ID: 900673398

View in Genome Browser
Species Human (GRCh38)
Location 1:3869617-3869639
Sequence GCCTCCGCACCCACCGTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900673398_900673405 4 Left 900673398 1:3869617-3869639 CCCTCCACGGTGGGTGCGGAGGC 0: 1
1: 0
2: 1
3: 24
4: 175
Right 900673405 1:3869644-3869666 GAGGAATTCCTGCGGGTCCTCGG 0: 1
1: 0
2: 2
3: 12
4: 118
900673398_900673403 -4 Left 900673398 1:3869617-3869639 CCCTCCACGGTGGGTGCGGAGGC 0: 1
1: 0
2: 1
3: 24
4: 175
Right 900673403 1:3869636-3869658 AGGCTCAGGAGGAATTCCTGCGG 0: 2
1: 0
2: 0
3: 23
4: 259
900673398_900673407 20 Left 900673398 1:3869617-3869639 CCCTCCACGGTGGGTGCGGAGGC 0: 1
1: 0
2: 1
3: 24
4: 175
Right 900673407 1:3869660-3869682 TCCTCGGCTCCATGTGCCAGAGG 0: 1
1: 0
2: 1
3: 10
4: 117
900673398_900673409 26 Left 900673398 1:3869617-3869639 CCCTCCACGGTGGGTGCGGAGGC 0: 1
1: 0
2: 1
3: 24
4: 175
Right 900673409 1:3869666-3869688 GCTCCATGTGCCAGAGGCTCCGG 0: 1
1: 1
2: 0
3: 17
4: 216
900673398_900673404 -3 Left 900673398 1:3869617-3869639 CCCTCCACGGTGGGTGCGGAGGC 0: 1
1: 0
2: 1
3: 24
4: 175
Right 900673404 1:3869637-3869659 GGCTCAGGAGGAATTCCTGCGGG 0: 2
1: 0
2: 2
3: 22
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900673398 Original CRISPR GCCTCCGCACCCACCGTGGA GGG (reversed) Exonic
900673398 1:3869617-3869639 GCCTCCGCACCCACCGTGGAGGG - Exonic
901494424 1:9613143-9613165 GCCTCAGGACCCTCCCTGGAGGG + Exonic
901627937 1:10634297-10634319 GCCTCCGCACCCTCTGGGGCAGG - Intergenic
901746601 1:11377820-11377842 GCCACCGCACCCAGCCTAGAAGG + Intergenic
902520342 1:17012027-17012049 TCCTCCGCACACACCGGGGGCGG + Intergenic
903173471 1:21567537-21567559 GCCTCCTCTCCCACGGTGGAAGG - Intronic
903762914 1:25711715-25711737 GGCTGCGCACCCACGGAGGAGGG - Intronic
904136031 1:28313285-28313307 GCCACCGCACCCAGCCAGGAGGG + Intergenic
904440324 1:30525679-30525701 GCCTCCGGACCCCCAGTTGAAGG + Intergenic
905704419 1:40043480-40043502 GCCTCCGCACCCGGCGTGAAGGG + Intronic
906049026 1:42855415-42855437 GCCACCGCACCCAGCCAGGAAGG - Intergenic
910010590 1:82456807-82456829 GCCTCCACACCCACCATAGCTGG + Intergenic
915569205 1:156734815-156734837 GCCACCGCACCCGGCCTGGAGGG + Intronic
918232628 1:182550135-182550157 TCCTCCCCACCCACTGTGTAGGG - Intronic
923541361 1:234890555-234890577 GCCACCGCACCCAGCCTGCATGG + Intergenic
1062767054 10:74050-74072 TCCTCAGCACCCACCCAGGAGGG - Intergenic
1064420589 10:15187201-15187223 GCCACCGCACCCACCCTGCAAGG - Intergenic
1065484350 10:26222551-26222573 GCCTTCTCACCCTTCGTGGATGG + Intronic
