ID: 900673966

View in Genome Browser
Species Human (GRCh38)
Location 1:3872543-3872565
Sequence CCTCTTCAGCACCTGGAACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 306}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900673960_900673966 4 Left 900673960 1:3872516-3872538 CCCCTACAGTAACAGGGAGAGCA 0: 2
1: 0
2: 0
3: 10
4: 182
Right 900673966 1:3872543-3872565 CCTCTTCAGCACCTGGAACCTGG 0: 1
1: 0
2: 2
3: 43
4: 306
900673957_900673966 11 Left 900673957 1:3872509-3872531 CCATCAACCCCTACAGTAACAGG 0: 2
1: 0
2: 0
3: 9
4: 149
Right 900673966 1:3872543-3872565 CCTCTTCAGCACCTGGAACCTGG 0: 1
1: 0
2: 2
3: 43
4: 306
900673962_900673966 2 Left 900673962 1:3872518-3872540 CCTACAGTAACAGGGAGAGCAGG 0: 2
1: 0
2: 1
3: 25
4: 221
Right 900673966 1:3872543-3872565 CCTCTTCAGCACCTGGAACCTGG 0: 1
1: 0
2: 2
3: 43
4: 306
900673961_900673966 3 Left 900673961 1:3872517-3872539 CCCTACAGTAACAGGGAGAGCAG 0: 2
1: 0
2: 2
3: 14
4: 174
Right 900673966 1:3872543-3872565 CCTCTTCAGCACCTGGAACCTGG 0: 1
1: 0
2: 2
3: 43
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900673966 Original CRISPR CCTCTTCAGCACCTGGAACC TGG Exonic
900291251 1:1924448-1924470 CCTCTCCAGCACCCGGGGCCGGG - Exonic
900673966 1:3872543-3872565 CCTCTTCAGCACCTGGAACCTGG + Exonic
901204946 1:7489234-7489256 CTTTTTCAGCATCTGGAAACGGG - Intronic
901631213 1:10649086-10649108 GCTCTTCAGCACCTTGGACGGGG - Exonic
903361804 1:22781582-22781604 CCTCTTCAGGACCCAGAGCCAGG + Intronic
903448595 1:23437702-23437724 CCTCGTCTGAGCCTGGAACCAGG - Intronic
903779782 1:25813948-25813970 CTTCATCAGCACCTGGTCCCTGG + Exonic
903891221 1:26571838-26571860 GCGCTTCAGCACCTGGCAACAGG - Exonic
904264964 1:29312923-29312945 CCTCCTCAGCACCTGGGTCAAGG - Intronic
904627469 1:31815102-31815124 CCTCAGCAGCACCTGCAGCCCGG + Exonic
905204953 1:36338193-36338215 CCTCCTCAGCACCTGGGTCTGGG - Intergenic
905446064 1:38029170-38029192 CCTCTGCTGCAGCTGGAGCCTGG + Intergenic
906053558 1:42895503-42895525 CCTTTTCAACACATGGCACCAGG - Intergenic
906715167 1:47963331-47963353 TCTGTTCACCACCTGTAACCTGG - Intronic
907265180 1:53254922-53254944 GCTCTTCAGGACCTGGCCCCAGG - Intronic
910897588 1:92084724-92084746 TCTCTTCAGCCTCTGGAGCCTGG + Intronic
911239539 1:95449811-95449833 CCTCTTCAGCACCTCTTTCCTGG + Intergenic
911650079 1:100377966-100377988 CCTGTTCATCACTTGGAAACAGG - Intronic
911828777 1:102523622-102523644 CCTCTTTAGCCTCTTGAACCTGG + Intergenic
912458470 1:109815630-109815652 ACTCTTCACCACCTGGCACCAGG - Intergenic
914267014 1:146046801-146046823 CTTCTTCAGCAGCTGAAGCCTGG + Intergenic
914323824 1:146591688-146591710 CCTCTTCTGCACATGGACCCTGG + Intergenic
915321757 1:155060407-155060429 CCTCTGCAGCCCCTGCCACCTGG + Intronic
916897522 1:169180877-169180899 GCTCTCCAGCACCTGAAACATGG - Intronic
917211942 1:172640597-172640619 CTTCCTGAGCACCTGGCACCAGG - Intergenic
917457047 1:175193872-175193894 CTGGTTCAGCACCTGGCACCTGG - Intergenic
918593906 1:186270449-186270471 CCTCTTCAGCACCTAGATCTTGG + Intergenic
919454790 1:197808271-197808293 CTTCTTCAGCCTCTTGAACCTGG + Intergenic
922918277 1:229276892-229276914 CTTCCACAGCACCTGGAACCTGG + Intronic
923825833 1:237499306-237499328 CCTCTCAAACACCTGGGACCTGG - Intronic
