ID: 900676537

View in Genome Browser
Species Human (GRCh38)
Location 1:3890689-3890711
Sequence TGCAGAAGCAGAATGAGCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 394}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900676537_900676544 29 Left 900676537 1:3890689-3890711 CCCTGGCTCATTCTGCTTCTGCA 0: 1
1: 0
2: 5
3: 43
4: 394
Right 900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG 0: 1
1: 0
2: 0
3: 2
4: 58
900676537_900676540 -5 Left 900676537 1:3890689-3890711 CCCTGGCTCATTCTGCTTCTGCA 0: 1
1: 0
2: 5
3: 43
4: 394
Right 900676540 1:3890707-3890729 CTGCACAGTGGAGCTGCTGTTGG 0: 1
1: 0
2: 0
3: 33
4: 271
900676537_900676542 16 Left 900676537 1:3890689-3890711 CCCTGGCTCATTCTGCTTCTGCA 0: 1
1: 0
2: 5
3: 43
4: 394
Right 900676542 1:3890728-3890750 GGATTCTTCTGCTCCGGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 54
900676537_900676541 10 Left 900676537 1:3890689-3890711 CCCTGGCTCATTCTGCTTCTGCA 0: 1
1: 0
2: 5
3: 43
4: 394
Right 900676541 1:3890722-3890744 GCTGTTGGATTCTTCTGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900676537 Original CRISPR TGCAGAAGCAGAATGAGCCA GGG (reversed) Exonic
900081397 1:860785-860807 TGTTGTAGCAGGATGAGCCACGG + Intergenic
900093899 1:932629-932651 TGCAGAGGCAGAAGGACCCAGGG - Intronic
900382150 1:2390329-2390351 TGCAGGAGATGAGTGAGCCAGGG + Intronic
900676537 1:3890689-3890711 TGCAGAAGCAGAATGAGCCAGGG - Exonic
900957489 1:5895721-5895743 TCCAGAACCAGAAAGAACCAAGG + Intronic
901221332 1:7585646-7585668 TGCAGGAGGACAATGGGCCATGG + Intronic
901337506 1:8463808-8463830 TGCAGAAGCAGAAGCAGCCATGG + Intronic
901564256 1:10099633-10099655 TGTAGAAGAGGAAAGAGCCAAGG + Intronic
902397483 1:16140242-16140264 TGCAGAAGCAGGATGGACCAAGG - Intronic
902576806 1:17383237-17383259 TGGAGTAGGAGACTGAGCCAAGG - Intronic
902744474 1:18464262-18464284 GGCAGAATCAGACTCAGCCATGG + Intergenic
902826917 1:18981235-18981257 ATCAGAAGCAGGAAGAGCCAAGG + Intergenic
903478145 1:23634606-23634628 GGCAGAAACAGCATGTGCCAAGG + Intronic
904172150 1:28598934-28598956 TGCACAAGCAGAGCGAGCCCAGG + Intronic
904392071 1:30192539-30192561 TGGAGAAGCAGAAAGGGCCCTGG - Intergenic
904496123 1:30887718-30887740 TCCAGAAGCAGTCTGAGCCCTGG - Intronic
904732803 1:32607330-32607352 TGCAGGAGCAGAAAGAGGCCAGG + Intronic
905087284 1:35392221-35392243 TGCTGAAGCAGCTTGAACCATGG - Exonic
905690674 1:39940547-39940569 GGCAGAAGCAGAATCTGCCTTGG - Intergenic
906115201 1:43352180-43352202 AAGAGAAGCAGACTGAGCCATGG - Intronic
906895768 1:49769517-49769539 AGCAGAAAAAGAAAGAGCCAGGG + Intronic
907638597 1:56161490-56161512 TGGGGAAGCAGAAAGAGCCCTGG + Intergenic
908146524 1:61251129-61251151 TGCAAAAGAAAAGTGAGCCAGGG - Intronic
908499396 1:64728090-64728112 TGCAAAAGCAGAAGGAGTAATGG + Intergenic
909677173 1:78251709-78251731 TGCAGAAGCAGAAAGCTTCATGG + Intergenic
909741801 1:79038095-79038117 TGGAGAAGGAGAAAGAGACAGGG - Intergenic
912565775 1:110586176-110586198 TGCAGGAGCAGAAGAAGCAAGGG - Intergenic
912703520 1:111895633-111895655 TTCAGCAGCAGGATGAGTCAGGG + Intronic
913314191 1:117536277-117536299 GGCTGGAGCAGAATGAGCTAGGG + Intergenic
913535585 1:119768976-119768998 TTTAGAAGCAGACTGAGCCACGG - Intergenic
913573480 1:120144700-120144722 TCCAGAAGCAAATTTAGCCAGGG + Intergenic
914294739 1:146309501-146309523 TCCAGAAGCAAATTTAGCCAGGG + Intergenic
914555780 1:148760284-148760306 TCCAGAAGCAAATTTAGCCAGGG + Intergenic
915146867 1:153800625-153800647 GGCAGAAGTAGAGAGAGCCATGG - Intergenic
918338995 1:183551879-183551901 AGCAGAAGCAGAAACAGCAACGG + Intronic
919259060 1:195166166-195166188 TGCATAAGCAGAATTAGGCAGGG - Intergenic
919621985 1:199873332-199873354 GGCAGAAGCACAAGGAACCAGGG + Intergenic
920977530 1:210800092-210800114 TGCAGAAGCACACAGAGCAAGGG - Intronic
921328759 1:214014702-214014724 GGCAGAGGCAGATCGAGCCAGGG + Intronic
921514122 1:216068634-216068656 TGAAGAAACAGAAAGAGTCAGGG + Intronic
923439890 1:234007328-234007350 TGAAGAAGGAGAGTGAGCCCTGG + Intronic
924015149 1:239713065-239713087 TGCAGAAGCAGATTGTGCCCGGG - Intronic
