ID: 900674837

View in Genome Browser
Species Human (GRCh38)
Location 1:3878690-3878712
Sequence CAGCGAGGCCGGCCCGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 330}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900674837_900674841 -10 Left 900674837 1:3878690-3878712 CCTCTCCCGGGCCGGCCTCGCTG 0: 1
1: 0
2: 4
3: 29
4: 330
Right 900674841 1:3878703-3878725 GGCCTCGCTGTGACCCTCTGCGG 0: 1
1: 0
2: 3
3: 12
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900674837 Original CRISPR CAGCGAGGCCGGCCCGGGAG AGG (reversed) Intronic
900077866 1:832628-832650 CAGAGAGGCTGGCCCTGGGGTGG + Intergenic
900109412 1:999248-999270 CAGCGAGGCCGGGCGGCGGGAGG + Exonic
900110114 1:1001732-1001754 CTGCGAGGCCGGAGCGGGGGTGG + Intergenic
900393518 1:2443893-2443915 CAGCGAGGGCGGCGGGGGCGGGG - Intronic
900474582 1:2870164-2870186 CAGCGAGGATGTCCCAGGAGGGG - Intergenic
900663090 1:3795837-3795859 CAGCGGGGGCTGCCCGGGCGGGG - Intronic
900674837 1:3878690-3878712 CAGCGAGGCCGGCCCGGGAGAGG - Intronic
901016703 1:6235991-6236013 CGCCGATGCCGGCCCGGGAAGGG + Intergenic
901199788 1:7460191-7460213 CAGAGGGGCCGCCACGGGAGAGG - Intronic
901630963 1:10647968-10647990 CACGGAGGCCGGGCTGGGAGCGG + Exonic
902412055 1:16217497-16217519 GAGGGAGGCCGGCCTGGGAGAGG - Intergenic
902778353 1:18689160-18689182 CAGCGAGGCCAGCCCGTGGATGG - Intronic
903173947 1:21569750-21569772 CAGCTAGGCCAGGCCTGGAGAGG - Intronic
903350014 1:22711490-22711512 CACCGCGGCCGGCCGGGGTGGGG + Intronic
903738237 1:25543803-25543825 CAGCCGGGCCGGGCCGGGATCGG + Intronic
903868092 1:26412626-26412648 CACCCAGGCCGGGCAGGGAGGGG + Intronic
904160456 1:28518730-28518752 GAGGGAGCCCTGCCCGGGAGAGG + Intronic
904379876 1:30103426-30103448 CAGTGGGGCCGCCCCAGGAGGGG - Intergenic
905037790 1:34929265-34929287 CAGCCAGGCCGGGGCAGGAGCGG + Intronic
905653546 1:39671981-39672003 CCGCGAGCCCGGGCCAGGAGCGG - Exonic
905874576 1:41423823-41423845 CTGCGAGGGTGGCCTGGGAGGGG - Intergenic
905996044 1:42381100-42381122 GAGCGAGGCGGGCCCGGGGAGGG + Intronic
906279366 1:44542938-44542960 CAGTGCGGCTGGCCCTGGAGCGG - Intronic
908131871 1:61082466-61082488 CGGCCGGGCCGGCGCGGGAGCGG + Intronic
911449443 1:98045540-98045562 CAGCGCGGCCGGCCGGGGGTGGG + Intergenic
912480440 1:109978522-109978544 TAGAGAGGCAGGCCTGGGAGAGG + Intergenic
913450196 1:118987872-118987894 CACCGGGCCCGGCCCGGGAGAGG + Intronic
915475141 1:156148765-156148787 CAGAGAGGCCAGCCTGGAAGGGG + Intronic
917904008 1:179571867-179571889 CACCGAGCCAGGCACGGGAGAGG + Intronic
918064255 1:181089064-181089086 CAGCGGGACCGGCCAGGTAGAGG - Exonic
920399498 1:205668316-205668338 CAGGGAAGGCGGCCCTGGAGCGG - Intronic
920541990 1:206785626-206785648 CAGAGAGGGCAGCCAGGGAGAGG + Intergenic
922734360 1:227971475-227971497 CTGGGAGGCAGGACCGGGAGAGG - Intergenic
922734649 1:227972607-227972629 CTGGGAGGCAGGACCGGGAGAGG - Intergenic
924343556 1:243055179-243055201 CTGGGAGGCAGGGCCGGGAGAGG + Intergenic
1062849616 10:733640-733662 CAGCGAGGTGGGACAGGGAGGGG + Intergenic
1062932546 10:1362786-1362808 CAGCGAGGCCGGGTGGGGAGCGG - Intronic
1064048848 10:12042914-12042936 CAGCGCGGCCGGGCTGAGAGTGG + Intronic
1065099568 10:22320740-22320762 CCGCGGGGCCGGCCGGGGGGCGG + Intronic
1066732561 10:38448922-38448944 CTGGGAGGCAGGGCCGGGAGAGG - Intergenic