1063819593 10:9819387-9819409 CCTTTTTAGCACCAGGGACCAGG + Intergenic
1064722692 10:18246008-18246030 GCTCTTCTACTCCTGGAACCCGG + Intronic
1065189538 10:23197100-23197122 CCACTTCTGCACCTGGAGCTGGG + Intergenic
1065979340 10:30876114-30876136 ACTCTTGAGCACATGGAATCTGG - Intronic
1066693934 10:38061360-38061382 TCTCATCAGCACCTGGACCATGG - Intronic
1066998885 10:42587812-42587834 TCTCATCAGCACCTGGACCATGG + Intronic
1067078049 10:43199183-43199205 CTTCTTCACCACCTGGAAGGTGG + Exonic
1067217794 10:44316872-44316894 CCCCTTCAGGACCTCTAACCTGG + Intergenic
1067746177 10:48938323-48938345 CCTCTTCTTCACCTGGCACTAGG - Intronic
1069035891 10:63645650-63645672 CCTCTTCATCCTCTGAAACCAGG + Intergenic
1069347476 10:67487134-67487156 CCACTCCAGCACTTGGATCCAGG + Intronic
1069723663 10:70564495-70564517 GCCCTTCAGCACCTGGATGCAGG + Exonic
1071541588 10:86489768-86489790 CCTCTTTACCACCTGGAAATGGG + Intronic
1072047984 10:91676121-91676143 TCTCTGCAGCAGCTGGAACAAGG - Intergenic
1072748615 10:97959792-97959814 CTTCTTCAGCTTCTTGAACCAGG + Intronic
1072884265 10:99259996-99260018 CCTTTTTGGCACCAGGAACCAGG - Intergenic
1073116682 10:101095424-101095446 CCTCTTCAGCTCCAGGAAACAGG + Intronic
1073536372 10:104280354-104280376 CCTTTTCAGAGCCTGGAACTTGG - Intronic
1073650413 10:105352619-105352641 CTTCTTCAGCCTCTTGAACCTGG + Intergenic
1075947909 10:126454040-126454062 CCACTGCAGCTCCTCGAACCTGG - Intronic
1076238979 10:128888020-128888042 CCTCTGCAGCCCATGGAGCCTGG - Intergenic
1076262447 10:129078496-129078518 CATCTTGAGCTCCTGGCACCGGG - Intergenic
1076499097 10:130921720-130921742 CCCCTTCAGCACCTGCATCAAGG + Intergenic
1076547169 10:131253151-131253173 TCTCTTCAGCACCAGGAGCCCGG + Intronic
1076909751 10:133381087-133381109 TCTCATCTGCACCTGGTACCTGG - Intronic
1077476281 11:2791957-2791979 CCTCTGGAGCACTCGGAACCCGG - Intronic
1077489252 11:2852930-2852952 CCTCTTCAGCACCCCGTACCAGG + Intergenic
1081062936 11:38503346-38503368 CCTCATCTGCTTCTGGAACCTGG + Intergenic
1082025659 11:47569689-47569711 TCTCTTCCACTCCTGGAACCAGG - Exonic
1084297253 11:68220937-68220959 CCTCATCTGCACCTTAAACCTGG - Intergenic
1084977482 11:72810460-72810482 TGTCTTCAGCATCTAGAACCAGG - Intergenic
1085457197 11:76671790-76671812 CCCCTTCTACACTTGGAACCAGG - Intergenic
1086448313 11:86890888-86890910 CTTCTTCAGCCTCTTGAACCTGG + Intronic
1087649371 11:100846956-100846978 CTTCTTCAGCTGCTTGAACCTGG - Intronic
1088515348 11:110626663-110626685 CCTATAAAGCACCTGAAACCCGG + Intronic
1088558144 11:111083762-111083784 CCTCTTCAGCTCCTGTATCATGG - Intergenic
1089512937 11:119011967-119011989 GCTCTTCAGCACCTAGAAGCTGG + Exonic
1090858062 11:130628708-130628730 CCTCTTCAGAACCTGATTCCTGG - Intergenic
1091731732 12:2885969-2885991 ACTCTTCTGCCCCTTGAACCAGG + Intronic
1093769084 12:22998828-22998850 GCTCTTCTGCTCATGGAACCTGG - Intergenic
1093849353 12:24017259-24017281 CCTCTTCTGCACATCTAACCTGG + Intergenic
1094137819 12:27147840-27147862 CCTCTTCAGCAGCTGGAAAAGGG + Intergenic
1094187149 12:27656914-27656936 CCTCTTCAGCAGCTGGAAAAGGG + Intronic
1094388871 12:29926876-29926898 CCTCTTGAACTCCTGGACCCAGG + Intergenic
1096685239 12:53284063-53284085 GCCCTTCAGCACCAGGAACAGGG - Exonic
1097261122 12:57720780-57720802 CCTCTTCAGCTCCCGGCACCTGG - Exonic