1063108676 10:3016190-3016212 TGCAGAAGCAGAATGTTCCGTGG - Intergenic
1063457495 10:6194532-6194554 TGCAGCAACAGAAAGAGACAAGG + Intronic
1064207508 10:13336399-13336421 TGCAGAAACTGAGTGAGCCATGG + Intronic
1064530075 10:16298955-16298977 TTAAAAAGCAGAATGAGACAAGG + Intergenic
1064907380 10:20361280-20361302 TTCAGAAGCAGACTGCTCCAGGG - Intergenic
1065552616 10:26884437-26884459 TGCAGAGGAAGAATGTGCCATGG + Intergenic
1065587213 10:27230949-27230971 TTCAGAAGCAGAATAAGATAAGG - Intronic
1065598863 10:27348005-27348027 TGCAGATGCAGAACGGCCCAGGG + Intergenic
1065600428 10:27362379-27362401 TGCAGAAAAAGAATGTGCCATGG - Intergenic
1066581117 10:36883397-36883419 TGCAGAAGAAGAATGTGCCATGG + Intergenic
1067208203 10:44237553-44237575 TGAAGAAGGAGAAGGAGGCATGG + Intergenic
1068033757 10:51735020-51735042 TGAAGAAGCAGAGTGAGATAGGG + Intronic
1068894901 10:62188561-62188583 AGCAGGAACAGAATGAGCAAAGG - Intronic
1069701790 10:70432211-70432233 TGCCGAAGCAGACTGACGCAGGG + Intergenic
1072578686 10:96721713-96721735 TCTAGAAGCTGAAAGAGCCAAGG - Intergenic
1072822085 10:98568219-98568241 TCCAGAAGCAAAATGAGTCCTGG + Intronic
1074945743 10:118278985-118279007 TTCAGCAGGAGAATGTGCCAGGG - Intergenic
1075310279 10:121407886-121407908 TGCAGAAGCTAAAAGAGGCAAGG + Intergenic
1076239880 10:128896589-128896611 AGCGGAAGCAGAAAGTGCCAAGG + Intergenic
1076814934 10:132909937-132909959 TGCAGCAGCAGATTGGGCCACGG - Exonic
1077433311 11:2526602-2526624 TGCAGCAGGAGGATGAGCCGAGG + Intronic
1078355644 11:10629713-10629735 TGCAGAAGGAGGATGAGCTGGGG + Intronic
1078413779 11:11148859-11148881 GGGAGAAGCAGAATGAGGCAGGG - Intergenic
1078457573 11:11487048-11487070 GGCTGAAGAAGAATGAGCAAAGG - Intronic
1079460783 11:20676072-20676094 GGCAGAAACTGAATGGGCCAGGG - Intronic
1080333487 11:31169915-31169937 GGCAGAAGCAGCATAAGCTAAGG + Intronic
1080424752 11:32145443-32145465 TGCAGAAGAAATATGAGGCATGG + Intergenic
1080461515 11:32458882-32458904 TGCAGAGCCATAATGAGCCTGGG - Intergenic
1080812923 11:35723634-35723656 TGCAGCAGGTGAATGAGTCATGG - Intronic
1084313515 11:68330574-68330596 TGCAGAATGAGAATGACCCCAGG - Intronic
1085216184 11:74834864-74834886 AGAAGAAGCAGAATGAGCCCAGG + Intronic
1085985759 11:81785727-81785749 TGCAAAAACAGAATGAGGAATGG + Intergenic
1086228880 11:84545149-84545171 TCCAGTAGCAGCATTAGCCATGG - Intronic
1086993884 11:93334614-93334636 AGCAGGAGCAGAAAGTGCCAAGG + Intronic
1087359516 11:97140562-97140584 TGCAGAAGAAGAAAGAGAAAAGG - Intergenic
1088432042 11:109769221-109769243 TGCAGAAGCAGAGTGATACAGGG + Intergenic
1088849342 11:113692546-113692568 TGCAGCAGCAGGAGGAGCCCTGG + Intronic
1091015955 11:132050892-132050914 TGCAGAAGAAGAACCAGACAAGG - Intronic
1091287174 11:134413862-134413884 TGCAGAAGCAGGATGGGCGGGGG + Intergenic
1093194558 12:16114659-16114681 TGCATCAGAAGAATGAGGCAGGG - Intergenic
1094248047 12:28325733-28325755 TGCTGAAGCAGAATGAATGAGGG + Intronic
1094371585 12:29744246-29744268 AGATGAAGCAGAATGAACCAGGG + Intronic
1096310333 12:50515120-50515142 TTCAGAAGCTTAATGAGGCAGGG - Intronic
1096666980 12:53172438-53172460 TGGAGAAGGAGAGTAAGCCAGGG + Intronic
1098034249 12:66286286-66286308 AGCTGAAGCAAAATGAGCAAAGG + Intergenic
1098407405 12:70140797-70140819 TGAAGAAAAAGAATGTGCCAAGG + Intergenic
1101646313 12:106633887-106633909 GGCAGAAGCAGCAGGAGCAAAGG - Intronic
1102119326 12:110428760-110428782 TGCTGCAGCAGAGTGAGCAAGGG - Intergenic
1102865939 12:116374010-116374032 AGGAGAAGCGGACTGAGCCAGGG + Intergenic
1103156565 12:118690015-118690037 TGCAGTAACTGAATGAGACAGGG + Intergenic
1103185750 12:118955626-118955648 TGCAGAAGCAGATGGAGACCAGG + Intergenic
1103601424 12:122057105-122057127 TGAAGAAGCAGAACAGGCCATGG + Intronic
1104169008 12:126261640-126261662 CGCTGGAGCAGAGTGAGCCAGGG + Intergenic
1105555656 13:21446038-21446060 GGCTGAAGCAGAATGAGCAAAGG + Intronic
1105858948 13:24392991-24393013 GGCAGCAGCTGCATGAGCCAGGG - Intergenic
1107714062 13:43180896-43180918 AGCAGAAGCAGAAAAGGCCAAGG + Intergenic