1067026481 10:42847500-42847522 CAGGGCGGCCGGCCTGGCAGGGG - Intergenic
1067497824 10:46775114-46775136 CAGGGAGGGCGGCCCGAGCGCGG - Intergenic
1067596825 10:47565300-47565322 CAGGGAGGGCGGCCCGAGCGCGG + Intergenic
1069719735 10:70541761-70541783 CAGCAAGGCCGGGCAGGGAGGGG - Intronic
1070162584 10:73874716-73874738 CAGCGAGGGCGGCTCCGGGGCGG - Intergenic
1072757590 10:98030936-98030958 CAGCGAGGCCTGGCGAGGAGGGG + Intergenic
1076035521 10:127196192-127196214 CAGCAGGGCCGGGCCGGCAGCGG - Intronic
1076320764 10:129579935-129579957 CACCCAGGCCTGCCCGTGAGAGG + Intronic
1076558077 10:131343032-131343054 CAGCGAGGCAGCCTGGGGAGCGG - Intergenic
1076657852 10:132036587-132036609 CCGCGGGGACCGCCCGGGAGTGG + Intergenic
1076797362 10:132804843-132804865 CAGAGAGGACGGCCAGGGCGTGG + Intergenic
1076827097 10:132974565-132974587 CAACGCGCCCTGCCCGGGAGAGG + Intergenic
1076873867 10:133206516-133206538 CAGCGAGGCCAGCCCCGGCCTGG - Intronic
1076947827 10:133664500-133664522 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
1076948817 10:133667810-133667832 CAGCCAGGCCGCGCCGGCAGAGG + Exonic
1076949801 10:133671109-133671131 CAGCCAGGCCGCGCCGGCAGAGG + Intronic
1076950785 10:133674408-133674430 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
1076951775 10:133677718-133677740 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
1076952764 10:133681028-133681050 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
1076953748 10:133684327-133684349 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
1076954732 10:133740679-133740701 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
1076955721 10:133743989-133744011 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
1076956711 10:133747299-133747321 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
1076957698 10:133750608-133750630 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
1076958683 10:133753907-133753929 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
1076959672 10:133757217-133757239 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
1076960656 10:133760516-133760538 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
1077411287 11:2405080-2405102 CAGCAAGGCAGGCCCAGGAAGGG + Intronic
1078547454 11:12256537-12256559 CAACAAGGTGGGCCCGGGAGGGG - Intronic
1081871172 11:46383151-46383173 CAGCGAGGCCAGCAGGGCAGGGG + Intronic
1082233679 11:49798274-49798296 CAGGGAGGCTGGCCGGGGCGGGG + Intergenic
1083332520 11:61905519-61905541 CAGCGGGGCCAGCCCGGGCTGGG + Intronic
1083799996 11:65041207-65041229 ACGCGAGGCCGGCCGGGGGGTGG - Exonic
1083945404 11:65920212-65920234 AAGCAGGGCAGGCCCGGGAGCGG + Intronic
1084494736 11:69497378-69497400 CACAGAGGCCGGCCCGGCAAAGG + Intergenic
1085395654 11:76205975-76205997 CAGAGCGGCCAGCCCAGGAGCGG - Intronic
1086850298 11:91800024-91800046 CAGCCTGGCCAGCCGGGGAGAGG - Intergenic
1087505907 11:99020836-99020858 CAGCGCGGGCGGCCGGGGAGGGG + Intergenic
1088522075 11:110711676-110711698 CGGCGATGTCTGCCCGGGAGCGG - Intronic
1089243015 11:117098091-117098113 GAGCGTGGCGGGGCCGGGAGAGG - Intronic
1089529436 11:119116802-119116824 GAGCAGGGCCGGCCCGGGATGGG + Exonic
1089787781 11:120920454-120920476 AACCCAGGCCGGCCTGGGAGAGG - Intronic
1090226309 11:125074152-125074174 CAGGGAGGACTGCCAGGGAGAGG - Intronic
