69
900671432_900671450 26 Left 900671432 1:3857221-3857243 CCTCTGCGCGTGCGCGACCCCGC 0: 1
1: 0
2: 0
3: 11
4: 382
Right 900671450 1:3857270-3857292 AGGGGAGGGCTCCGCTACTCTGG 0: 1
1: 0
2: 0
3: 7
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900671432 Original CRISPR GCGGGGTCGCGCACGCGCAG AGG (reversed) Intergenic