1097995592 12:65884304-65884326 CCTCTTCAGCATCTCTAATCTGG - Intronic
1098280382 12:68856394-68856416 CCACATCACCACCTGGAATCAGG - Exonic
1098586840 12:72164403-72164425 TCTCTTCAGCCTCTTGAACCTGG - Intronic
1100194174 12:92225270-92225292 CCTCTGCAGCACCAGGTAGCAGG + Intergenic
1101824214 12:108208123-108208145 CATCTCCAGCACCTGGAATCAGG - Intronic
1101997555 12:109535747-109535769 CTTCCTCAGCACAGGGAACCCGG + Exonic
1102715951 12:114972748-114972770 CCTCATCAGGGCCTGGAACCAGG + Intergenic
1102813631 12:115844631-115844653 CATTCTCAGCACCTGGAACAGGG + Intergenic
1103380456 12:120490169-120490191 CATCTCCAGCACCTGGAACAGGG + Intronic
1103447758 12:121005360-121005382 CAGCTTCAGCACCTGGCACCTGG - Intronic
1103942980 12:124510903-124510925 CCTCATCAGAACCCGGAATCTGG + Intronic
1104973192 12:132540692-132540714 ACACATCAGCACCTGGAACCAGG + Intronic
1105294136 13:19073444-19073466 CCTCTGCAGCATCTGGCACAGGG + Intergenic
1107716170 13:43201746-43201768 CTTCTTCAGCCTCTTGAACCTGG - Intergenic
1107940061 13:45375463-45375485 CATCCTCATCACCTGGCACCAGG - Intergenic
1107945994 13:45418238-45418260 TCTCTGCGGCTCCTGGAACCCGG - Intronic
1110792636 13:79602128-79602150 CTTCTTCAGCCTCTTGAACCTGG - Intergenic
1112637169 13:101227706-101227728 CTTCTTCAGCCTCTTGAACCTGG + Intronic
1113132513 13:107053849-107053871 CCTGGTCATCACCTGGTACCAGG - Intergenic
1113657369 13:112075855-112075877 CATCCTCAGCACCTGGACACAGG - Intergenic
1115539749 14:34409622-34409644 CCTCTGCAGCCCCAGGTACCAGG + Intronic
1117622121 14:57598094-57598116 CCTCAGGAACACCTGGAACCAGG + Intronic
1117992535 14:61448793-61448815 CCTCTGGAGGGCCTGGAACCTGG + Intronic
1118206345 14:63727479-63727501 CCCCTTCTGGATCTGGAACCTGG - Exonic
1118747344 14:68783948-68783970 TTTTTTCAGCACCTGGAGCCAGG - Intergenic
1118885310 14:69860784-69860806 CCTCTTCTGCTCTTGGAAGCCGG + Intronic
1119768138 14:77203669-77203691 CCTCTTCAGCACCTAGCTCGGGG + Intronic
1120626351 14:86831651-86831673 CCTCTCCAGCAACAGGAACATGG + Intergenic
1121643421 14:95501473-95501495 CCTCTGCTGCACGTGGCACCTGG - Intergenic
1121708874 14:96021960-96021982 CCTCTTTAACACCTGGGAGCAGG + Intergenic
1125161736 15:36652276-36652298 CTTCTTCAGAACCTGGAATAAGG + Intronic
1125292111 15:38161387-38161409 CCTCTTAAACACCTGGCATCTGG - Intergenic
1125600030 15:40910467-40910489 CCTTTTCATCCCCTGGAATCTGG + Intergenic
1125828386 15:42694255-42694277 ACTCTGCAGCACCTGGAGCAGGG - Exonic
1125905035 15:43383920-43383942 CCTCCCAAGTACCTGGAACCAGG + Intronic
1127118623 15:55751652-55751674 CTTCTAAAGCACCTGGAACAGGG - Intergenic
1127755957 15:62092266-62092288 CCTCTTCAGCATCTGAAGACGGG + Intergenic
1128822458 15:70671825-70671847 CTTCATCAGCACATGGAACTAGG - Intronic
1129063861 15:72884340-72884362 CCTCTTAAGCTCCTGGAAAGGGG + Intergenic
1129821109 15:78602605-78602627 CTGCTTCAGCACCTGGCTCCAGG - Intronic
1129918276 15:79294249-79294271 TCTCTTCAGCACCGGCATCCTGG + Exonic
1130957967 15:88640328-88640350 CATCCCCAGCACCTGGAGCCTGG - Intronic
1131375395 15:91918885-91918907 ACTCTGCAGGAGCTGGAACCAGG - Intronic
1131425377 15:92341530-92341552 CTTCTTCAGCCTCTTGAACCTGG + Intergenic
1131967409 15:97859025-97859047 CCTCTTCAGCAGCTGCCAGCTGG - Intergenic