1069756068 10:70775082-70775104 CCCTCAGCTCCCACCCTGGAGGG - Intronic
1069930602 10:71878984-71879006 GCCTCCGCAGCCACCGCACATGG + Intergenic
1072016829 10:91356239-91356261 TCCTCCGCAGCCACAGTGGAGGG - Intergenic
1076434333 10:130429851-130429873 GCCTCCTCACCCATCGTGCATGG - Intergenic
1077049791 11:561435-561457 GCCTCCGCGCCGCCCGGGGAGGG + Exonic
1077112208 11:866812-866834 GCCTCCGGACCCCCCCTGGGAGG + Exonic
1077380661 11:2235544-2235566 ACCTCCTCACCCACCCTGGGAGG + Intergenic
1080534673 11:33209973-33209995 GCCACCGCGCCCAGCCTGGAAGG - Intergenic
1081402462 11:42658953-42658975 TCCTCAGCACCAACCTTGGAAGG - Intergenic
1084129851 11:67125145-67125167 GCCACCGCACCCAGCCTGGAGGG + Intronic
1084158368 11:67329114-67329136 GCCACCGCACCCAGCCTAGAAGG - Intronic
1085424461 11:76391665-76391687 GCCACCGCACCCAGCCTGGCTGG - Intronic
1085754098 11:79189846-79189868 GCCTGCGCAGCCTCCGTTGATGG + Intronic
1090623762 11:128586748-128586770 GACTCCTCACCCACCGTTAAAGG - Intronic
1091380085 12:52220-52242 GCCTCTGGACCCATCCTGGAGGG + Intergenic
1092839219 12:12522848-12522870 GCCACCGCACCCAGCCTAGAGGG + Intronic
1094474867 12:30833296-30833318 GCCCCCACACCCACGCTGGAAGG + Intergenic
1096143827 12:49264690-49264712 GCCCCCGCACCCACCGGGGACGG + Intronic
1097192407 12:57225850-57225872 CCCTCCGCCCCCAGAGTGGAAGG - Exonic
1097889227 12:64760281-64760303 GCCACCGCGCCCACGGTGGGCGG - Intergenic
1099127873 12:78788631-78788653 GCCTCAGCATCCACCGAGGAAGG + Intergenic
1100424498 12:94471357-94471379 GCCTCAGCACCCCCCGTAGCTGG + Intergenic
1101874803 12:108591208-108591230 GCCTCCACACCCAGCCTTGAGGG + Exonic
1102047720 12:109840234-109840256 GCCTCAGGACCCACCGAGGGGGG + Intergenic
1105425684 13:20292691-20292713 GCCTCCCCACTCCCCGTGGCGGG + Intergenic
1106322961 13:28659268-28659290 GCCGCCGCCGCCACCGGGGACGG - Intronic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1115499062 14:34033373-34033395 GCCACCGCACCCAGCCTGGGTGG - Intronic
1117972405 14:61265192-61265214 GCCACCGCACCCGCCTGGGATGG - Intronic
1118612894 14:67555331-67555353 ACCTCCTCACCCACAGTCGAGGG - Intronic
1119760492 14:77147491-77147513 GCCTCTGCATCAACCCTGGAGGG - Intronic
1122577286 14:102750501-102750523 GACTCAGCACGCACCGAGGAAGG - Intergenic
1123474713 15:20581697-20581719 CCCTCCGCAGCCACCGGGGATGG + Intergenic
1123474866 15:20582363-20582385 CCCTCCGCAGCCACCGGGGATGG + Intergenic
1123643145 15:22417994-22418016 CCCTCCGCAGCCACCGGGGATGG - Intergenic
1123643298 15:22418660-22418682 CCCTCCGCAGCCACCGGGGATGG - Intergenic
1124422171 15:29531950-29531972 GCCACCGCACCCAGCTTGAAAGG + Intronic