1091266557 11:134276363-134276385 CAGGGAGGCCTGCGCGGGAGAGG - Intronic
1092140597 12:6180711-6180733 CAGCCAGGCCTGCCCCGCAGTGG - Intergenic
1092256043 12:6927532-6927554 CCGCGGGCCCGGCGCGGGAGAGG - Intronic
1093175680 12:15911259-15911281 CCGCGACTCCGCCCCGGGAGCGG + Exonic
1096668229 12:53181029-53181051 CCGCGTCCCCGGCCCGGGAGAGG + Intronic
1096968456 12:55647167-55647189 CTGCGAGGGCTGCCCAGGAGGGG - Intergenic
1097130300 12:56806461-56806483 AAGGGAGGCCGGCCCTGGACCGG + Intergenic
1097246920 12:57611850-57611872 CTGCATGGCCGGCCCGGGTGGGG + Intronic
1101371849 12:104137940-104137962 CAGCGGGCCGGGCCGGGGAGCGG - Intronic
1101640162 12:106581742-106581764 CAGCGCGGCCGACCCGCGAACGG + Intronic
1101948228 12:109154550-109154572 GAGGTAGGCCGGCCCGGGGGCGG + Intronic
1103716846 12:122950024-122950046 CAGGGATGCCAGCCCTGGAGTGG - Intronic
1103762805 12:123263814-123263836 CACCGTGCCCGGCCTGGGAGAGG - Intronic
1104845752 12:131845967-131845989 CACCGGGGCCGACCAGGGAGAGG - Intronic
1104977518 12:132558865-132558887 CAGGGAGGCCGGCTCTGGTGCGG - Intronic
1105405319 13:20128176-20128198 CAGCGGGGCCGGCCAGGGCCCGG + Intergenic
1105661175 13:22497022-22497044 CAGCGCGGCCTGGCAGGGAGAGG + Intergenic
1106776672 13:33016325-33016347 CAGCGGAGCCCGCCGGGGAGCGG + Intergenic
1108541507 13:51451747-51451769 CTGCCGGGCCGGGCCGGGAGGGG + Intronic
1110860539 13:80341146-80341168 CAGCGAGGCCGAGGCGGGGGCGG + Intergenic
1113373724 13:109744945-109744967 CAGAGAGCCAGGCCAGGGAGTGG - Intergenic
1113574913 13:111388506-111388528 GAGCGAGGCAGGCCCAGGACTGG - Intergenic
1113788108 13:113013460-113013482 CAGCCAGCACGGCCCAGGAGGGG + Intronic
1113802297 13:113092927-113092949 CAGCGAGGCCGGCCTGTGCGGGG - Intronic
1114484121 14:23053037-23053059 CAGGGATGCTGGCCGGGGAGGGG + Intronic
1114485192 14:23057742-23057764 CTGCGGGCCCGGTCCGGGAGGGG - Intergenic
1114646999 14:24261435-24261457 CACCGAGGCAGGCCCTGAAGAGG + Intronic
1115576264 14:34714746-34714768 CAGAAGGGCCGGCCTGGGAGCGG - Intronic
1115754560 14:36518862-36518884 CAGGGAGGGCGGCCCGGCAGCGG - Intronic
1117647372 14:57866021-57866043 CGGAGAGGCCGGCCCGAGTGGGG - Intronic
1118679573 14:68226320-68226342 CTCCGTGGCTGGCCCGGGAGAGG - Intronic
1119046301 14:71321033-71321055 CGGCGAGGCCGGCCCGAGGCGGG - Intronic
1119854198 14:77887122-77887144 CAGGGAGGCCGTCCCCAGAGGGG - Exonic
1120139430 14:80911928-80911950 CACCGTGCCCTGCCCGGGAGTGG - Intronic
1121183611 14:91947778-91947800 CAGCGCGGCCCGGCGGGGAGGGG + Exonic
1121629494 14:95412129-95412151 CAGCTGGGCCGGGCAGGGAGAGG - Intronic
1122359893 14:101152953-101152975 GAGCGAGGACGGCCAGGGTGTGG - Intergenic
1122444938 14:101761564-101761586 CAGCGGGGCGGGGCCGGGCGCGG + Intergenic
1122627342 14:103091261-103091283 CAGGGAGGCCGGCACGTGGGTGG + Intergenic
1122790254 14:104181385-104181407 CATCCAGGCTGCCCCGGGAGGGG - Intergenic
1122887594 14:104717297-104717319 CAGCGCGCCCTGCCCGGGGGGGG - Intronic
1122974983 14:105167413-105167435 CACCGCGGCCTGCCCGGGACCGG + Intronic
1123081558 14:105697696-105697718 CAGCGTGGCTGGGCCGGCAGGGG - Intergenic
1202852591 14_GL000225v1_random:30727-30749 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
1202860671 14_GL000225v1_random:79379-79401 CAGCCAGGCCGCGCCGGCAGAGG - Intergenic