1109093437 13:58078950-58078972 TGTAGAAGCAGAAAGAGGAATGG + Intergenic
1110507397 13:76303543-76303565 AGCAGAAGCAGAGTGAATCAAGG + Intergenic
1110561532 13:76915243-76915265 TGGGGATGCAGAATGAGCTAAGG + Intergenic
1110755290 13:79166370-79166392 TTCAAAAGCAGAATAATCCAAGG - Intergenic
1111218463 13:85175370-85175392 TGCTGAAGAAGAATGAGGAAGGG + Intergenic
1112211205 13:97379624-97379646 TGTACAAGCAGAAAGAGCCAGGG + Intronic
1112466643 13:99650997-99651019 AGAAGCAGCAGCATGAGCCATGG - Intronic
1113159266 13:107361520-107361542 TGGAAAAGAAAAATGAGCCATGG + Intronic
1113222608 13:108122353-108122375 TACAGAATGAGAAAGAGCCAAGG + Intergenic
1114266658 14:21076336-21076358 TGCGGGAGCAGGAAGAGCCAAGG - Intronic
1114650620 14:24282220-24282242 AGCAGAAGCAGCATGATGCAGGG + Intergenic
1114860724 14:26517227-26517249 AGCAGCAGCAGAATGAGCAAGGG - Intronic
1115080608 14:29446149-29446171 TGCAGAAGCAGGACAAGCAATGG + Intergenic
1115114839 14:29867699-29867721 TACAGAGGCAGAATGAGCCAGGG + Intronic
1115243360 14:31270731-31270753 AGCAGCAGCAGCAGGAGCCATGG + Intergenic
1115427530 14:33277745-33277767 TGCTGGAGCAGAATGAGAAAGGG + Intronic
1115536482 14:34378061-34378083 TGCAGAAGGAGACTGAGACTAGG - Intronic
1116148470 14:41105884-41105906 TGGAGAACCAGAATGAGACAAGG + Intergenic
1117162746 14:53005401-53005423 AGCAGAAGCTGAAAGAGGCAAGG - Intergenic
1117213474 14:53526088-53526110 TGCAGAACCAGCATGAACCAGGG + Intergenic
1117232962 14:53741041-53741063 TGAAGAAGAAGAAGGAGCAAGGG - Intergenic
1117742235 14:58830725-58830747 GGCTGAAGCAAAATGACCCAAGG + Intergenic
1118365558 14:65092596-65092618 TGCAAAACCAGAATTTGCCATGG - Intronic
1119125293 14:72119907-72119929 TCCGGTAGCAGAATGAGCCTGGG + Intronic
1119371013 14:74143252-74143274 GACAGAAACAGAATGAGCCTGGG + Intronic
1119437489 14:74606895-74606917 TGCAGATGGAGAATGAGGGAAGG - Intronic
1119464404 14:74843684-74843706 AGCAGAAGCAGAATAAAACAGGG + Intronic
1120409875 14:84141005-84141027 TCCAAATGCAGAATGAGACAGGG - Intergenic
1121233515 14:92376140-92376162 TGCAGTGGCAGAATGAGCTCTGG + Intronic
1121671621 14:95714457-95714479 TCCAGAAGAAGAAAGGGCCAAGG - Intergenic
1122913616 14:104845583-104845605 TCCAGAAGCAGACTCAGACAGGG + Intergenic
1124384686 15:29196912-29196934 TGTGGAAGGAGAATGAGCCAAGG - Intronic
1124434730 15:29637704-29637726 GGCAGAACCAGAATGGGTCATGG + Intergenic
1126686047 15:51249948-51249970 TCCAGAAGAAGAATGTCCCAGGG - Intronic
1129364709 15:75047233-75047255 TGCAGAAGCAGCAGGTGGCATGG + Intronic
1129998478 15:80027001-80027023 TGCAGAAGCAGAAGGTCCCTTGG - Intergenic
1133034825 16:3028765-3028787 TGCAGAGGCAGAAGGAGCTGCGG - Exonic
1135857734 16:26027522-26027544 TGGAGAAGCAAAATGAGATAGGG - Intronic
1136080412 16:27848883-27848905 TGCTGTAGCAGAGTGAGCAAGGG + Intronic
1136472478 16:30490508-30490530 TGAAGAGGCAGGAGGAGCCAGGG - Intronic
1138629050 16:58279053-58279075 TTCAAAAGCAGAAAGACCCATGG - Intronic
1140133600 16:72185420-72185442 AGCACAAGCAGAATGGTCCAAGG - Intergenic
1141138227 16:81480574-81480596 TGGAGCAGCAGAATGGGTCAGGG - Intronic
1141977974 16:87530616-87530638 TACAGATGCAGAAAGAGCAATGG + Intergenic
1142858173 17:2744662-2744684 TGGAGAAGCAGATTGACACAAGG + Intergenic
1146561081 17:33871202-33871224 TTCAGAAGCTGAATGAGGCTGGG + Intronic
1147367874 17:39971173-39971195 TGAAGAGGAAGAAGGAGCCAGGG + Intronic
1147423128 17:40332292-40332314 GGAAGCAGCAGAATGGGCCATGG + Intronic
1148018075 17:44536572-44536594 GACAGAGGGAGAATGAGCCAGGG - Intergenic
1148392953 17:47286343-47286365 TGAAGAAGCAGAGTGTGTCACGG + Exonic
1148626995 17:49077165-49077187 TATAGCAGCAGAAAGAGCCAAGG + Intergenic
1148947543 17:51277589-51277611 AGCAGAAAAAGCATGAGCCATGG + Intronic
1151294794 17:73176926-73176948 AGCAGATGTAGACTGAGCCATGG - Intergenic
1151427400 17:74040074-74040096 TGCAGAAGCAGGAAGAGTGAGGG + Intergenic
1151484131 17:74387935-74387957 TACAGGAGGAGCATGAGCCAGGG + Intergenic
1151998984 17:77632901-77632923 TGCAGAAGCGGGGAGAGCCAAGG - Intergenic
1153049691 18:890006-890028 TGCAAAAGCACAATGAGCACAGG - Intergenic
