ID: 900676538

View in Genome Browser
Species Human (GRCh38)
Location 1:3890690-3890712
Sequence GTGCAGAAGCAGAATGAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900676538_900676540 -6 Left 900676538 1:3890690-3890712 CCTGGCTCATTCTGCTTCTGCAC 0: 1
1: 0
2: 3
3: 26
4: 255
Right 900676540 1:3890707-3890729 CTGCACAGTGGAGCTGCTGTTGG 0: 1
1: 0
2: 0
3: 33
4: 271
900676538_900676544 28 Left 900676538 1:3890690-3890712 CCTGGCTCATTCTGCTTCTGCAC 0: 1
1: 0
2: 3
3: 26
4: 255
Right 900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG 0: 1
1: 0
2: 0
3: 2
4: 58
900676538_900676541 9 Left 900676538 1:3890690-3890712 CCTGGCTCATTCTGCTTCTGCAC 0: 1
1: 0
2: 3
3: 26
4: 255
Right 900676541 1:3890722-3890744 GCTGTTGGATTCTTCTGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 181
900676538_900676542 15 Left 900676538 1:3890690-3890712 CCTGGCTCATTCTGCTTCTGCAC 0: 1
1: 0
2: 3
3: 26
4: 255
Right 900676542 1:3890728-3890750 GGATTCTTCTGCTCCGGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900676538 Original CRISPR GTGCAGAAGCAGAATGAGCC AGG (reversed) Exonic
900093900 1:932630-932652 CTGCAGAGGCAGAAGGACCCAGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901321783 1:8344456-8344478 GTGCTGAGGTAGAGTGAGCCTGG + Intergenic
901727369 1:11252627-11252649 GTGCAGAAGCAGGAGGAGTCTGG - Intronic
902638233 1:17749254-17749276 GTTCAAAGGCTGAATGAGCCAGG - Intergenic
902836664 1:19051844-19051866 GGGAAGGGGCAGAATGAGCCTGG - Intergenic
903689732 1:25164250-25164272 CTCCAGGAGCAGAAGGAGCCTGG - Intergenic
904357933 1:29953447-29953469 CTGCAGAAATAGAAAGAGCCTGG + Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
907593426 1:55697710-55697732 GTGCAGAAGAATAATGATCTTGG - Intergenic
907644229 1:56225367-56225389 GTTAAGAAGCTGACTGAGCCGGG - Intergenic
908407402 1:63828836-63828858 GTGCTGAAGCAGGAGTAGCCTGG - Intronic
913397492 1:118388391-118388413 AAGCAGAAGCAGAATGACTCTGG + Intergenic
914942166 1:152032807-152032829 CTGCAGAACCAGAAGGACCCTGG - Exonic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
921328758 1:214014701-214014723 GGGCAGAGGCAGATCGAGCCAGG + Intronic
922517036 1:226215283-226215305 GTACAAATGCAGAATGTGCCAGG - Intergenic
922616524 1:226964343-226964365 GTTCAGAAGCAGAAAGGACCTGG + Intronic
924015150 1:239713066-239713088 TTGCAGAAGCAGATTGTGCCCGG - Intronic
924442989 1:244102368-244102390 GTGCAGAAGGAGAATGCTGCTGG - Intergenic
924597624 1:245461246-245461268 AAGCAGAAGCAGAATCAGTCTGG - Intronic
924908766 1:248486144-248486166 GTACAGAAGAAGAATGAACAGGG + Intergenic
924915341 1:248561918-248561940 GTACAGAAGAAGAATGAACAGGG - Intergenic
1064785863 10:18893560-18893582 GTTATGAAGCATAATGAGCCAGG + Intergenic
1065361422 10:24892714-24892736 GTCCACAAGCAGAAAGAGACTGG + Intronic
1065423790 10:25577600-25577622 GAGCAAAAATAGAATGAGCCCGG - Intronic