1202921983 14_KI270723v1_random:35327-35349 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
1202922945 14_KI270724v1_random:2286-2308 CAGCCAGGCCGCGCCGGCAGAGG - Intergenic
1124401132 15:29348492-29348514 CAGGAAGACCGGCTCGGGAGTGG + Intronic
1124630844 15:31336218-31336240 CAACGAGGCCAGACCGGGAAAGG - Intronic
1124905083 15:33860812-33860834 CAGAGTGGCCGGCCTGGCAGGGG - Intronic
1125589330 15:40844587-40844609 CAGGGATGCCGGCCGGGGCGAGG - Exonic
1126109430 15:45166995-45167017 CAGCGCGCCAGGCCGGGGAGCGG - Intergenic
1129233587 15:74210019-74210041 GAGCCAGGCCTGCCCAGGAGAGG + Intronic
1129440573 15:75578584-75578606 CCGCGAGCCGGGCACGGGAGCGG + Intronic
1132345624 15:101107028-101107050 CAGCGAGGCAGGACGGGAAGAGG - Intergenic
1132616404 16:843006-843028 CAATGGGGCCGGCCCTGGAGGGG + Intergenic
1132648787 16:1011113-1011135 CAGGGAGGCTTGCCCGGGCGGGG - Intergenic
1132698438 16:1212209-1212231 CGGGGAGGCCGGGGCGGGAGTGG - Intronic
1132711861 16:1272429-1272451 CGGAGAGGCTGGCCCGGGAGGGG - Intergenic
1132724964 16:1334448-1334470 CCGCGAGGCGGGGCAGGGAGGGG + Intronic
1132728998 16:1351551-1351573 CGGCGAGGGCGGCCCGGGCCCGG - Exonic
1132807806 16:1783096-1783118 CAGCGAGGCCGCCCCGGGAAGGG - Intronic
1137555025 16:49465059-49465081 CAGCGAGGTGGGCGCGGGCGAGG + Intergenic
1138110176 16:54317599-54317621 CAGGGAGGCCAGCTGGGGAGCGG + Intergenic
1138591243 16:58000696-58000718 CAGGGAGGCGGGGCCGGGGGAGG + Intronic
1139343875 16:66289580-66289602 CAGACAGGCAGGCCTGGGAGTGG - Intergenic
1139482017 16:67236018-67236040 CAGCCTGGCCTGCCCAGGAGGGG + Intronic
1139590583 16:67930835-67930857 CAGGGAGGCCAGCGCGAGAGGGG + Intronic
1139776254 16:69318794-69318816 GAGGGAGGCCGGCCCGGGCCCGG - Intronic
1142038908 16:87880307-87880329 CAGGGAGGACAGCCCAGGAGAGG + Intergenic
1142473589 17:177164-177186 CAGCCAGGCCGGCACTGCAGGGG + Intronic
1142646151 17:1315170-1315192 CACCGTGCCCGGCCGGGGAGAGG - Intergenic
1143723981 17:8832958-8832980 CAGCGAGGCCAGCCCGAGCCGGG - Exonic
1144581176 17:16460437-16460459 GAGAGAGGCAGGCCAGGGAGTGG - Intronic
1145765530 17:27456301-27456323 CAGGGAGGGCGGCGCGGGCGCGG + Intergenic
1147189393 17:38730127-38730149 CCGCCAGGCCCGCCCGGCAGGGG + Intergenic
1147671853 17:42180988-42181010 CAGCGCGGCCGGGCCGGAGGGGG + Exonic
1148090263 17:45019100-45019122 CGGCGCGGGCGGCCCGGGCGGGG + Intergenic
1148560609 17:48603933-48603955 CGCCGAGGCCGGCGAGGGAGAGG - Intronic
1148765617 17:50036843-50036865 CCTCCAGGCCAGCCCGGGAGGGG - Intergenic
1149614444 17:57987282-57987304 CAGCCGGGCCGGCCCGGGGCAGG - Intronic
1150692550 17:67378210-67378232 GGGCGAGGCCGGGCCGGGCGCGG - Intronic
1150765037 17:67995773-67995795 CTGCGAGCCCGGCCCGGGCACGG + Intergenic
1151954375 17:77373235-77373257 CAGGGAGGCCGGTGCGGGTGCGG + Intronic
1152535583 17:80948800-80948822 CAGGGAGGTCGGCCTGGGTGTGG - Intronic
1152555500 17:81051064-81051086 CAGGGAGGCCACACCGGGAGTGG - Intronic
1153484477 18:5582881-5582903 CAGTGAGGCATGCCCGGGAGTGG + Intronic
1153886976 18:9475755-9475777 GCGCGAGGCCGGCGCGGGAGAGG - Intronic
1153911179 18:9708044-9708066 CGGCCAGGCGGGGCCGGGAGGGG + Intergenic
1156600420 18:38598966-38598988 CAGCGGGGCTAGCCCAGGAGTGG + Intergenic
1157117238 18:44873501-44873523 CAGGGAGGTCGTCCCGGCAGAGG + Intronic
1159040650 18:63320309-63320331 CGCCGCGGCAGGCCCGGGAGTGG + Intergenic