1155060791 18:22226734-22226756 GGCAGAAGCAGAAGGAGCAGAGG - Intergenic
1156395350 18:36694381-36694403 CGCTCCAGCAGAATGAGCCAAGG - Intronic
1156735410 18:40252156-40252178 TAAAGAAGCACAATAAGCCAAGG - Intergenic
1156762814 18:40613817-40613839 TCCAGTAACAGAATGACCCATGG + Intergenic
1156821321 18:41376479-41376501 TGCTGTAGCAGAGTGAGCCATGG + Intergenic
1157723033 18:49940256-49940278 TGCAGAAGGGAGATGAGCCAGGG - Intronic
1157747968 18:50153422-50153444 AGCACAAGCAGCATGAGACATGG + Intronic
1158896743 18:61921351-61921373 TGCAGAGGCAGGATCAGCCAGGG - Intergenic
1161267900 19:3373441-3373463 GGCTGGAGCAGAATGAGCAAGGG - Intronic
1161465178 19:4425771-4425793 TGCTGAAGCATCATGAGCCATGG + Intronic
1161599169 19:5170423-5170445 GGCTGCAGCAGAGTGAGCCAGGG + Intronic
1162268774 19:9597185-9597207 TGAATGAGCAGAATGAGTCAGGG + Intergenic
1162410085 19:10500392-10500414 TGCTGAAGCAGAGTGATCAAAGG - Intronic
1162503655 19:11069379-11069401 CACAGAAGCAGAATCAGACATGG - Intergenic
1164594859 19:29526161-29526183 AGCAGAACCAGAAGGAGACAGGG + Intergenic
1164713685 19:30376559-30376581 TTCAGAAACAGAATGGGCCAGGG + Intronic
1165012584 19:32859621-32859643 AGCAGAGGCAGAAAGTGCCAGGG - Intronic
1165067574 19:33237930-33237952 TGCAGAAGGAGGATGTCCCATGG - Intergenic
1165331808 19:35144416-35144438 TGCAGAAGCAGGATTAGCAGTGG - Intronic
1166318236 19:42000740-42000762 GGCGGAAGCAGAATGTGCAATGG - Intronic
1166714962 19:44961078-44961100 CGCAGAAGCAGAATGACAGAAGG - Intronic
1166869240 19:45861275-45861297 AGCAGAAGAAGAATGAAACAGGG - Intronic
1166891549 19:45997065-45997087 GGCTGCAGCAGAGTGAGCCAGGG - Intronic
1167307460 19:48717258-48717280 TGCTGAGGCAGAGTGAGTCAAGG - Intronic
1167514126 19:49913093-49913115 TGCAGATGCAGCATCAGCCAGGG + Intronic
1167618903 19:50550742-50550764 TGCAGGAGAAAAATGAGCCCGGG - Intronic
1167836391 19:52075228-52075250 TGCAAGATCAGAAAGAGCCAAGG + Intronic
925852962 2:8101039-8101061 TGAAGAAGCAGAAAGAGCAAGGG - Intergenic
926123359 2:10256575-10256597 TGAGGAAGCAGAAGGAGCCGAGG - Intergenic
926311646 2:11679889-11679911 TGCAGCACCAGCCTGAGCCAAGG - Intronic
926319973 2:11742923-11742945 TCAAGGAGCAGAATGAACCACGG - Intronic
926572221 2:14542208-14542230 AGCAGAAGTGCAATGAGCCAGGG + Intergenic
927553724 2:24018551-24018573 TGCTGCAGCAGAGTGAGCAAGGG + Intronic
928441306 2:31294581-31294603 TGCAGAAGCAGTATAAGGAAAGG - Intergenic
929610784 2:43269279-43269301 TTCAGAAGCAGCAAGAGTCAGGG + Intronic
929868831 2:45740771-45740793 GGTAGAATCAGAATGAGGCAGGG - Intronic
930514666 2:52391576-52391598 TGCAGAAGCATGATAAGCAAAGG - Intergenic
931131426 2:59340883-59340905 GTAAGAAGCAGAATGAGACAGGG + Intergenic
931977428 2:67658072-67658094 AGCAGGAGGAGGATGAGCCAAGG - Intergenic
932033043 2:68209990-68210012 TGCTGAAACATAATGAGCAATGG + Intronic
932254331 2:70270855-70270877 TGCAGTGGCACAGTGAGCCAAGG - Intronic
932702007 2:73998488-73998510 GGCAGAACCAGACTGAACCAAGG - Intronic
933059835 2:77724079-77724101 TGCCAAAGCAGAATTAGACAAGG - Intergenic
933204473 2:79489655-79489677 AGAATAAGCAAAATGAGCCAGGG - Intronic
933661588 2:84931835-84931857 TCAAGAGGCAGAGTGAGCCAGGG - Intergenic
934517782 2:94999515-94999537 GGCAGGCGCAGAATGAGGCAGGG + Intergenic
934778960 2:96957014-96957036 TGCAAAAAAAAAATGAGCCATGG - Intronic
935518326 2:104073096-104073118 GACAGAAACAGAAAGAGCCATGG + Intergenic
937354352 2:121188529-121188551 AGTAGAAACAGAATGTGCCAAGG - Intergenic
938236016 2:129707941-129707963 AGCAGGAGCAAAAGGAGCCATGG + Intergenic
938945164 2:136205847-136205869 TGGAGAGGCAGAATCAGCAAAGG + Intergenic
939118973 2:138093170-138093192 GGCAGAAGCAGAGTGAGCAAAGG - Intergenic
939142351 2:138369991-138370013 TAAAGAAGAAGACTGAGCCAAGG - Intergenic
939179110 2:138783357-138783379 GGGAGAAACAGAATGAGCAAAGG + Intergenic
939909043 2:147957450-147957472 TGCATAAGCAGTATGAGGCTAGG + Intronic
940424537 2:153515292-153515314 TGCAGGAGCAGAGGGAGCTACGG - Intergenic
940720871 2:157280426-157280448 AGCAGAAGCTGAAAGAGGCAAGG + Intronic
941544535 2:166832079-166832101 GGAAGAAACAGAATGAGTCATGG + Intergenic