1067723130 10:48744925-48744947 GTGCTGAAGCAGAAAAAGCAAGG - Intronic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1069725422 10:70574481-70574503 GTGCAGAGGCAGAATGAACCTGG + Intergenic
1070427598 10:76304579-76304601 GTGCAGAGGCTGACTTAGCCTGG + Intronic
1071132577 10:82411999-82412021 GTCAAGAAGAAGAATGAGTCTGG + Intronic
1071218548 10:83435545-83435567 GTGCACAGGCAGAATGAACCTGG + Intergenic
1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG + Exonic
1072708040 10:97696308-97696330 CTGCAGAAGCATAATGGGCAAGG - Intergenic
1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG + Intronic
1076539481 10:131205018-131205040 GTGCAGCCCCAGAAAGAGCCGGG - Intronic
1077026888 11:443895-443917 GTTCAGAAACAGAATGTGCAAGG + Intergenic
1078355643 11:10629712-10629734 CTGCAGAAGGAGGATGAGCTGGG + Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG + Intronic
1080461516 11:32458883-32458905 CTGCAGAGCCATAATGAGCCTGG - Intergenic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1083590222 11:63889329-63889351 GGCCAGAAGCAGAGTAAGCCAGG - Intronic
1084726753 11:70946841-70946863 GTGGAGAGGGAGGATGAGCCTGG - Intronic
1084726802 11:70947023-70947045 GTGCAGAGGGAGGTTGAGCCTGG - Intronic
1085330821 11:75649431-75649453 GGGAAGAAGCAGAATGGGTCTGG + Intronic
1085554042 11:77403280-77403302 GTTCAGAAGAAGATTGAACCTGG - Intronic
1085706919 11:78794716-78794738 ATGTAGAAGGAGATTGAGCCAGG + Intronic
1086053108 11:82617250-82617272 GTGCAAAAGCAGACTGGGCTTGG - Intergenic
1088432041 11:109769220-109769242 GTGCAGAAGCAGAGTGATACAGG + Intergenic
1088689265 11:112311411-112311433 GTGAGGGAGCAGAATGAGCCAGG + Intergenic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1090161024 11:124495665-124495687 GAACAGAAGCAGATTGATCCTGG - Intergenic
1091287173 11:134413861-134413883 GTGCAGAAGCAGGATGGGCGGGG + Intergenic
1091334365 11:134755324-134755346 GTCCAGATGCAGCATGAGCAGGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1093832610 12:23782394-23782416 ATGCAGAAGCAGAATGACTGTGG + Intronic
1096309251 12:50505476-50505498 GCGCAGAAGCAGTGTGGGCCCGG - Intronic
1098059783 12:66549286-66549308 GTGCAGAAGCAAAATGATAAAGG + Intronic
1101373302 12:104149975-104149997 GTGCTGAGGCAGGCTGAGCCTGG + Intergenic
1102720570 12:115012854-115012876 GTGAAGAAGAGGAAGGAGCCAGG - Intergenic
1103237232 12:119383559-119383581 GTGCGAGAGCAGAAGGAGCCAGG + Intronic
1104646231 12:130499570-130499592 GTGCAGGAGTAGAATGAACACGG - Intronic
1106230187 13:27815476-27815498 GTGAAGAGGCTGGATGAGCCAGG - Intergenic
1107285135 13:38781966-38781988 GGGCAAAAGCAGAGTGGGCCAGG - Intronic
1110549211 13:76792905-76792927 GGCAGGAAGCAGAATGAGCCAGG + Intergenic
1111969051 13:94891590-94891612 GTGGAAAGGCAGAAAGAGCCTGG - Intergenic
1112029971 13:95447963-95447985 AAGCAGAGGCAGAAAGAGCCTGG - Intronic
1112211204 13:97379623-97379645 ATGTACAAGCAGAAAGAGCCAGG + Intronic