1160706563 19:532621-532643 GAGCGAGGCCAGCCTGGGGGTGG + Intronic
1160972311 19:1775085-1775107 CCGTGTGGCCGGCCGGGGAGAGG - Intronic
1161123057 19:2540694-2540716 CAGCGAGGCCCGCCGGGCAGCGG + Intronic
1161224390 19:3136362-3136384 CAGCCCAGCCGGCCCTGGAGAGG - Exonic
1161490513 19:4558416-4558438 CAGCAGGGCCGGGCGGGGAGGGG + Exonic
1162445093 19:10718100-10718122 CCGTGAGGCCGAGCCGGGAGCGG + Intronic
1163115315 19:15185432-15185454 CAGGGAGGTGGGCCAGGGAGAGG + Intronic
1163823116 19:19507597-19507619 CAGCCAGGCCAGGCTGGGAGAGG - Exonic
1165146862 19:33736377-33736399 CAGGGAGGCAGGCCTGGGAGCGG - Intronic
1165157187 19:33795945-33795967 CTGGGAGGGCGGCCAGGGAGCGG + Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165741251 19:38206505-38206527 CAGCGGGGCAGGCCCGGGAGCGG - Exonic
1165956952 19:39507076-39507098 CCGCGAAGCCGGCGCGGCAGCGG - Exonic
1166947246 19:46404754-46404776 CACCGAGCCTGGCACGGGAGGGG - Intergenic
1167075225 19:47244344-47244366 CCGCGCGGCCGGGCCGGGAAAGG - Intergenic
1167078012 19:47260672-47260694 CAGGGAGGCCGGGCCGGCATGGG + Exonic
1167272069 19:48511442-48511464 CAGCGAGGCCGCCGCGGGGGTGG + Intronic
1168240656 19:55087278-55087300 GAGCGAGGGCAGCCCGGGCGCGG - Intronic
927156490 2:20224288-20224310 CAGCGCGGCCGGCGCGGGAGCGG - Intronic
927510648 2:23642103-23642125 AAGTGAGGCCTGCCTGGGAGAGG - Intronic
930022244 2:47008502-47008524 CAGCAAGGTGGCCCCGGGAGTGG + Intronic
931594495 2:63926831-63926853 CACCGAGCCAGGCACGGGAGGGG - Intronic
932681424 2:73829106-73829128 GAGCGAGGCAGGCCGGGCAGGGG - Exonic
936713798 2:115162046-115162068 CGGCCAGGCCCTCCCGGGAGGGG + Intronic
938258304 2:129877644-129877666 GGGCGGGGCCGGGCCGGGAGCGG + Intergenic
938266118 2:129929517-129929539 CAGAGTGGCCGACCTGGGAGAGG + Intergenic
938796009 2:134718828-134718850 CAGCGGGGCCGGGCCGGGGGCGG + Exonic
940652335 2:156451593-156451615 CAGGGCGGCTGGCCCGGCAGAGG + Intronic
942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG + Exonic
942451052 2:176108087-176108109 CGGCGAGGGCCCCCCGGGAGAGG + Exonic
943639678 2:190344144-190344166 CAGCGAGGCCGCCCCCGGCCGGG + Intronic
946325432 2:218982399-218982421 GGGAGAGGCCGGCCCCGGAGGGG + Intronic
947593204 2:231396337-231396359 CACCGAGGCCGGGACGGGGGAGG - Intronic
947672402 2:231946619-231946641 CAGGCAGCCCGGCCCAGGAGGGG - Intergenic
948415390 2:237799030-237799052 CAGCGAGGCGGGCGGGGGACTGG + Intronic
948584644 2:239011728-239011750 CAGCGAGGCCACCTCGGGAGTGG - Intergenic
949032732 2:241804630-241804652 CACAAAGACCGGCCCGGGAGCGG + Intergenic
1170567350 20:17614662-17614684 CGGGGAGGCAGGACCGGGAGAGG - Intronic
1170856579 20:20061854-20061876 CAGCAGGGCTGGCCCAGGAGAGG + Intronic
1171252069 20:23656156-23656178 CAGAAAGGCCTCCCCGGGAGGGG + Intergenic
1171458814 20:25287035-25287057 CAGCGAGCCGGGCCTGGGTGAGG - Intronic
1172859193 20:38033917-38033939 CAGTGAGGCCCGGCAGGGAGCGG - Exonic
1174053977 20:47785624-47785646 CAGCGTGGCCGGCCGGGCTGGGG - Intronic
1174231232 20:49046854-49046876 CGGCGAGGCCTGCCCGGGCGGGG + Intronic
1174352631 20:49979416-49979438 GAGCGAGGGCGGGCCTGGAGGGG + Intergenic
1175199146 20:57266259-57266281 GAGCGCGGCCGGCCGGGGAGGGG - Exonic
1175975142 20:62707339-62707361 TAGCTGGGCGGGCCCGGGAGGGG + Intergenic
1176092574 20:63325634-63325656 CAGAGGGGCCGGCCAGGCAGGGG - Intronic