1132118670 15:99158071-99158093 CCTCATCAGCACCTGTAATGTGG - Intronic
1132892344 16:2210492-2210514 CCTCCTCAGCACCAGGGACATGG - Intronic
1134051920 16:11143349-11143371 CTTCTTCAGCCTCTGGAACCTGG - Intronic
1134779906 16:16886273-16886295 CTTCTTCAGCCTCTTGAACCTGG - Intergenic
1135790172 16:25386695-25386717 CCTCTCCAGCATCTAGAACAGGG + Intergenic
1138002757 16:53299034-53299056 CAGCCTCAGCACCTGGAACCAGG + Intronic
1139408725 16:66741045-66741067 TGTCTCCAGCACCTAGAACCTGG + Intronic
1139451465 16:67030543-67030565 CCTCATCAGCACCTCCAACAAGG - Intronic
1139641992 16:68298469-68298491 CCTCTTCTGTCCCTGGCACCAGG + Exonic
1140009739 16:71119156-71119178 CCTCTTCTGCACATGGACCCTGG - Intronic
1140871731 16:79113020-79113042 GTTCTTCAGCACCTGGCACTGGG - Intronic
1141368545 16:83466271-83466293 CTTCTTCAGCCTCTTGAACCTGG - Intronic
1141483451 16:84322687-84322709 ACCATCCAGCACCTGGAACCAGG + Intronic
1142376904 16:89711248-89711270 CCTCTCCGGCACCTGGCACCAGG + Intronic
1143343737 17:6234155-6234177 CCTCTACAGCACCAGGCCCCAGG - Intergenic
1144502876 17:15804863-15804885 GCTCTTCAGCACCTGGACACAGG + Intergenic
1145101701 17:20082473-20082495 CCTCTTCAGTAGCTGGGACAAGG - Intronic
1145165057 17:20607528-20607550 GCTCTTCAGCACCTGGACACAGG + Intergenic
1146012488 17:29207026-29207048 CTTCCTCAGTACCTGGCACCTGG + Intergenic
1146907708 17:36628597-36628619 CTTCTGCAGCACCTGGCACAGGG - Intergenic
1147378137 17:40035150-40035172 CCTCAGCAGCACCAAGAACCGGG - Exonic
1148863044 17:50614465-50614487 CTTCCTCAGCACCTGGAAGAGGG + Intronic
1149565114 17:57635734-57635756 CCTCTTCAGCAACGGAAAACAGG + Intronic
1150245593 17:63672415-63672437 CCTTCCCAGCACCTGGAACCAGG - Intronic
1150845212 17:68650001-68650023 CCTCTTCAGGTTCTGGAGCCTGG - Intergenic
1151361395 17:73591331-73591353 CTTCTTCAGCTTCTCGAACCTGG + Intronic
1151927840 17:77211844-77211866 CAGCTTCAGCACCTGCACCCTGG + Intronic
1152214798 17:79025725-79025747 CCTCTCCAGCACCTGCCAACCGG + Intronic
1152875917 17:82786133-82786155 AATCATCTGCACCTGGAACCAGG + Intronic
1153120400 18:1717782-1717804 ACTCACCAGCACCTGGAATCTGG + Intergenic
1153369217 18:4295004-4295026 CCTCATCTGCTCCTGGAGCCTGG + Intronic
1155228073 18:23747510-23747532 TCTCTCCAAAACCTGGAACCAGG + Intronic
1155516359 18:26627128-26627150 CCTCCTTTGCACCTGGAAACTGG + Intronic
1156831356 18:41495927-41495949 TATCTACAGCATCTGGAACCTGG - Intergenic
1157298942 18:46465834-46465856 CCTTTTCAGAGCCTGGCACCAGG - Intergenic
1159888678 18:73934879-73934901 CTTCTTCAGCCTCTTGAACCTGG + Intergenic
1160210522 18:76874465-76874487 GCTCTTCAGCACCTAGAACAGGG - Intronic
1160321584 18:77900640-77900662 CGCCGTCTGCACCTGGAACCCGG - Intergenic
1161396900 19:4049482-4049504 TATTTTCAGCACCTGGAACAGGG - Intronic
1162308886 19:9893040-9893062 CCTCTTCATCTCTTAGAACCAGG + Intronic
1162473841 19:10888173-10888195 CCTCTTTAGCACCAGGAAGCAGG + Intronic
1162899969 19:13789120-13789142 CCTCTTCAGCATCTGATACGTGG - Intergenic
1163799031 19:19353979-19354001 CCTTCTCAGAACCTGAAACCTGG + Intronic
1164465845 19:28486938-28486960 CCTCATGAGAACCTGGAATCAGG - Intergenic
1165486725 19:36101025-36101047 CCTGTACCCCACCTGGAACCAGG - Intronic
1166988232 19:46675021-46675043 CCCCTGCATCACCTGTAACCAGG + Exonic