941602292 2:167558515-167558537 TCCAGAAGCAGAAGGGGTCAGGG + Intergenic
943688579 2:190845170-190845192 TGCAGAAGCAAAATGTGGCTTGG - Intergenic
944093098 2:195935657-195935679 TGCAGAAGGAAAATGAGGCAAGG + Intronic
944511928 2:200473635-200473657 TGGAGAAGCAGAAGGAGAGAAGG - Intronic
945097854 2:206236724-206236746 TGCAGCAGAATAAAGAGCCATGG + Intergenic
945739338 2:213641629-213641651 TACAAAAGTAGAATGAGCAATGG - Intronic
945895524 2:215477315-215477337 TGCAGAAGGAGTATGAGCTTTGG - Intergenic
945984271 2:216341428-216341450 TGCTGATGCAGACTGAGCCTGGG + Intronic
947420444 2:229937615-229937637 TGCTGAAGCAGGGAGAGCCAGGG - Intronic
947598587 2:231430220-231430242 TCCAGAAGAAGAATGTCCCAGGG + Intergenic
947787025 2:232832306-232832328 AGCAGAAGGAAAATGAGCCCAGG + Intronic
1168893663 20:1309639-1309661 TGCAGAAGCAGAAGCAGCCACGG + Intergenic
1169372880 20:5042220-5042242 GGGAGAAGCACAATGAACCAAGG - Intergenic
1169639456 20:7733759-7733781 AGGAGAAGCAGAATGAGTAATGG - Intergenic
1171179346 20:23081198-23081220 TTCAGCAGCAGAACAAGCCAGGG - Exonic
1171277705 20:23872381-23872403 TCCAGAGGCAGAAAGAGCCCTGG - Intergenic
1171282651 20:23914021-23914043 TCCAGAGGCAGAAAGAGCCTTGG - Intergenic
1172503578 20:35444481-35444503 GGCTGAAGCAGAGTGAGCGAAGG + Intronic
1172796578 20:37543974-37543996 TGCACAAGCACATTCAGCCAAGG - Intergenic
1172926712 20:38543799-38543821 TTCAGAAGCAGAATAACCAAAGG - Intronic
1173302892 20:41819351-41819373 TGCAGGAACAGAATTATCCAAGG + Intergenic
1173327150 20:42044382-42044404 TGGAAAACCAGAATGAGCCTGGG - Intergenic
1173598669 20:44277363-44277385 TGCAGGAGAAGATTGAGGCAGGG + Intronic
1175092848 20:56519213-56519235 TTCAGAAGCAGAAGGAGCTGTGG + Intronic
1177014691 21:15771544-15771566 TGTTGAAGCTGAATGAGCGAGGG + Intronic
1177079391 21:16619825-16619847 GGCTGAAGGAGAATGAGCAAGGG + Intergenic
1177459229 21:21388476-21388498 TGCTGAAGCTGAATAAGCAAGGG + Intronic
1177502354 21:21973957-21973979 TGCAGAAAAAGCATGAACCATGG + Intergenic
1177598574 21:23280630-23280652 TGGAGGAGAAGAATGACCCAGGG - Intergenic
1177772174 21:25529320-25529342 TCCAGAAGCTGAAAGAGGCAAGG - Intergenic
1177781783 21:25629850-25629872 AGCAGAAGCAGCATATGCCAAGG + Intergenic
1178112825 21:29386104-29386126 TGCAGGTGAAGGATGAGCCATGG - Intronic
1179174151 21:38995327-38995349 TGCAGCAGAAGAATGAAGCAAGG + Intergenic
1179840848 21:44072311-44072333 TGCAGAAGCAAGAGCAGCCAGGG - Intronic
1180694582 22:17743694-17743716 TGCAGAGGCAGAGTGATCCCGGG + Intronic
1181456875 22:23064794-23064816 GGGAGAAGCACAATGAGGCAAGG + Intronic
1181808061 22:25386957-25386979 TGCAGAACGAGAATGACCCCAGG + Intronic
1181889037 22:26045383-26045405 GACAGAAGCAGAATTAGTCAGGG + Intergenic
1183391258 22:37546664-37546686 AGCAGAAGGGGAAAGAGCCAAGG + Intergenic
1183975976 22:41512591-41512613 TGCAGAAGCAGAAAGAGCTCTGG - Intronic
949226116 3:1698230-1698252 TTGAGAAGCAGAATGATCAACGG + Intergenic
950983110 3:17330439-17330461 TAAAGAAGCAGAGTGAGCTAAGG - Intronic
951638942 3:24812351-24812373 TCCAGAAGCAGAATTTGGCATGG - Intergenic
951860292 3:27244609-27244631 TGCAGAGGGAGAATGGGCTATGG - Intronic
952795803 3:37238111-37238133 AGAAAAAGCAGAATGTGCCAAGG + Intergenic
953074996 3:39560904-39560926 TGAAGAAGAAGAATGAGGTATGG + Intergenic
953091699 3:39733525-39733547 GGCTGAAGCAGAATGAGCAAAGG - Intergenic
953589994 3:44242118-44242140 TGCAGAAGCGGCAGGCGCCAGGG + Exonic
954957682 3:54536593-54536615 AGCAGCAGCAAAGTGAGCCATGG - Intronic
955248626 3:57254308-57254330 TACAGAAGAAAATTGAGCCATGG + Intronic
956028113 3:65005696-65005718 GACAGATGCAGAATGAGTCAGGG - Intergenic
956029766 3:65024883-65024905 TGCAGATTCAGAATTAACCAAGG + Intergenic
956086690 3:65618901-65618923 TGCAGATGCAGAATGAGTTCAGG - Intronic
956717437 3:72090773-72090795 AACAGAAGCAGAGTGAGCAAAGG + Intergenic
960294590 3:115927634-115927656 GGCCGAAGCAGAGTGAGCAAGGG - Intronic
961051402 3:123750128-123750150 TGCAGAAGCAGAATGTGCATAGG + Intronic
961581969 3:127890780-127890802 ATCAGAATCAGAATGAGTCAGGG - Intergenic
961660045 3:128463692-128463714 GGCAGAGGCAGGATCAGCCACGG + Exonic