1176113478 20:63421193-63421215 CGGCAGGGCCGGCCCGGGAGGGG - Intronic
1179225024 21:39445578-39445600 CAGCGAGGCAGGCAGGGGCGAGG + Exonic
1180064629 21:45406057-45406079 CGGCGAGGCCGGCGGGGCAGCGG - Intronic
1180098647 21:45574147-45574169 CAGCGAGGAGAGCCCGGCAGAGG - Intergenic
1181818991 22:25461001-25461023 CACCGAGGCCTGTCAGGGAGTGG + Intergenic
1182393583 22:30019612-30019634 CAGCCTGGCTGGCCCTGGAGAGG + Exonic
1183841052 22:40501126-40501148 CGGGGAGGCCGGCCGGGCAGGGG + Intronic
1184037703 22:41926408-41926430 GGGCGAGGCTGGCCGGGGAGGGG + Intronic
1184094457 22:42309091-42309113 CAGAGAGGCTGGCCTGGAAGGGG + Intronic
1184298953 22:43543670-43543692 CAGAGAGGGCTGCCCTGGAGGGG + Intronic
1184557350 22:45240602-45240624 GGGCGAGGCCGGGCCGGGAGAGG - Intronic
1184679168 22:46061321-46061343 CGGCCGGGCGGGCCCGGGAGAGG - Intronic
1185258324 22:49848739-49848761 GGTCAAGGCCGGCCCGGGAGGGG - Intergenic
950060909 3:10070467-10070489 CCGGGAGGCTGGCCCGGCAGAGG - Intronic
950082662 3:10234665-10234687 CAGCGAGGCCGCTGCGGGCGAGG - Intronic
950153823 3:10707980-10708002 CAGCGGGGCCGGGCCGGGCCGGG - Intronic
950452494 3:13073167-13073189 CAGGGAGGCTGGGGCGGGAGCGG + Intergenic
950650219 3:14402551-14402573 CAGCTCGGCCGGGCCGGGGGCGG - Intergenic
951080114 3:18443889-18443911 TAGCGAGGCCGGTCCTGGAGAGG - Intronic
951803587 3:26623209-26623231 CAGCCACCCCGGCCCGGGACTGG + Exonic
953522835 3:43659401-43659423 CACCGAGCCAGGCACGGGAGGGG - Intronic
953927819 3:46991274-46991296 CAGCGAGGACGGCGCAGAAGAGG - Exonic
954423715 3:50432329-50432351 CAGCCAGGCCGGCACAGCAGGGG - Intronic
954857671 3:53660611-53660633 CAGAGGGGCAGGCCTGGGAGTGG - Intronic
957084868 3:75669590-75669612 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
960569676 3:119173463-119173485 CAGCGAGGCAGGGCAGGCAGCGG + Intronic
962839203 3:139218324-139218346 CAGCGAGGCCTGGCAGTGAGAGG + Intronic
967157838 3:186709917-186709939 CACCGCGCCCGGCCCGGGAATGG - Intergenic
968511536 4:997813-997835 CAGCGAGGGGAGCCCGGGACAGG - Intronic
968556192 4:1247663-1247685 CAGCGAGGACGGCCGCGGTGCGG + Intronic
968674388 4:1870144-1870166 CAGCGGAGGCGGCGCGGGAGAGG + Intergenic
968775448 4:2537011-2537033 CGGCAAGGCCGGCCCGGCGGCGG + Intronic
968811512 4:2801519-2801541 CAGAGACCCCGGCCTGGGAGTGG + Intronic
969416990 4:7067531-7067553 CAGCGAGGCCGAGCCGGGCCGGG - Intronic
969582028 4:8071262-8071284 CAGCCATCCCGGCCCAGGAGTGG + Intronic
969614756 4:8245885-8245907 CAGAGAGGCCGGCCCAGTAGGGG + Intergenic
972484250 4:39527253-39527275 CGGCGGGGCCAGCCTGGGAGCGG + Intronic
972608684 4:40637093-40637115 TAGCGAGGCAGGGCCGGGCGCGG + Intergenic
973573184 4:52261132-52261154 CAGGGAGGCCAGACGGGGAGGGG - Intergenic
974016896 4:56656188-56656210 CAGGGAGGGAGGCCCGGGTGGGG - Intronic
978539750 4:109804095-109804117 CAGCAAAGCAGGCCCAGGAGTGG - Intergenic
980056467 4:128083698-128083720 CAGGGTGGCTGGCCCGGCAGAGG + Intronic
981334968 4:143559578-143559600 GAGAGAGGCCGTCGCGGGAGCGG + Intergenic
982468415 4:155759179-155759201 CTGCCAGGCCGGCCGAGGAGGGG - Intronic
985446102 4:190021984-190022006 CAGCCAGGCCGCGCCGGCAGAGG - Intergenic
985451280 4:190065299-190065321 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
985453255 4:190071891-190071913 CAGCCAGGCCGCGCCGGCAGAGG + Exonic