1125524415 15:40365990-40366012 GCCTCCTCACCCGCTCTGGAGGG - Intronic
1130379424 15:83358978-83359000 GCCTCCACACCCTCCAAGGAAGG + Intergenic
1132044111 15:98549374-98549396 GCCACCACACCCAGCGAGGAAGG + Intergenic
1132856901 16:2049536-2049558 GCCACCGCACCCAGCCAGGATGG - Intronic
1133093089 16:3420246-3420268 GCCACCGCACCCAGCCTGCATGG - Intronic
1134882350 16:17756615-17756637 GCCTACGCATCCAGGGTGGATGG - Intergenic
1137381267 16:48001857-48001879 GCCTCCGATCCCACCGTGAGTGG + Intergenic
1137611565 16:49821729-49821751 GCCTTCGCACACACCGGGGGAGG - Intronic
1139369573 16:66458426-66458448 CCCTCCCCTCCCACCCTGGAGGG + Intronic
1139480324 16:67227011-67227033 GCCTCCGCCCCCACTGCGCAAGG + Intronic
1142363247 16:89637063-89637085 GGCTCAGCACCCACCCTGGGGGG - Intronic
1142661593 17:1433803-1433825 GCCACCGCACCCAGCATGTATGG + Intronic
1142979308 17:3662567-3662589 GCCTCAGCTCCCACCTGGGAGGG - Intergenic
1144624618 17:16838410-16838432 GCCTCCGGACCCCCCTTGCAGGG - Intergenic
1144881810 17:18434311-18434333 GCCTCCGGACCCCCCTTGCAGGG + Intergenic
1145150423 17:20510075-20510097 GCCTCCGGACCCCCCTTGCAGGG - Intergenic
1147207252 17:38846323-38846345 GCCTCCGCACCCAGCCGAGATGG + Intergenic
1148237672 17:45980212-45980234 GCCACCGCACCCAGCCTGGTTGG - Intronic
1150432538 17:65129840-65129862 GCCACCACACCCACTGAGGATGG - Intergenic
1150498321 17:65626156-65626178 GCCACCGCACCCAGCGGAGATGG - Intronic
1151074341 17:71254082-71254104 GCCTCTGCAACCAACATGGATGG - Intergenic
1152076730 17:78164548-78164570 GCCTCCGCCCCCTCCCAGGAGGG + Intronic
1152293786 17:79455096-79455118 GCCTGTGCACACCCCGTGGAGGG - Intronic
1152960329 18:75897-75919 TCCTCAGCACCCACCCCGGAGGG - Intergenic
1156759377 18:40569140-40569162 GCCTTTGCACCCACAGTGGAGGG + Intergenic
1158102192 18:53841964-53841986 GCCACCGCACCCAGCCAGGAAGG - Intergenic
1159254091 18:65923128-65923150 GCCACTGCACCCACCCTGGGTGG - Intergenic
1160369734 18:78362274-78362296 GGCTCAGCCTCCACCGTGGAGGG + Intergenic
1160524356 18:79526292-79526314 GGCTCCGCCCCCAGTGTGGAAGG - Intronic
1160873099 19:1285884-1285906 GCCGCCGCACCCGCCGGGGAGGG - Intergenic
1160936446 19:1598256-1598278 GCCACTGCACCCAGCCTGGAAGG - Intronic
1161662340 19:5554586-5554608 GCCACCGCACCCAGCCTGCATGG - Intergenic
1162468536 19:10857943-10857965 GCCACCCCACCCAGCCTGGAAGG - Intronic
1162902987 19:13806327-13806349 GCCACCACACCCAGCCTGGACGG + Intronic
1162989357 19:14292384-14292406 GCCACGGCACCCAGCATGGAAGG - Intergenic
1163410710 19:17152446-17152468 GCCTCGGCCCCCACAGTGGTTGG - Intronic
1163830715 19:19545982-19546004 CCCTCCGCACCCGCCGGGGTAGG + Exonic