962635923 3:137331387-137331409 TGGAAAAGAAGAGTGAGCCAGGG - Intergenic
962724223 3:138206423-138206445 AGCTGGAGCAGAATGAGCAAAGG - Intronic
962842999 3:139252352-139252374 TGCAGAGGTGAAATGAGCCAGGG + Intronic
962929286 3:140022402-140022424 TGCAGAAGAGCAATGAGCCTGGG + Intronic
964765709 3:160176885-160176907 TGTAAAAGAAGGATGAGCCAAGG - Intergenic
964948042 3:162249949-162249971 ACCAGAAGCAGAAAGAGGCACGG + Intergenic
965147339 3:164923689-164923711 TTGAGAAGCAGAATAAGACAAGG - Intergenic
965441047 3:168714716-168714738 TGCAGAAGCAGAAAAGGGCATGG - Intergenic
965537321 3:169836837-169836859 GGCTGGAGCAGAGTGAGCCAGGG + Intronic
966289209 3:178334964-178334986 TGGAGAAGCACAGTGAGCCTTGG + Intergenic
966334660 3:178854621-178854643 CCCAGAAGCAGACTGAGACAAGG + Intergenic
967621365 3:191638710-191638732 GGCAGAAACAGAAAGAGCCCTGG + Intergenic
968537463 4:1143394-1143416 TGCAGAAGCAGAGATATCCAGGG - Intergenic
968748089 4:2371267-2371289 TACAAAAGAAGAATGTGCCAGGG - Intronic
969480503 4:7444562-7444584 GGCAGGAGCAGAAGGCGCCACGG + Intronic
969587371 4:8102162-8102184 GGCTGAAGCAGAATGACCAAGGG - Intronic
970881557 4:20938247-20938269 TGCAGAATCAGGAGAAGCCAAGG + Intronic
972293904 4:37718036-37718058 GGCGGAAGCTGAATGAGCCTAGG + Intergenic
972954886 4:44376871-44376893 TGCAGAAGCAGCAAGCGGCATGG + Intronic
973006741 4:45017333-45017355 TAGATAATCAGAATGAGCCAGGG - Intergenic
975329851 4:73100311-73100333 TGCTGCAGCAGAGTGAGCAAGGG + Intronic
975407300 4:74004608-74004630 TGAAGAAGCAGCATCATCCAGGG + Intergenic
976478191 4:85508972-85508994 TGCAGAAACAGACTGAGGGAAGG - Intronic
977285302 4:95098648-95098670 AGCAGCAGCAGAATGAACCTGGG - Intronic
977296217 4:95212591-95212613 TGCAGAAGCAGAAAGAACTGGGG - Intronic
979471169 4:121098714-121098736 TGTAGAAGTAGAATGAGCCTGGG - Intergenic
979598857 4:122564265-122564287 TGAAGAAGGAAACTGAGCCAGGG - Intergenic
980002490 4:127506734-127506756 TGAAGCAACAGAATGAGCAAAGG + Intergenic
981222635 4:142254556-142254578 TGCAGAAGCCTCATGAGCCGAGG + Intronic
981310461 4:143293260-143293282 TACAGAAGCAGGAGGAGGCAAGG + Intergenic
981848532 4:149199147-149199169 AGCAGAAGCTGGAAGAGCCAAGG - Intergenic
981870118 4:149475641-149475663 AGAAGAAGCAGAATCAGCAAAGG + Intergenic
981930597 4:150185199-150185221 GGAAGGAGAAGAATGAGCCAAGG + Intronic
982309411 4:153968816-153968838 TGGAGGAGCATAATGAGCCGAGG + Intergenic
983457950 4:167987282-167987304 TGTGGAAGCAGAATGATTCAGGG + Intergenic
983709359 4:170694853-170694875 TTCAGTAGCATAATGAGGCATGG - Intergenic
984966854 4:185146857-185146879 TGCAAAAGACGAAGGAGCCAAGG + Exonic
985054007 4:186020321-186020343 GGCTGAAGGAGAATGAGCCAGGG + Intergenic
985854415 5:2413695-2413717 TGCAGAGACAGAATGAGCACAGG + Intergenic
986106476 5:4664458-4664480 CTCAGAAGCAGAATCAGCCCTGG + Intergenic
986253657 5:6083616-6083638 GGCAGGAGCTGAGTGAGCCAGGG - Intergenic
986372601 5:7094799-7094821 GGGACCAGCAGAATGAGCCATGG + Intergenic
987568168 5:19620567-19620589 TGAAGAAGCAGAATGAGAGAGGG + Intronic
987911556 5:24153973-24153995 GGCAGGAGCACAATGTGCCATGG - Intronic
989535058 5:42553545-42553567 TGTAAAAGCAGAATGAGATATGG - Intronic
991261405 5:64672098-64672120 TGCAGTAGCAGAATGGGGAAAGG + Intergenic
991545926 5:67781361-67781383 TGCAGAAGCCTCAGGAGCCAAGG + Intergenic
991696899 5:69281395-69281417 TGAAGAAGCTGCCTGAGCCAAGG - Exonic
991977466 5:72197222-72197244 TGCAGAGGCAGAAGTAGCCCCGG + Exonic
992506751 5:77394844-77394866 TGCAGCAGGGGATTGAGCCAAGG + Intronic
992533287 5:77672495-77672517 TGCAGAAGCAGAATGATAACAGG - Intergenic
993130827 5:83896236-83896258 TGCAGAAGCAGAGGGAGCAGAGG + Intergenic
993776502 5:92005369-92005391 AGCAGAACAAAAATGAGCCAGGG + Intergenic
995322602 5:110853748-110853770 TGGAGAAGAAGAAGGAGACAGGG + Intergenic
996005601 5:118417723-118417745 TGCAGAAGGAGCATGGGGCAAGG - Intergenic
998158598 5:139800174-139800196 TGAAGAAGCAAAATGAGGTAAGG - Intronic
998495574 5:142585659-142585681 AGCAGCAGCAGCATGTGCCAAGG - Intergenic
998995180 5:147863733-147863755 AGCAGATGCAGAATGACCCCAGG - Intergenic