985454245 4:190075184-190075206 CAGCCAGGCCGCGCCGGCAGAGG + Exonic
985455233 4:190078477-190078499 CAGCCAGGCCGCGCCGGCAGAGG + Exonic
985456221 4:190081777-190081799 CAGCCAGGCCGCGCCGGCAGAGG + Exonic
985457205 4:190085071-190085093 CAGCCAGGCCGCGCCGGCAGAGG + Intergenic
985458192 4:190088364-190088386 CAGCCAGGCCGCGCCGGCAGAGG + Exonic
985459181 4:190091664-190091686 CAGCCAGGCCGCGCCGGCAGAGG + Exonic
985463434 4:190174433-190174455 CAGCCAGGCCGCGCCGGCAGAGG + Exonic
986304650 5:6506318-6506340 CACTGAGGCCTGCCAGGGAGGGG + Intergenic
987758290 5:22125266-22125288 CACCGAGGCCTGTCGGGGAGTGG - Intronic
988629448 5:32913251-32913273 CAGAGAGGCAGGCTCCGGAGTGG - Intergenic
988844202 5:35112921-35112943 TAGCGAGGCTGGTCTGGGAGTGG + Intronic
990458922 5:56014752-56014774 CGGCGTGGCTGGCCCGGCAGAGG + Intergenic
996298570 5:121954208-121954230 CAGCGGCGCCGGCGCGGGCGCGG + Intergenic
997266588 5:132498335-132498357 CAGGGTGGCTGGCCTGGGAGAGG + Intergenic
997342343 5:133154469-133154491 CACCGCGCCCGGCCTGGGAGAGG - Intergenic
998139027 5:139689683-139689705 CTTTGAGGCCTGCCCGGGAGGGG + Intergenic
998406417 5:141876968-141876990 CAGCCGGTTCGGCCCGGGAGTGG + Intronic
999246543 5:150158005-150158027 CAGCCAGGCCAGCCTGGGGGAGG + Intergenic
1001494477 5:172178321-172178343 GAGAGAGGCCGGCCCATGAGTGG - Intronic
1002336716 5:178484531-178484553 CAGTGAGGCCGGGCCGGGCGTGG + Intronic
1002445624 5:179288308-179288330 CAGGGCTGCCCGCCCGGGAGTGG - Intronic
1002632682 5:180591540-180591562 GGGCGAGGCCGGCGCTGGAGGGG - Exonic
1003290853 6:4776851-4776873 CGGCGCGGCCGGGCCGGGAGGGG - Intronic
1004874798 6:19940581-19940603 CAGCAGGGGCGGCCCGGCAGAGG - Intergenic
1006088815 6:31615891-31615913 GAGAGAGGCAGGCCCGGGAAAGG - Intronic
1007161073 6:39792332-39792354 GCGCGAGGCCGGGCCTGGAGGGG + Intergenic
1007422688 6:41729085-41729107 AGGCGAGGCGGGGCCGGGAGTGG - Intronic
1007731680 6:43951363-43951385 CAGCTGGGCCCGCCAGGGAGAGG - Intergenic
1017297761 6:152818423-152818445 CACCGAGGCCTGTCAGGGAGTGG + Intergenic
1018890509 6:167978254-167978276 CAGCGCGGGCGGCCGGGGCGAGG + Intergenic
1019576753 7:1741315-1741337 CAGCGAGGCCAGGCTGGGGGTGG + Intronic
1019735239 7:2647133-2647155 CTGCGATGCCGGCGCTGGAGAGG - Exonic
1019886804 7:3912609-3912631 CAGCCATGCCTGCCTGGGAGAGG - Intronic
1020262136 7:6536507-6536529 CAGGCGGGCTGGCCCGGGAGGGG + Intronic
1023400975 7:39792904-39792926 CTGGGAGGCAGGGCCGGGAGAGG - Intergenic
1024471726 7:49773665-49773687 GAGCGCGGCCGGCGCGCGAGTGG - Exonic
1024511430 7:50207664-50207686 CAGCGATGCCAGCCGTGGAGTGG - Intergenic
1024648657 7:51387873-51387895 CTGGGAGGCAGGGCCGGGAGAGG + Intergenic
1026962532 7:74417797-74417819 GAGAGAGGCCGGCCAGGGCGTGG + Intergenic
1028395513 7:90364832-90364854 CAGTGAGGCTGGCGGGGGAGGGG - Intronic
1029525055 7:101089070-101089092 CCGCGTGGCTGGCCTGGGAGAGG - Exonic
1029543777 7:101199803-101199825 CACCGCGCCCGGCCTGGGAGTGG - Intronic
1029607154 7:101605999-101606021 CAGCCACGCTGTCCCGGGAGGGG + Intergenic
1030215954 7:107044478-107044500 CTGCGCGCCCGGGCCGGGAGAGG - Intergenic
1030270016 7:107660898-107660920 CCTCGAGGCCTCCCCGGGAGTGG - Intronic
1030464984 7:109889783-109889805 CACCGAGGCCTGTCAGGGAGTGG + Intergenic
1031253104 7:119413436-119413458 CAGCGGGGTGGGCCCGGGGGAGG + Intergenic