1114390012 14:22297468-22297490 GTTCAAAGGCAGAATGTGCCAGG - Intergenic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115114838 14:29867698-29867720 GTACAGAGGCAGAATGAGCCAGG + Intronic
1117213473 14:53526087-53526109 CTGCAGAACCAGCATGAACCAGG + Intergenic
1117540898 14:56745694-56745716 GTCCAGGAGGAGAAAGAGCCGGG - Intergenic
1119125292 14:72119906-72119928 TTCCGGTAGCAGAATGAGCCTGG + Intronic
1119371012 14:74143251-74143273 TGACAGAAACAGAATGAGCCTGG + Intronic
1119433085 14:74581065-74581087 GAGCAGAAGCAGGATGAACACGG + Intronic
1119981774 14:79089757-79089779 GTGCAGAAGAAGAAAGATCTTGG - Intronic
1121021093 14:90580602-90580624 GTGCAGAAGCAGCACTAGCAAGG - Intronic
1121887988 14:97562125-97562147 GTGCAGAAGGATAATGCTCCTGG + Intergenic
1122047769 14:99035834-99035856 TTGCAGAAGGAGAAGGGGCCGGG + Intergenic
1122519300 14:102332199-102332221 GTGGAGAAGCACAGTGAGCCGGG - Intronic
1123878634 15:24652446-24652468 GTGCAGATGTAGAAGTAGCCTGG + Intergenic
1125448883 15:39787201-39787223 GTGCAGTAGCACAATGATCATGG + Intergenic
1126755697 15:51923089-51923111 GTGAAGAGGCAGAAGGGGCCAGG + Intronic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1128805245 15:70526137-70526159 AGGCAGAAGCAGAATGAGTTGGG - Intergenic
1129177413 15:73849814-73849836 GTGCAGAAGAAGGCTCAGCCTGG + Intergenic
1132907801 16:2292191-2292213 GAGAAGAAGCAGAAAGAGCTGGG - Exonic
1133145262 16:3780429-3780451 GTGCAGAAGCACATTAAGGCCGG + Intronic
1134752428 16:16636583-16636605 GTGCAGGAGCAGAGTGGGCAAGG - Intergenic
1135522594 16:23188953-23188975 GGGCAGAGGCAGAGTGAGCTGGG + Intronic
1136472479 16:30490509-30490531 GTGAAGAGGCAGGAGGAGCCAGG - Intronic
1137593580 16:49708826-49708848 GTGCTGAAGCAGGAGGAGGCAGG - Intronic
1141065856 16:80913068-80913090 TTGGAGAAGCAGGAAGAGCCAGG - Intergenic
1141427458 16:83953335-83953357 GTGCAGGAGCCCAGTGAGCCCGG - Intronic
1141670905 16:85491262-85491284 GTGAAGAAACAGATTGATCCTGG - Intergenic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1146561080 17:33871201-33871223 GTTCAGAAGCTGAATGAGGCTGG + Intronic
1147367873 17:39971172-39971194 GTGAAGAGGAAGAAGGAGCCAGG + Intronic
1148018076 17:44536573-44536595 GGACAGAGGGAGAATGAGCCAGG - Intergenic
1148733834 17:49853397-49853419 TTTCAGAAGCAGAGGGAGCCAGG + Intergenic
1151366955 17:73623726-73623748 GTGAAGAAGCAGAGAGAGTCGGG - Intronic
1151427399 17:74040073-74040095 GTGCAGAAGCAGGAAGAGTGAGG + Intergenic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG + Intronic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1156864121 18:41869514-41869536 GTGCAGAATCCGAATGAGTTGGG - Intergenic
1158401190 18:57122858-57122880 GTGCTGAAGAAAAATCAGCCAGG + Intergenic
1158465957 18:57690104-57690126 GGTCAGAAACAGAATGAGTCAGG + Intronic
1158896744 18:61921352-61921374 GTGCAGAGGCAGGATCAGCCAGG - Intergenic
1159554637 18:69932603-69932625 GCGCAAAAGCAAAATGAGGCTGG - Intronic
1160868966 19:1268416-1268438 GTGGAGGAGCAGAGTGGGCCTGG + Intronic