999207068 5:149856699-149856721 TGCAGAAGCAGTATGGTACAAGG + Intergenic
999376046 5:151087147-151087169 TGCAGAAGCACAGTGAGCCGAGG - Exonic
999442830 5:151615618-151615640 TGCTGAAGCAGAATGAGTCAGGG + Intergenic
999991005 5:157049783-157049805 TGCAGATGCAGAAGGAGCTGGGG - Intronic
1000163897 5:158628517-158628539 TGAATAAGCTGAATGAGCGAAGG - Intergenic
1001041368 5:168337933-168337955 TGCTGGAGCAGAGTGAGCCTTGG + Intronic
1001899463 5:175413314-175413336 TGCAGATGCAGCATGAGCAGAGG + Intergenic
1001956055 5:175848909-175848931 GGCTGAAGCAGAGTGAGCCGGGG + Intronic
1002063386 5:176639827-176639849 TGAGGAGGGAGAATGAGCCAAGG + Intronic
1002128962 5:177067711-177067733 TGCAGGAGCTGACTCAGCCAAGG + Intronic
1002402798 5:179001211-179001233 TGAAGATGCAGAAAGGGCCAAGG + Intergenic
1002617290 5:180463871-180463893 TGCAGCAGCAGGATGGGCCTGGG - Intergenic
1003015308 6:2463014-2463036 TGCAGAAGCGGAAGGAGCCCGGG + Intergenic
1003631478 6:7791491-7791513 TGGAGAAGCAGAGAGGGCCAAGG - Intronic
1003734131 6:8858308-8858330 AGCACAAGCAGAATCAGCAAAGG + Intergenic
1004200110 6:13540427-13540449 TGGAGAACCAAAATGAGGCATGG + Intergenic
1004281562 6:14283988-14284010 AGCAGAGACAGAATGAGCAATGG - Intergenic
1005148981 6:22725919-22725941 TGCAAAAGCAGAAGCTGCCAGGG + Intergenic
1005209994 6:23449459-23449481 GGCTGGAGCAGGATGAGCCAAGG + Intergenic
1006034545 6:31201333-31201355 TGCAGAGCCAGAAGCAGCCAGGG - Intronic
1006474600 6:34246063-34246085 TGCTGCAGCAGAGTGAGCAAGGG + Exonic
1006931272 6:37690082-37690104 GGCTGGAGCAGAATGAGCCAGGG - Intronic
1007394796 6:41571259-41571281 TGCAGGAGCTGGATGAGCCCTGG + Intronic
1008011143 6:46469089-46469111 TGCAGAAGTACAATCAGCCCTGG - Intronic
1008049983 6:46891046-46891068 TGCAGAAGCTGAATGATGCCAGG - Intronic
1008603220 6:53116073-53116095 TGTAGTAGCAGAAGGCGCCAGGG - Intergenic
1008931597 6:56946137-56946159 TGCAGAAACAGAGAGAGCCAGGG + Intronic
1009706405 6:67257890-67257912 TGCAAAAGCAGAAGCTGCCAGGG - Intergenic
1011149747 6:84257878-84257900 AGCAGAGGCAGGAAGAGCCAAGG + Intergenic
1011650716 6:89503903-89503925 GGCCAGAGCAGAATGAGCCAAGG + Intronic
1011706133 6:90003242-90003264 CCCAGGAGCAGAGTGAGCCAAGG - Intronic
1012415141 6:99005012-99005034 GGCTGGAGCAGAGTGAGCCAGGG - Intergenic
1013548447 6:111183177-111183199 GGCAGAAGCAGAGTGGGCAAGGG - Intronic
1013591798 6:111625101-111625123 TACAGAAGATGAAAGAGCCAAGG - Intergenic
1014574222 6:123050612-123050634 AGCTGGAGCAGAATGAGCTATGG + Intronic
1014977275 6:127902985-127903007 AGCAGAAGCAGATGGAGCCTAGG - Intronic
1015202317 6:130596648-130596670 TGCAGAATCAGAATTTTCCATGG + Intergenic
1015990607 6:138937625-138937647 TGCAGAAGGAGATGGAGACAGGG + Intronic
1017359887 6:153555397-153555419 GGCAGAAGAAGCATGAGCTATGG - Intergenic
1018471695 6:164102866-164102888 TGCCGAAGGGGAAAGAGCCATGG + Intergenic
1022481482 7:30746096-30746118 TGCAGAAGTAAACTTAGCCAGGG + Intronic
1023835713 7:44066087-44066109 AGCAGCAGCAGAATGGGCAAGGG + Intronic
1024532793 7:50407201-50407223 TGCAGAGGCAGGATGGGCCCAGG + Intergenic
1024905513 7:54374560-54374582 CCCAGAAACAGAGTGAGCCAGGG - Intergenic
1030098585 7:105923770-105923792 AGCAGCAGCAGAAGGAGTCATGG + Intronic
1030612991 7:111708986-111709008 GGAAGAAACAGAATGAGCCAAGG - Intergenic
1031202309 7:118703690-118703712 AGCAGTAGCAGAATGAGCTTTGG - Intergenic
1032516784 7:132512377-132512399 AGAAGATGCAGAATGAGCCATGG - Intronic
1032599527 7:133278620-133278642 GGCTGAAGCAAAATGAGGCATGG + Intronic
1033058104 7:138078819-138078841 TTCAGAATCTGAATGAGCCATGG + Intronic
1034562387 7:151889466-151889488 TGCAGAAGAAGTAGGGGCCAGGG + Intergenic
1035523865 8:296689-296711 TGGTGTAGCAGGATGAGCCACGG - Intergenic
1035639900 8:1176855-1176877 TGGAGTAGCAGAGAGAGCCAAGG + Intergenic
1036069697 8:5427041-5427063 GGGAGAAGAAGAATGAGCAAAGG + Intergenic
1036667915 8:10759724-10759746 CGCAGAAGGAGCAAGAGCCAAGG + Intronic
1037786112 8:21904237-21904259 TGCGGGAGCAGAGAGAGCCAAGG + Intergenic
1040869341 8:52084104-52084126 GGCAGAAGGATCATGAGCCAAGG + Intergenic