1167307786 19:48719192-48719214 CCTCTACAGCCCCTGGGATCCGG - Intronic
1167338442 19:48900718-48900740 CCTCTTCCTCCCCTGGAACCAGG - Intronic
1167661709 19:50799346-50799368 GCCCTTCAGCACCTGGAGGCAGG + Exonic
1168453039 19:56480706-56480728 CTTCTTCAGCCTCTTGAACCTGG - Intergenic
926420338 2:12690070-12690092 CCTCTTCAACAAATGGTACCTGG + Intergenic
927141678 2:20135258-20135280 ACTCCTCATCACCAGGAACCAGG + Intergenic
927848088 2:26481762-26481784 TCCCTTTAGCACCTGGAAACCGG + Intronic
928414411 2:31079665-31079687 CCTCTTCAGCCTCTTGAACATGG + Intronic
928907611 2:36383927-36383949 TATCTTCTGCACCTGGAACAGGG - Intronic
930602324 2:53456817-53456839 TCTCTTCAGCATCTTGAACCTGG - Intergenic
931230420 2:60370026-60370048 CCTCGTCAGCACCTGAATCATGG + Intergenic
931375616 2:61705244-61705266 CTTCTTCAGCCCCTTGAACCTGG - Intergenic
931832010 2:66062478-66062500 CCTCTTGACCACCTGGGACAGGG + Intergenic
932176814 2:69610265-69610287 CCTCTTCAACAAATGGAACTGGG + Intronic
933188267 2:79303232-79303254 CCACTTCAGGACGTGGATCCTGG - Intronic
933409781 2:81910428-81910450 CCTCATCTGCTCCTGGAGCCTGG + Intergenic
933559317 2:83872362-83872384 CTTCTTCAGCCTCTTGAACCTGG + Intergenic
934231566 2:90187583-90187605 CCTTTTCATCAACTTGAACCAGG + Intergenic
935556706 2:104518371-104518393 CCTCTTCAGAACCCGGATGCTGG + Intergenic
935701005 2:105811795-105811817 TCTCTTCAGCCTCTTGAACCTGG + Intronic
937418432 2:121736259-121736281 CCTAGTCAGCAAGTGGAACCTGG + Intronic
938490609 2:131759092-131759114 CCTGTTGTGCACCTGGAACCTGG + Intronic
938502015 2:131835325-131835347 TCTCTGCAGCACCTGGGACCTGG + Intergenic
939838396 2:147157030-147157052 CCTCCTCATCACCTGCAACATGG - Intergenic
942667594 2:178336736-178336758 CTTCTTTAGCTCCTGGATCCTGG + Intronic
943063390 2:183061719-183061741 CCTCTTCAGCTCCTGGGAAATGG - Intergenic
943749206 2:191494264-191494286 ACTCTTCTGCTCATGGAACCTGG + Intergenic
944071023 2:195669108-195669130 CCTCTCCAGCAGTTGGAACTAGG + Intronic
944105207 2:196072233-196072255 ACTCTTCAGCCTCTGGAATCTGG - Intergenic
945125428 2:206504551-206504573 ACTCTTAAGTACCTGGAACATGG - Intronic
945431553 2:209771635-209771657 CCTCTTCAGCCCCCGGAATTCGG - Intergenic
945511982 2:210714152-210714174 CTTCTTCAGCCTCTTGAACCTGG - Intergenic
946218704 2:218207621-218207643 CCTCTCCAGTAGCTGGAACCAGG + Intergenic
946344415 2:219096958-219096980 TCTCTTCTGAACCTGGAAGCTGG - Intronic
946481282 2:220059220-220059242 CCTCCTCAGCACCTGTAGCTAGG + Intergenic
946481947 2:220065865-220065887 CCTCTTCCCCACCTGGAAAGAGG - Intergenic
947593625 2:231398015-231398037 CGGCTCCAGGACCTGGAACCAGG - Exonic
947833913 2:233161804-233161826 CTTCATCGGCACCTGGAACATGG + Exonic
947839366 2:233197889-233197911 CCTCGTAAGCACCTGGCCCCAGG - Intronic
1169453108 20:5729047-5729069 CCTCTTAAGTAGCTGGCACCTGG + Intergenic
1170393008 20:15895552-15895574 CTTCTTCAGCCTCTCGAACCTGG - Intronic
1170525010 20:17228142-17228164 CCTCTCCAGCTCCTGTAGCCGGG - Intronic
1171128276 20:22623874-22623896 ACTGTTCTGCACCTGGAATCTGG + Intergenic
1171308671 20:24127875-24127897 CTTCTTCAGCCTCTTGAACCTGG - Intergenic
1171725200 20:28611442-28611464 CCTGTGCAGCCCATGGAACCAGG + Intergenic
1171752871 20:29071644-29071666 CCTGTACAGCCCATGGAACCAGG - Intergenic