1161519201 19:4714110-4714132 GTGCAGAAGACGGATGAGTCTGG - Exonic
1162442630 19:10702233-10702255 GTGCAGATCCAGAATGCGCTGGG + Exonic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG + Intergenic
1164713684 19:30376558-30376580 TTTCAGAAACAGAATGGGCCAGG + Intronic
1164768883 19:30792762-30792784 GTTCAGAAGCAGTAAGAGCATGG - Intergenic
1165433051 19:35783223-35783245 GGCCAGCAGCAGAATAAGCCTGG + Intronic
1165991987 19:39821111-39821133 GAGTAGAAGCAGAATCTGCCAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1166885965 19:45961051-45961073 GTGCAGCTGCAGAAGGAGACCGG - Exonic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167462274 19:49631900-49631922 TTGCAGAGGAGGAATGAGCCCGG - Intergenic
1167514125 19:49913092-49913114 TTGCAGATGCAGCATCAGCCAGG + Intronic
1167618904 19:50550743-50550765 CTGCAGGAGAAAAATGAGCCCGG - Intronic
1168238776 19:55078970-55078992 GGGGAGAAAGAGAATGAGCCTGG - Intronic
1168583004 19:57570805-57570827 GTAGAGAATCAGAAGGAGCCTGG - Intergenic
925841351 2:7995106-7995128 GTGCAGAACATGATTGAGCCAGG + Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926219209 2:10924045-10924067 GTGCAGAAGCAAAGAGTGCCCGG - Intergenic
926225013 2:10961249-10961271 CTGGAGGAGCAGAACGAGCCCGG - Intergenic
926647989 2:15310738-15310760 GTTTAGAGGCAGAAGGAGCCAGG - Intronic
927658485 2:24971870-24971892 ATGCCGAAGCGGAAGGAGCCCGG - Exonic
928314060 2:30232394-30232416 GTGCTGAAGGGGAAGGAGCCCGG + Intronic
928593218 2:32838110-32838132 GGGCAGCAGCAGAACCAGCCTGG + Intergenic
928786216 2:34888920-34888942 GTGTAGATGCAGATTGAACCTGG + Intergenic
932871688 2:75406634-75406656 GTGCAGAAGGAGACGGAGCATGG - Intergenic
933661589 2:84931836-84931858 GTCAAGAGGCAGAGTGAGCCAGG - Intergenic
939388782 2:141538688-141538710 GTGCAGCAGCACAATGATCTTGG + Intronic
939691371 2:145265953-145265975 AGGCAGAAGCAGAATGATCTGGG + Intergenic
940803405 2:158157422-158157444 GTGAAGAAGCAGCTAGAGCCAGG + Intergenic
940855862 2:158728378-158728400 GCTCTGAAGCAGAATAAGCCAGG + Intergenic
942314468 2:174684541-174684563 GTACAGAAGCAGAGAAAGCCGGG - Intergenic
942504461 2:176626905-176626927 GGGCTGAAGCAGAAAGAGCAAGG - Intergenic
942585528 2:177472010-177472032 GTGCTGAAGCAAAATAACCCAGG - Intronic
943745135 2:191454365-191454387 GTGCACAGACAGAATGAGCTTGG + Intergenic
945984270 2:216341427-216341449 CTGCTGATGCAGACTGAGCCTGG + Intronic
947534274 2:230931175-230931197 GTGGAGATGAAGACTGAGCCAGG - Intronic
947598586 2:231430219-231430241 GTCCAGAAGAAGAATGTCCCAGG + Intergenic
948660160 2:239501973-239501995 GTGCTGGAGCAGAAGGAGCTGGG - Intergenic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
1169102606 20:2964285-2964307 GAGCAGAACAAGAATGAACCAGG - Exonic
1171095249 20:22326684-22326706 ATGCATAAGTAGAATCAGCCTGG - Intergenic
1171179347 20:23081199-23081221 GTTCAGCAGCAGAACAAGCCAGG - Exonic
1171969320 20:31553841-31553863 GTTCTGAAGCAGGGTGAGCCCGG - Intronic