1033989074 7:147262512-147262534 CAGGGAGGCCGGGCCTGGCGCGG + Intronic
1034306678 7:150049180-150049202 AAGCCAGGCCGGGCCTGGAGCGG - Intergenic
1034425039 7:151009735-151009757 CAACAAGGCCAGCCCGGCAGTGG - Intronic
1034800167 7:154051463-154051485 AAGCCAGGCCGGGCCTGGAGCGG + Intronic
1035118343 7:156543944-156543966 CAGCGAGGCCTGCCCACGGGTGG + Intergenic
1037444893 8:18955674-18955696 CAGAGAGGCTGTCCCAGGAGTGG + Intronic
1037469416 8:19192976-19192998 CAGGGAAGCTGGCCCAGGAGAGG + Intergenic
1037859045 8:22391856-22391878 CAGGGAGCCCTGGCCGGGAGCGG - Intronic
1038613057 8:29071543-29071565 GAACGTGGCCGGCCTGGGAGGGG - Intronic
1038930305 8:32186820-32186842 CAGAGAGGCTGGGCTGGGAGAGG - Intronic
1039843218 8:41308383-41308405 CGGCGGGGCTGGCCCGGGAGCGG - Intronic
1039947231 8:42140434-42140456 CGGCGGGGCCGGCGGGGGAGGGG - Intergenic
1041796491 8:61752882-61752904 CAGGGAGGCTGGCCGGGCAGGGG + Intergenic
1048300530 8:133247980-133248002 CAGCCTGGCAGGCCTGGGAGTGG - Intronic
1049082936 8:140457244-140457266 CGCCGCGGACGGCCCGGGAGGGG + Intronic
1049109587 8:140635079-140635101 CAGCGAGGCCGGGCCAAGCGGGG + Intronic
1049411362 8:142475370-142475392 CGCCGAGGCCGGCCCGGGTGGGG - Intronic
1049665438 8:143840793-143840815 CGCCGAGGCGGGCCCGGGAACGG - Exonic
1049735259 8:144201723-144201745 CAGCAGGGCCGGCCGGGCAGTGG + Intronic
1049988375 9:972005-972027 CCGCGAGGCCGGGCTGGGAGGGG + Intergenic
1056604649 9:88076659-88076681 TAGCGAGCCCCGCCCGGCAGGGG - Intergenic
1059375199 9:113876088-113876110 CGGCGAGGCCGGCCCGGGGGCGG + Intergenic
1060150280 9:121284050-121284072 GAGGGAGGCTGGCCAGGGAGGGG + Intronic
1060187874 9:121574925-121574947 CAAAGAGGCCAGCTCGGGAGGGG + Intronic
1060232156 9:121833379-121833401 CAACGATGCCTTCCCGGGAGTGG - Intronic
1060375384 9:123112027-123112049 CAGCCTGGCAGGCCCTGGAGAGG - Intronic
1060897013 9:127224869-127224891 CCGCGGGGCTGGCGCGGGAGGGG + Intronic
1061178062 9:129009211-129009233 GAGCGAGGCCTCCCCCGGAGGGG + Exonic
1061237819 9:129352398-129352420 CTGGGAGGCCGGCCCGGAGGAGG + Intergenic
1062012126 9:134272943-134272965 CAGGGAGGCCGGCCCTGGGGGGG + Intergenic
1062022612 9:134326547-134326569 CGGCGCGGCCGGCCCGGGCCCGG - Intronic
1062152759 9:135030365-135030387 CAGCAAGGCAGGCCTGGGGGAGG + Intergenic
1062185383 9:135215528-135215550 GAGAGAGGCAGGCCAGGGAGCGG + Intergenic
1062358824 9:136177907-136177929 CAGCGTGGCCGTCGCGGGCGGGG + Intergenic
1062358837 9:136177952-136177974 CAGCGTGGCCGTCGCGGGCGGGG + Intergenic
1062483427 9:136762970-136762992 CAGCGAGGCCAGGCAGGGAAGGG + Intronic
1185611324 X:1395133-1395155 CAGCGAGGCCGGGCTGGACGGGG + Intergenic
1186244927 X:7608959-7608981 CAGGGCGGCCGGCCGGGCAGAGG + Intergenic
1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG + Intronic
1192033870 X:67543955-67543977 CAAGGAGGCCGGCCCGGTGGGGG + Intergenic
1192177351 X:68894389-68894411 CAGCCAGGCCTGACCCGGAGAGG + Intergenic
1192664178 X:73069920-73069942 CAGACAGGGCGGCCGGGGAGAGG - Intergenic
1196828465 X:119758708-119758730 CTGCGAGGTCGGCGCGAGAGAGG - Exonic
1200132951 X:153861419-153861441 CTGCCAGGCGGGCCCGGGTGTGG - Intergenic
1200133123 X:153862245-153862267 CAGCCAGGCTGGCTGGGGAGTGG + Exonic
1200224762 X:154411455-154411477 CAGCGAGGCCAGCCCCGGGGCGG - Intronic
1201179716 Y:11332990-11333012 CAGCCAGGCCGCGCCAGGAGAGG + Intergenic