1171789393 20:29505922-29505944 CCTGTACAGCCCATGGAACCAGG + Intergenic
1171878727 20:30600859-30600881 CCTCTGCAGCATCTGGCACTGGG + Intergenic
1172483500 20:35285305-35285327 TCTCTCCAGCACCTGCAGCCTGG - Intergenic
1173469662 20:43313186-43313208 CTTCTTCAGCCTCTTGAACCTGG + Intergenic
1173500542 20:43549640-43549662 CCACATCAGCACCTGGACACGGG - Intronic
1174490023 20:50886327-50886349 CCATGTCAGCACCTGAAACCTGG + Intergenic
1174860860 20:54089643-54089665 CTTCTTCAGCCTCTTGAACCTGG + Intergenic
1176196093 20:63836834-63836856 CTGCTTCACCACCTGGCACCCGG + Intergenic
1180409665 22:12593703-12593725 CCTGTACAGCCCATGGAACCAGG - Intergenic
1181271410 22:21660974-21660996 CCTCATCACCCCCTGGCACCTGG + Intronic
1183188878 22:36308807-36308829 CCTATTCTCCACCTAGAACCAGG - Intronic
1183383154 22:37500519-37500541 CCTTCTCAGCTCCTGGAGCCTGG - Intronic
1183391975 22:37550579-37550601 CCAGTTCAGCACCTGGCAGCAGG - Intergenic
1183549679 22:38474557-38474579 CGTCTTCACCACCAGGTACCTGG + Exonic
1184130486 22:42514179-42514201 CCTCTCCAGCACCCGCAAGCTGG + Exonic
1184140662 22:42576001-42576023 CCTCTCCAGCACCCGCAAGCTGG + Intergenic
1184510382 22:44929938-44929960 CCCCTGCAGCACCTGCAACCAGG + Intronic
1184513614 22:44946918-44946940 ACTCTGCAGGACCTGGAAACGGG + Intronic
1184646140 22:45896503-45896525 CCTCTCCAGCCCCAGGGACCTGG - Intergenic
1185122466 22:48980479-48980501 CCACCTGAGCACCTGGGACCTGG + Intergenic
951812315 3:26714425-26714447 CCTCTCCAGCAACTTGCACCAGG - Intergenic
953634710 3:44652954-44652976 CTTCTTCAGCCTCTTGAACCTGG - Intronic
953899872 3:46833927-46833949 CCGCTTCAGGTCCTGGAGCCGGG + Exonic
954355763 3:50083089-50083111 CTTCTTCAGCCTCTTGAACCTGG + Intronic
954421701 3:50422259-50422281 CCAGTTCAGAACTTGGAACCTGG + Intronic
955583730 3:60453655-60453677 TCTCTTCACCACCTGGAAAATGG + Intronic
955643268 3:61109603-61109625 CTTCTTCAGCCTCTTGAACCTGG + Intronic
955941188 3:64148447-64148469 CATCTCCAGGACCTGGAACATGG + Intronic
955971064 3:64439040-64439062 CCTCTGCAGCAACTGCATCCCGG + Intronic
956343184 3:68249040-68249062 CTTCTTCAGCCTCTTGAACCTGG + Intronic
960875739 3:122293375-122293397 CTTCTTCAGCCTCTTGAACCTGG + Intergenic
961358664 3:126354370-126354392 CCCCTTCAGGGCCTGGCACCCGG + Intronic
961554468 3:127688678-127688700 CCTCCTCAGCATAGGGAACCCGG - Intergenic
961622999 3:128239456-128239478 CCTCTTGACCTCCTGGAGCCTGG - Intronic
961799957 3:129439907-129439929 CCTCTTCAGCTCACGGCACCGGG + Exonic
964530438 3:157661918-157661940 CCACTGCAGCATCTGGAACTTGG - Intronic
964879174 3:161404748-161404770 CCACTGCTGAACCTGGAACCAGG + Intergenic
965062341 3:163800523-163800545 TCTCTTCAGCCTCTTGAACCTGG + Intergenic
966463311 3:180202143-180202165 CTTCTTTAGCATCTTGAACCAGG - Intergenic
966902532 3:184497179-184497201 TCTCTCAAGCAGCTGGAACCAGG - Intronic
967782114 3:193451122-193451144 CTTCTTCAGCCTCTTGAACCTGG + Intronic
967893608 3:194380687-194380709 CCTCTTCATCACCTGTCATCAGG - Intergenic
969378177 4:6776973-6776995 CCTCCTCAGCTCCTAGAACGGGG - Intergenic
970737741 4:19194385-19194407 CCTGTACACCACCTGGAACCTGG - Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
973093814 4:46171901-46171923 CCTACACAGTACCTGGAACCTGG - Intergenic
973951965 4:56025022-56025044 CCTCCCCAGCAGCTGGTACCTGG - Intronic