1172223312 20:33288259-33288281 GAGCAGAGGAAGAAGGAGCCAGG - Intronic
1173302713 20:41818092-41818114 GGGCAGAAGCAGAAGGATCTCGG - Intergenic
1173327151 20:42044383-42044405 TTGGAAAACCAGAATGAGCCTGG - Intergenic
1173598668 20:44277362-44277384 GTGCAGGAGAAGATTGAGGCAGG + Intronic
1175795273 20:61766918-61766940 GTGCAGAGTCAGAATCAGGCAGG - Intronic
1177734364 21:25070473-25070495 GGGCAGAAGTAGAATGTGACAGG - Intergenic
1177955512 21:27593520-27593542 GTCTACAACCAGAATGAGCCTGG - Intergenic
1178331449 21:31697630-31697652 GTCTATAAGCAGAATGAGCACGG - Intronic
1180245878 21:46546855-46546877 GGGCAGAAGCTGGATGCGCCAGG - Intronic
1180694581 22:17743693-17743715 CTGCAGAGGCAGAGTGATCCCGG + Intronic
1181935750 22:26437173-26437195 GGTCAGAAGCAGGATAAGCCTGG + Intronic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182680172 22:32073441-32073463 GGGCAGAAGCAGTGTGAGTCAGG - Intronic
1183762312 22:39832973-39832995 GTGCAGAAGCCGAGTGGGCAAGG + Intronic
1184561146 22:45263630-45263652 GTGGAGCAGAAGAAGGAGCCGGG - Intergenic
949200680 3:1375323-1375345 TTTCAGTAGCAGAATGAGACTGG + Intronic
952026814 3:29092723-29092745 GTGCCAAAACAGAATGGGCCTGG - Intergenic
952235145 3:31471632-31471654 AGCCAGAAACAGAATGAGCCAGG + Intergenic
952799547 3:37275738-37275760 GTGCAGAAGAAGAACGCGGCTGG + Intronic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
954335321 3:49913046-49913068 AGCCAGATGCAGAATGAGCCTGG + Intronic
954463284 3:50639814-50639836 GTGTAGAAGCAGAAGGTGCTGGG - Intronic
959563162 3:107805677-107805699 GAGCAGAAACAGAATGATCCTGG + Exonic
961608278 3:128114668-128114690 GTGCAGATGCCTAATGAGGCAGG - Intronic
962411388 3:135144173-135144195 GTGCAGAACCAGAAACAGCTGGG - Intronic
962929285 3:140022401-140022423 TTGCAGAAGAGCAATGAGCCTGG + Intronic
965795035 3:172430771-172430793 GTGCAAAAACAAAATCAGCCAGG + Intergenic
968748090 4:2371268-2371290 GTACAAAAGAAGAATGTGCCAGG - Intronic
968844441 4:3032186-3032208 GTGAAAAAGCAGAATGGGCCGGG + Intronic
968943588 4:3652110-3652132 GTGCAGAAGCACAAGGGGCAAGG - Intergenic
969834625 4:9830570-9830592 GTGCCTAAGCAGAGTGAGACGGG - Intronic
973006742 4:45017334-45017356 GTAGATAATCAGAATGAGCCAGG - Intergenic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
977285303 4:95098649-95098671 AAGCAGCAGCAGAATGAACCTGG - Intronic
977296218 4:95212592-95212614 ATGCAGAAGCAGAAAGAACTGGG - Intronic
979471170 4:121098715-121098737 CTGTAGAAGTAGAATGAGCCTGG - Intergenic
980019904 4:127696324-127696346 TTGCAAAAGCAGAATGCACCAGG - Intronic
981340829 4:143619429-143619451 GTGCGCAAGCAGAATGAACCTGG + Intronic
982873877 4:160620001-160620023 GTGCAGATGCAGAAAGAGGGTGG - Intergenic
983377315 4:166946403-166946425 GCGCAGGAGCAGGCTGAGCCTGG - Intronic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
985054006 4:186020320-186020342 TGGCTGAAGGAGAATGAGCCAGG + Intergenic
985095433 4:186408218-186408240 GTGAATGAGCAGAATGAGCATGG + Intergenic