1163938718 19:20473891-20473913 GCCACCGCACCCAGCCAGGAAGG - Intergenic
1164266998 19:23628834-23628856 GCCACCGCACCCGGCCTGGAAGG - Intronic
1166130468 19:40742854-40742876 GCAGCTGCACCCACCCTGGAGGG - Intronic
1166428416 19:42700417-42700439 GCCACCGCACCCAGCCTGGATGG - Intronic
1166875704 19:45896003-45896025 GCCACCGCACCCGGCCTGGATGG - Intronic
1167268553 19:48495294-48495316 GCCACCGCACCCAGCCTAGAGGG + Intronic
1168471466 19:56643668-56643690 GCCTGCGCTCCCACCGTTGCAGG - Intronic
1202647114 1_KI270706v1_random:152831-152853 CCCTCTGCAGCCACCGGGGATGG + Intergenic
926158922 2:10474587-10474609 GCCACCGCACCCGGCCTGGAAGG + Intergenic
927819921 2:26255211-26255233 GCCCCCGCACCCAGCCTGGAAGG - Intronic
928116813 2:28551013-28551035 GCCTCCGCAACCAGCATGGGAGG + Intronic
931365241 2:61613451-61613473 GCCACTGCACCCAGCCTGGAAGG + Intergenic
932344748 2:70988310-70988332 ACCTCCTGACCCACCTTGGAAGG + Exonic
935732384 2:106074694-106074716 GCCTCCTCAGTCACCATGGATGG - Intronic
936067428 2:109343101-109343123 GCCTCCACACCCACCCAGGAGGG - Intronic
938844728 2:135196676-135196698 GCCACCACACCCAGCCTGGATGG + Intronic
940485583 2:154291580-154291602 GGCCCCGCACCCAGCGTGGCCGG - Intronic
944645436 2:201775594-201775616 GCCTTCCCAACCACTGTGGAAGG + Intronic
947912171 2:233808635-233808657 GCCACCAAACCCACTGTGGATGG - Intronic
948487888 2:238292338-238292360 GACTGCACACCCATCGTGGATGG - Intergenic
1169165831 20:3423223-3423245 GCCTCCTGACCCAGCGTGCAAGG - Intergenic
1169483333 20:6005759-6005781 GGCGCCGCACGCACCTTGGAGGG + Intergenic
1170889692 20:20367451-20367473 GCCTCCGCCCGGACCTTGGACGG - Intergenic
1171235272 20:23519393-23519415 GCCTCCAAACCCACCCTGGAAGG + Intergenic
1172763804 20:37340171-37340193 GCCACCGCACCCAGCCAGGAAGG + Intergenic
1174250527 20:49216237-49216259 GCCACCGCACCCAGCCTTGAGGG - Intergenic
1176604756 21:8819943-8819965 CCCTCTGCAGCCACCGGGGATGG - Intergenic
1177205541 21:18006126-18006148 GCCTCAGCAATCACGGTGGAAGG - Intronic
1179653536 21:42830913-42830935 GCCACCGCACCCAGAGTGGGGGG + Intergenic
1179922836 21:44516445-44516467 GCCTCTTCACCCACGGTGTAGGG + Intronic
1180347046 22:11711548-11711570 CCCTCTGCAGCCACCGGGGATGG - Intergenic
1183364681 22:37400612-37400634 GCCTCCCCACCCACCCTCGGTGG + Intronic
1184159428 22:42689082-42689104 GCCGCCACACCCACCCTGGAAGG - Intergenic
1185322025 22:50205872-50205894 GCCCCCACACCCACAGTGGGAGG - Intronic
949543195 3:5050360-5050382 GCCACCGCACCCAGCCGGGAGGG - Intergenic
952384015 3:32826170-32826192 GCCACCGCACCCTGCCTGGATGG - Intronic