974497852 4:62656802-62656824 CCTGTGGAGTACCTGGAACCAGG - Intergenic
978605733 4:110476839-110476861 CCTCTTCAGCTCCGGGAGCCGGG - Exonic
985613098 5:901394-901416 CAACCTCATCACCTGGAACCGGG + Exonic
985672123 5:1212502-1212524 CCTCTGGAGCACCTGCAGCCTGG - Intronic
986168158 5:5293527-5293549 CCGCCTCAGCTCCTGAAACCCGG - Intronic
987251726 5:16107727-16107749 CCTCATCTGCTCCTGGAGCCTGG - Intronic
987299077 5:16580913-16580935 CATGTTCAGGACCTGGATCCAGG + Intronic
988349682 5:30086044-30086066 CCTCATGATCACCTGGGACCTGG + Intergenic
988941748 5:36153986-36154008 TATCTCCAGCACCTGGAACACGG - Intronic
988987692 5:36636871-36636893 CCTCTCCAGCCCCTGGAAAGTGG + Intronic
989570365 5:42940653-42940675 CCTTTACAGCACCTGGAACATGG + Intergenic
990193778 5:53290265-53290287 CCTCGTCTGCTTCTGGAACCTGG - Intergenic
993968662 5:94389383-94389405 TCTCTTCAGCCTCTTGAACCTGG + Intronic
996385083 5:122902324-122902346 CTTCTTCAGCCTCTTGAACCTGG - Intronic
996536774 5:124585703-124585725 CCTCATCAGCTTCTGGAGCCTGG + Intergenic
996827312 5:127699972-127699994 GCTCATCAGCAACTGGATCCTGG - Intergenic
997265890 5:132495320-132495342 CTACTTCTGGACCTGGAACCTGG - Intergenic
997377241 5:133405952-133405974 AATCCTCAGCACCTGGAATCGGG - Intronic
997691172 5:135828499-135828521 CCTCCTCAGCACCTGAGAGCAGG - Intergenic
998204181 5:140147432-140147454 TTTCTTTAGCATCTGGAACCTGG + Intergenic
998502673 5:142646874-142646896 CCACTTCAGAATCTGGGACCTGG + Intronic
999283742 5:150381784-150381806 GCTTTTCAGCAGCTGGAACCTGG - Intronic
999287529 5:150403029-150403051 CCTCTGAAGCACATGGGACCAGG - Intronic
1000036798 5:157455022-157455044 CTTCTTCAGCCCCTTGAACCTGG - Intronic
1001929045 5:175659630-175659652 CCTGTTCAGAGACTGGAACCAGG + Intronic
1002088703 5:176792210-176792232 CGTCTTCTACACCTGGAACAGGG + Intergenic
1003637084 6:7842241-7842263 CCTCTTGTGCAGCTGCAACCAGG + Intronic
1005719840 6:28590247-28590269 CCTCTTCAGCTCCTAGTACCAGG + Intronic
1005814463 6:29539484-29539506 CTTCTCCAGCTCCTGGAACAGGG + Intergenic
1006472869 6:34237939-34237961 CCTCTTCAGCCCCAGGGGCCGGG + Intronic
1008587775 6:52964828-52964850 CCTGGTCAGTACCTGGAACATGG - Intergenic
1013659885 6:112284350-112284372 CTTCTTCAGCCTCTTGAACCTGG + Intergenic
1014604468 6:123454887-123454909 CCTTTTTGGCACCAGGAACCTGG - Intronic
1014743516 6:125172754-125172776 ACTCTCCAGCACCTAGAACAGGG + Intronic
1015746357 6:136514003-136514025 CTTCTTCAGCCTCTTGAACCTGG + Intronic
1016314504 6:142771332-142771354 CCTCTTCAGCAAGAGGACCCAGG - Exonic
1016625831 6:146167060-146167082 CCTCTGCAACCCCTGGAAACAGG + Intronic
1019347519 7:538213-538235 CCTCTGCAGCCCCTGGACCAGGG - Intergenic
1022061020 7:26794960-26794982 CTTCTTCAGCCTCTTGAACCTGG + Intronic
1022826215 7:34017017-34017039 CCTCTTTAGAAACTGGAACCAGG + Intronic
1023116144 7:36864563-36864585 GCTCTTCAGCACTTGGAGCGGGG + Intronic
1023274426 7:38502763-38502785 CTTCTTCGGCCCCTTGAACCTGG + Intronic
1023497247 7:40810993-40811015 CCTATTCAATACCTGGAACTGGG - Intronic
1024200467 7:47101364-47101386 CCTTCCCAGCACCAGGAACCAGG + Intergenic
1024539948 7:50468097-50468119 CCTCCCCAGCACCTGCAACATGG - Intronic
1026828806 7:73599588-73599610 CCTCTTCAGCAGTGGGACCCTGG - Exonic