1041153538 8:54960798-54960820 AGCAGTAGCAGAATGAACCCAGG + Intergenic
1041159598 8:55026042-55026064 TGCAGAACGAGACTGAGACACGG - Intergenic
1043665551 8:82807111-82807133 TCCAGAAGCAGAAAAAGACAGGG - Intergenic
1044424023 8:92030721-92030743 TGCAGAAGAAGAATGAGAAGTGG - Intronic
1046402807 8:113728394-113728416 TACTGAAGCAGGATGAACCAGGG + Intergenic
1046876269 8:119258092-119258114 TACAGAAGGATAATGAGCAATGG - Intergenic
1047073060 8:121369381-121369403 TGCAGAAGAAGAATGACTAAAGG - Intergenic
1047256267 8:123215770-123215792 TGCAGAGGCAGTCTGAGGCATGG - Intergenic
1047350772 8:124071502-124071524 TGTAGATGCAGAAGGAGCCCTGG - Exonic
1047893080 8:129334415-129334437 TGCACAGCCAGAAAGAGCCAAGG + Intergenic
1048470221 8:134698355-134698377 AGCAGAAGGAGAAGGAGGCAAGG + Intronic
1048853806 8:138669437-138669459 TGCAGAACCAGAAACAGCCCAGG + Intronic
1049251964 8:141594016-141594038 AGCTGGAGCAGAGTGAGCCAGGG + Intergenic
1049662751 8:143827535-143827557 AGCTGAAGCAGCATGAGACAGGG + Intronic
1050559234 9:6817597-6817619 TTCAGATGCAGAATGAGGAAAGG - Intronic
1050646467 9:7725042-7725064 AGCAGAAGAAGAAGGATCCATGG - Intergenic
1050932586 9:11349088-11349110 TGCAGTAGCTGTAGGAGCCAGGG - Intergenic
1051805684 9:20990334-20990356 TGCTGCTGCAGAAAGAGCCATGG + Exonic
1052069709 9:24067252-24067274 TGCAAGGGCAGAAAGAGCCAGGG + Intergenic
1054853985 9:69878439-69878461 TGCTGAAACAGAATCAGGCAGGG - Intronic
1055187134 9:73470774-73470796 TGAAGCAGCAGAAGCAGCCATGG - Intergenic
1055749705 9:79491546-79491568 TTCAGAAGTAGAAAGAGCTAAGG - Intergenic
1055938335 9:81624111-81624133 TGCAGTAGTTGAAAGAGCCAGGG - Intronic
1056475673 9:86948741-86948763 TCCAGAAGCAGAGGGAGCCGGGG + Intergenic
1056528845 9:87469239-87469261 TGCAAATGGAGAATGAGCCCAGG + Intergenic
1056717788 9:89046970-89046992 TGCAGAGTCTGGATGAGCCATGG - Exonic
1058773070 9:108257560-108257582 TACATAAGCAGAGTCAGCCAGGG + Intergenic
1058872319 9:109213279-109213301 TACAGAAGGAGAAGGAGACAGGG - Intronic
1058973346 9:110102886-110102908 TGCAGAGGCAGAAAGAGGCTGGG - Intronic
1059260306 9:112969891-112969913 TGCAGAAGGAGATTGCTCCAGGG + Intergenic
1059356317 9:113702080-113702102 TCCAGGAGCAGCGTGAGCCAAGG + Intergenic
1059761206 9:117339362-117339384 CGCAGAGGCAGAAAGAGGCAAGG + Intronic
1061114958 9:128604321-128604343 TGCAGGAGCTGAATGAGCGCTGG + Exonic
1061429852 9:130524032-130524054 TGCAGACACAGAGAGAGCCAAGG + Intergenic
1062203485 9:135321563-135321585 TGGAGCCCCAGAATGAGCCACGG - Intergenic
1062650196 9:137572103-137572125 AGCAGAGGCAGCGTGAGCCACGG + Intronic
1186435701 X:9541483-9541505 TGCAGGAGCAGCAGGAACCAAGG + Intronic
1187144069 X:16621502-16621524 TGGAGAAGCAGGATGGTCCAGGG + Intronic
1187429687 X:19210923-19210945 TGGAGAGGCAGAATTAACCAAGG - Intergenic
1188039768 X:25358215-25358237 TGAAGAGGCAGAGTGAGCAAGGG - Intergenic
1188772582 X:34171960-34171982 TGTAGAAGTAGAATTTGCCATGG + Intergenic
1189538806 X:41964923-41964945 GGCTGAGGCAGAATGAGCCCAGG - Intergenic
1190221490 X:48515098-48515120 GGCAGGAGCAGAGTGAGCCAGGG + Intronic
1190232138 X:48590461-48590483 GGCAGGAGCAGAGTGAGCCAGGG + Intronic
1190936820 X:55005222-55005244 TGCATAAGAGGAATGAGGCAGGG - Intronic
1191741207 X:64437160-64437182 TGGTGTAGCAGGATGAGCCACGG + Intergenic
1192072668 X:67957751-67957773 TGGAGGAGAATAATGAGCCAGGG - Intergenic
1192314725 X:70042794-70042816 TGCTGAAGCAGAATGGGCAGAGG - Intronic
1192531661 X:71892898-71892920 TGTAGAAGGAGTAGGAGCCATGG + Intergenic
1193270331 X:79521648-79521670 TTAAGAACCAGAATGAGACAAGG + Intergenic
1193947783 X:87759944-87759966 TGGAGAACCAGAACAAGCCAAGG - Intergenic
1196086300 X:111685912-111685934 TGCAGGAGCATAGTGAGCAAGGG + Intronic
1196189410 X:112779259-112779281 AGCAGCAGCAGAAGGAGCAACGG + Exonic
1196292480 X:113959788-113959810 TGCAGATGCAGAAATAGGCAAGG - Intergenic
1197016663 X:121633350-121633372 TGGAACTGCAGAATGAGCCAAGG - Intergenic
1200326820 X:155249158-155249180 TGCTAGAGCAGAATGAGCCAGGG - Intergenic
1201390028 Y:13488038-13488060 TGCAGTACCAGAAAGAGACAGGG - Intergenic