952919023 3:38271951-38271973 GCCCCAACACCCACAGTGGATGG - Intronic
953244307 3:41176821-41176843 GCATCCGCATCCTCTGTGGAAGG - Intergenic
963806632 3:149729130-149729152 GCCACCGCACCCAGCCTGGAAGG + Intronic
966425444 3:179775606-179775628 GCCTGAGCCCCCACCGTGGTGGG - Intronic
968071934 3:195789472-195789494 GCCCCAGCTCCCACCGGGGATGG - Exonic
968353391 3:198080931-198080953 CCCTCCGCAGCCACCAGGGATGG + Intergenic
970979688 4:22081882-22081904 GCTCCAGCACCCACCGTGCATGG - Intergenic
971257065 4:25024225-25024247 GCCACCGCACCCAGCCAGGAAGG - Intronic
973373368 4:49270994-49271016 CCCTCTGCAGCCACCGGGGATGG + Intergenic
973387642 4:49524214-49524236 CCCTCTGCAGCCACCGGGGATGG - Intergenic
977855450 4:101885201-101885223 GCCACCGCACCCAGCCTGGGAGG + Intronic
978577093 4:110198569-110198591 GCGTCCGCATCCACCGTAGGAGG + Exonic
979612282 4:122702190-122702212 GCCTCAGCACCCACAGTAGCTGG + Intergenic
983552416 4:169031503-169031525 GACACCGCACGCACCCTGGAGGG + Intergenic
983552426 4:169031537-169031559 GCCACCACACGCACCCTGGAGGG + Intergenic
983552437 4:169031571-169031593 GCCACCGCACGCACCCTGGAGGG + Intergenic
983552448 4:169031605-169031627 GCCACCGCACGCACCCTGGAGGG + Intergenic
984963145 4:185117464-185117486 ACCTCCACACCCACCATGGGAGG - Intergenic
985061151 4:186080876-186080898 GCCACCGCGCCCAGCCTGGAGGG + Intronic
985128317 4:186717051-186717073 GCCACCGCACCCAGCGTAAATGG + Intronic
985661343 5:1158563-1158585 GCCACCGCACCCGGCGTGCAAGG + Intergenic
990381230 5:55223426-55223448 GCCGCCGCACCGCCGGTGGAAGG - Intronic
992138442 5:73771254-73771276 GCCACCGCACCCAGCCCGGATGG - Intronic
992290720 5:75276903-75276925 TCCTCCACACCCACTGTGGCAGG + Intergenic
1001403869 5:171462207-171462229 CCCTCCCCACCCACCCTGGTAGG - Intergenic
1002046385 5:176543697-176543719 ACCTCCGCGCCCACCGGGGCTGG - Intronic
1002449491 5:179310761-179310783 GCCTCTACACCCACCTTTGAGGG - Intronic
1006136998 6:31901569-31901591 GCCCGCGCGCCCACGGTGGAAGG + Intronic
1006597676 6:35205365-35205387 GCCACCGCACCCAGCCCGGAAGG - Intergenic
1007241061 6:40425512-40425534 GCCTCCTCTGCCACCCTGGAGGG - Intronic
1007393156 6:41562051-41562073 GCCTGCTCACCCACAGTGCAGGG + Intronic
1009624870 6:66126529-66126551 GCCTCTCCACCCACCCTGGTAGG - Intergenic
1010493285 6:76500772-76500794 GCCACCGCGCCCAGCCTGGAGGG - Intergenic
1013995620 6:116304430-116304452 GCCTCAGAACCCACTGGGGATGG - Intronic
1014586333 6:123202231-123202253 CCCCCCGCCCCCACCGTGGTGGG + Intergenic
1018559406 6:165085837-165085859 GCCACCACACCAACCCTGGACGG + Intergenic
1031469140 7:122148105-122148127 GACTCAGCACCCAATGTGGATGG - Intergenic