1028718737 7:94004486-94004508 CCCCGTCCGCTCCTGGAACCGGG - Intergenic
1029732726 7:102448358-102448380 CCTCTTCTCCAGCTGTAACCTGG + Exonic
1031131695 7:117840402-117840424 CCTCTCCAGTAGCTGGGACCAGG - Intronic
1032755651 7:134888499-134888521 CCTCTCCAGCCCCAGGCACCAGG + Intronic
1033314770 7:140288057-140288079 GCTGTTCAGCACCTGGTTCCAGG - Intergenic
1033342610 7:140503804-140503826 GGCCTTCACCACCTGGAACCAGG + Intergenic
1033423277 7:141221218-141221240 CCTTTTCAGCACCTGGAACTGGG - Intronic
1035706211 8:1677326-1677348 CATCTTCTGCACCTGGGAGCCGG + Intronic
1036605875 8:10305330-10305352 CTGCTTCAGCACCTTGAAGCAGG - Intronic
1039558101 8:38491343-38491365 CCTCATCAGCACCTTGATCTTGG - Intergenic
1039862630 8:41471892-41471914 CTTCTTCAGCCTCTTGAACCTGG + Intergenic
1039952346 8:42181977-42181999 GTTCTTCAGCACGTGGCACCAGG + Exonic
1047243087 8:123111498-123111520 CCTTTTCAGTACATAGAACCAGG + Intronic
1049446067 8:142632240-142632262 CTCCTTCAGCACCTGGGACAGGG + Intergenic
1049681478 8:143920455-143920477 CTTCTTCAGGGCCTGGAACAGGG + Exonic
1050313708 9:4379272-4379294 CTTCTTCAGCCTCTTGAACCTGG + Intergenic
1051835603 9:21334679-21334701 CATCTCCATCACCTGGTACCAGG + Exonic
1052075999 9:24141411-24141433 CTTCTTCAGCCTCTTGAACCTGG - Intergenic
1052758497 9:32566387-32566409 CCTCTTCTGGACCTGGAACCTGG - Intronic
1053536400 9:38930813-38930835 CCTCTTCTAAACCTGGAACCTGG - Intergenic
1053724392 9:40983733-40983755 CCTGTACAGCCCATGGAACCAGG - Intergenic
1054629734 9:67433135-67433157 CCTCTTCTAAACCTGGAACCTGG + Intergenic
1055335510 9:75229486-75229508 CCTCTTCAGCCTCTTGAGCCTGG + Intergenic
1055728510 9:79257423-79257445 CCTCTTCAGCACCTGCCTCCTGG - Intergenic
1056553461 9:87670582-87670604 CACCTGCAGCACCTGGCACCTGG + Intronic
1057265736 9:93616537-93616559 CCTCTGCAGCATCTGGCACAGGG - Intronic
1058100485 9:100913993-100914015 TCTCTTCAGCCTCTTGAACCTGG + Intergenic
1058373244 9:104294233-104294255 CCTCTCAAGCACATGGAACGGGG + Intergenic
1059123245 9:111661428-111661450 GCTCCTCAGCGCCTGAAACCTGG - Exonic
1060516659 9:124270226-124270248 CATCCTCAGCACCTGGAGCGGGG + Intronic
1060727494 9:126016149-126016171 CTTCTTCAGCCTCTAGAACCTGG + Intergenic
1061791913 9:133063506-133063528 GCCCTTCCCCACCTGGAACCTGG + Intronic
1062497432 9:136838354-136838376 TCTCTGCAGCACCTGGATCCTGG - Intronic
1203792122 EBV:157398-157420 CCTCTTCTGCTCCAGGCACCAGG + Intergenic
1203450403 Un_GL000219v1:108236-108258 CCTGTACAGCCCATGGAACCAGG + Intergenic
1185612079 X:1398769-1398791 CCTCTCCAGCCCCTGCCACCCGG - Intergenic
1187497382 X:19807172-19807194 CCACTTCAGGACCTGGTACAGGG - Intronic
1188649753 X:32617471-32617493 CCTCTTCAGCAAATGCTACCAGG + Intronic
1190591222 X:52003731-52003753 CCCCATCAGCTCCTGGAATCAGG + Intergenic
1190944005 X:55073088-55073110 CCCCAGTAGCACCTGGAACCCGG - Intergenic
1194163392 X:90483601-90483623 GCTCTTCTGCTCGTGGAACCTGG + Intergenic
1194207568 X:91029999-91030021 CCCATTCATCACCTGGAAACAGG + Intergenic
1196364644 X:114910997-114911019 CTTCTTCCATACCTGGAACCAGG + Intergenic
1198422204 X:136479426-136479448 CTTCTTCAGCCTCTGGAGCCTGG - Intergenic
1198780220 X:140227207-140227229 CTTCTTCAGCCTCTTGAACCCGG - Intergenic
1200553365 Y:4605045-4605067 CCCGTTCATCACCTGGAAACAGG + Intergenic