ID: 900675494

View in Genome Browser
Species Human (GRCh38)
Location 1:3882874-3882896
Sequence ATGTATACGTAGATGAAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900675494 Original CRISPR ATGTATACGTAGATGAAACG TGG Intronic
900675494 1:3882874-3882896 ATGTATACGTAGATGAAACGTGG + Intronic
901723796 1:11223144-11223166 ATGTATTTGTAGAAGAAACCAGG - Intronic
902868968 1:19301337-19301359 AGGTATACCTAGAAGAAATGAGG - Intergenic
906314864 1:44779978-44780000 ATGTATTTGTAGTAGAAACGGGG + Intergenic
907709537 1:56866124-56866146 ATGGTTATGTAGTTGAAACGGGG - Intronic
909157399 1:72095622-72095644 ATGTATATGTAGATGACATGGGG - Intronic
911138094 1:94464689-94464711 ATGTTGACTTAGATGAAACATGG + Intronic
915149545 1:153819232-153819254 ATGTATATCTAGAGGAAATGTGG - Intronic
916116713 1:161491015-161491037 TTGAATGCGAAGATGAAACGAGG + Intergenic
919506753 1:198408381-198408403 ATGTTTTGGTAGATGAAATGGGG + Intergenic
1066423123 10:35280055-35280077 ATAGATACAAAGATGAAACGTGG - Intronic
1070916556 10:80158767-80158789 ATGTATTTTTAGAGGAAACGTGG + Intronic
1077276843 11:1715513-1715535 ATGTCTACGTGGAGGAAATGGGG + Intergenic
1088664111 11:112077010-112077032 ATGTATAGGTTGATGATAAGAGG + Intronic
1095833471 12:46612341-46612363 ATCCATAGGTAGATGAAAAGAGG + Intergenic
1095833475 12:46612385-46612407 ATCCATAGGTAGATGAAAAGAGG + Intergenic
1109730914 13:66412537-66412559 ATGTATACATAAATAAAAAGTGG - Intronic
1110317194 13:74123493-74123515 ATACATACGTAGATAAAACATGG - Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1120640287 14:87002578-87002600 ATGTTTACTAAGATGGAACGTGG - Intergenic
1128900083 15:71412500-71412522 ATACATACGTAGATGAAAGGAGG - Intronic
1129547135 15:76408211-76408233 ATGTATTTGTTGATGAAACCTGG + Intronic
1130635233 15:85612528-85612550 ATGTTTAAGTAGATCAAGCGTGG + Intronic
1137953007 16:52801465-52801487 CTGTTTACATAGATGAAAAGTGG - Intergenic
1138484891 16:57333829-57333851 TTGTATATGTAGTAGAAACGAGG + Intergenic
1140213869 16:72992140-72992162 ATGGATACTTAGAAGAAACTAGG - Intronic
1144297511 17:13890291-13890313 ATGTATACACAGATAAAAAGGGG - Intergenic
1148404852 17:47402322-47402344 GTTTATACGCAGATGAAACTTGG + Intronic
1150354829 17:64474245-64474267 TTGTATTTGTAGAAGAAACGGGG + Intergenic
1155244728 18:23896547-23896569 ATGTATACTTAGATGGAATATGG + Intronic
1165383285 19:35495706-35495728 ATGTATACGTGAAAGAAACCCGG - Intergenic
1167896539 19:52586365-52586387 ATGTATATGTAGACTGAACGCGG + Exonic
930084474 2:47484809-47484831 ATGAATGCATAAATGAAACGTGG + Intronic
931252181 2:60542666-60542688 ATGTGTACGTGGATGAAGTGGGG + Intronic
933486521 2:82931644-82931666 ATGCATACACAGATGAAAAGAGG - Intergenic
942686236 2:178535215-178535237 ATGAAGAGGTAGATGAAACCAGG - Exonic
943514963 2:188873899-188873921 ATGTATACATAGATGAAGTGGGG - Intergenic
946817816 2:223597296-223597318 ATGTACAGGCAGATGAAACCAGG - Exonic
1174862252 20:54102098-54102120 AGGCATACGTAGAGGAAAGGGGG + Intergenic
1177286876 21:19062985-19063007 ATGTAAACATATATTAAACGTGG + Intergenic
1181429486 22:22869980-22870002 ATGTAGATCTAGATGAAAGGGGG + Intronic
950474322 3:13205983-13206005 ATGGATGAGTAGATGAAAGGAGG - Intergenic
955579239 3:60401227-60401249 ATGTATATGGAGGTGAAACTTGG - Intronic
958812677 3:98879778-98879800 ATGTATATGTTGAAGAAACTAGG + Intronic
972171076 4:36346191-36346213 GTGTATGCGTATATGAAATGTGG - Intergenic
976020192 4:80614103-80614125 ATGTATACAGAAATGAAAAGGGG - Intronic
978083697 4:104623966-104623988 ATGTATGGGTAGAGGAAACAAGG + Intergenic
979166938 4:117545900-117545922 ATGGATAGGTAGATAAAACAGGG + Intergenic
981604077 4:146523351-146523373 ATGTATAATTAGATGACACTTGG - Intergenic
992575796 5:78110780-78110802 ATATATACGTATATGAGACAGGG + Intronic
993325250 5:86526510-86526532 ATGTAAACCAAAATGAAACGTGG - Intergenic
996686732 5:126290785-126290807 ATGAATATGTAGATGAAATGTGG + Intergenic
996947417 5:129087209-129087231 TTTTATACATAGATGGAACGTGG - Intergenic
998199238 5:140106913-140106935 CTGAATACGTAGATGGAACGTGG - Intergenic
1002240892 5:177839207-177839229 ATGTAACCGGAGATGGAACGTGG + Intergenic
1016218510 6:141634513-141634535 TTGTAAAAGGAGATGAAACGTGG - Intergenic
1030942902 7:115677679-115677701 ATGTATACATATATGTAATGGGG + Intergenic
1037011393 8:13847123-13847145 ATGCATACTTAGAAGAAATGTGG + Intergenic
1039603356 8:38860703-38860725 ATGTATACATAGATGAAAAATGG + Intergenic
1040932167 8:52746839-52746861 ATATATATGTAGAAGAAAAGCGG + Intergenic
1041671466 8:60495783-60495805 ATTTATACGCAGCTGAAACTAGG + Intergenic
1043072037 8:75649586-75649608 ATGTATCAGTAGATGATAAGTGG - Intergenic
1048098443 8:131320039-131320061 ATATATATGTATATGAAAAGAGG + Intergenic
1050078161 9:1886936-1886958 TTGAATACGTAGATGAATGGAGG - Intergenic
1186813821 X:13216208-13216230 CTGGCTACCTAGATGAAACGAGG - Intergenic
1199167870 X:144698988-144699010 TTGTATACGTAAAGGAAAGGAGG - Intergenic