1032388781 7:131542273-131542295 GCCTCTGCACCCACCTTGCAGGG - Intronic
1035199827 7:157254996-157255018 GCCTCAGCACCCGACGTAGATGG - Intronic
1036530703 8:9583771-9583793 GCCACCGCACCCAGCCTGTATGG + Intronic
1037431708 8:18819861-18819883 GCCTCCGCACCCAGCCAGAATGG + Intronic
1038572654 8:28676209-28676231 GCCTACTCACCCACCCTGGGAGG + Intronic
1038754013 8:30324095-30324117 GCCGCCGCACCCAGCCTGCAAGG - Intergenic
1040111911 8:43570427-43570449 GCCCCCGCGCCCAACCTGGAGGG - Intergenic
1045795008 8:106032341-106032363 GCCACCGCACCCAGCCTTGATGG + Intergenic
1049532173 8:143160135-143160157 GCCTCGGCGCTCACCGCGGATGG + Intronic
1049784585 8:144444349-144444371 GCCTCCGCGCCCCCGGAGGAAGG + Intronic
1049888742 9:47499-47521 GCCTCTGGACCCATCCTGGAGGG + Intergenic
1049950236 9:636579-636601 GCCACCGCACCCAGCCAGGAAGG - Intronic
1052872657 9:33523714-33523736 CCCTCTGCAGCCACCGGGGATGG - Intergenic
1053503396 9:38620854-38620876 CCCTCCGCAGCCACCGGGGATGG + Intergenic
1053752672 9:41273106-41273128 CCGTCCGCAGCCACCGGGGATGG + Intergenic
1054258200 9:62837458-62837480 CCGTCCGCAGCCACCGGGGATGG + Intergenic
1054351599 9:64021339-64021361 CCCTCTGCAGCCACCGGGGATGG - Intergenic
1055441145 9:76337758-76337780 GCCACTGCACCCAGCCTGGATGG + Intronic
1057684710 9:97221821-97221843 CTCTCCGCAGCCACCGGGGATGG + Intergenic
1057684791 9:97222111-97222133 CCCTCTGCAACCACCGGGGATGG + Intergenic
1058415096 9:104779090-104779112 TCCTTCGCACCCACCTTGAAAGG + Intergenic
1059357115 9:113708514-113708536 TCCTCCGCAACCACTGTGGCAGG - Intergenic
1059678456 9:116563087-116563109 GCCACCGCACCCAGCCTGGCTGG - Intronic
1061330128 9:129887024-129887046 GCCTCCCCCTCCACCGTGGATGG + Intergenic
1061965403 9:134011087-134011109 GCCTGCCCACCCACAGTGGCGGG + Intergenic
1062601177 9:137319264-137319286 GCCACCGCAGCCACAGTGCAGGG - Intronic
1062737768 9:138147807-138147829 TCCTCAGCACCCACCCCGGAGGG + Intergenic
1062738169 9:138150185-138150207 TCCTCAGCACCCACCCCGGAGGG + Intergenic
1202800576 9_KI270719v1_random:170918-170940 CCGTCCGCAGCCACCGGGGATGG - Intergenic
1203552133 Un_KI270743v1:172032-172054 CCCTCTGCAGCCACCGGGGATGG - Intergenic
1185535824 X:861017-861039 ACATCCCCACCCACAGTGGATGG + Intergenic
1188626042 X:32285984-32286006 GCCACCGCACCTGCCCTGGAAGG + Intronic
1189372284 X:40438373-40438395 ACCTACTCACCCACCCTGGAAGG + Intergenic
1190078957 X:47340172-47340194 GCCACCGCACCCAGCGGAGATGG - Intergenic
1190092448 X:47451465-47451487 GCCACCGCACCCAGCCTGCATGG - Intronic
1201153414 Y:11107605-11107627 CCCTCTGCAGCCACCGGGGATGG - Intergenic