985516313 5:346747-346769 CTGCAGATGCAGCATCAGCCAGG + Intronic
985677749 5:1241016-1241038 GTGCAGAAGCTGGAAGAGGCGGG + Intronic
985907522 5:2852601-2852623 GAGCAGAGGCAGAAAGAGCAAGG - Intergenic
986323395 5:6652276-6652298 GGGCTGTAGCAGAATGAGCAGGG + Intronic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
990809523 5:59706784-59706806 GTGCATAAGGAGAAGGAGCTCGG - Intronic
991348878 5:65700371-65700393 ATGAAAAAGAAGAATGAGCCGGG + Intronic
992689858 5:79231663-79231685 GGGCAGAGGCAGAATCAGGCAGG - Intronic
997162497 5:131624047-131624069 GTGAAGAATCAGAATGTACCAGG + Intronic
998163758 5:139828658-139828680 TTTCAGAAGCAGGATGAGGCAGG - Intronic
998835224 5:146196795-146196817 GGGCTGGAGCAGAATGAACCAGG - Intergenic
999442829 5:151615617-151615639 GTGCTGAAGCAGAATGAGTCAGG + Intergenic
999991006 5:157049784-157049806 ATGCAGATGCAGAAGGAGCTGGG - Intronic
1000518686 5:162273106-162273128 GAGCAGAAACAGAATTAACCTGG + Intergenic
1001486735 5:172125176-172125198 ATGCAGATGCCGAAAGAGCCAGG - Intronic
1001931965 5:175679501-175679523 GCACAGAATCAGAATGGGCCTGG + Intronic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1001962109 5:175885803-175885825 GTCCTGAAGCAGAAGGACCCTGG - Intergenic
1002617291 5:180463872-180463894 ATGCAGCAGCAGGATGGGCCTGG - Intergenic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1005652017 6:27893471-27893493 GGGCAGGAGCAGATTTAGCCGGG - Exonic
1006034546 6:31201334-31201356 GTGCAGAGCCAGAAGCAGCCAGG - Intronic
1006931273 6:37690083-37690105 TGGCTGGAGCAGAATGAGCCAGG - Intronic
1007322186 6:41035332-41035354 GTTCTGAAGCAGAGTGAGCTTGG + Intronic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007629823 6:43266969-43266991 GTGCAGGATCAGAGAGAGCCTGG + Intronic
1007855743 6:44854632-44854654 GTGCAGAAGCTGAATGGAGCTGG - Intronic
1008493277 6:52107546-52107568 GTGGAGAGGTAGAAAGAGCCTGG + Intergenic
1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG + Intronic
1013919600 6:115387440-115387462 ATGCAAAAGCTGAAAGAGCCTGG + Intergenic
1017481804 6:154864876-154864898 CTGCAGAAGAAGAATTAGGCTGG - Intronic
1018931234 6:168241724-168241746 GTGCAAAAGCAGAAGGTGCCAGG + Intergenic
1019109501 6:169698593-169698615 GGGAAGAAGCAGAAAGAGCTTGG - Intronic
1021111135 7:16696033-16696055 CTTCAAAAGCAGAAGGAGCCGGG - Intronic
1022481481 7:30746095-30746117 GTGCAGAAGTAAACTTAGCCAGG + Intronic
1022779031 7:33559466-33559488 GCATAGAAGCAGGATGAGCCAGG + Intronic
1022793616 7:33714378-33714400 GGGCTGCAGCAGAAAGAGCCTGG - Intergenic
1024207934 7:47179765-47179787 GTGCAGAAGGAGAAAGAGAAGGG + Intergenic
1026371982 7:69709239-69709261 GTGCAAAAGGAGTCTGAGCCTGG - Intronic
1026682099 7:72474793-72474815 GTGCAGAAGCGGCAAGAGGCAGG - Intergenic
1029232170 7:99079246-99079268 TTGCAGATGGAGAACGAGCCTGG - Intronic
1030758784 7:113324410-113324432 GAGCAGAAACACAATGAGACAGG - Intergenic
1034374368 7:150629603-150629625 GTGCACAAGCAGAATGTACTTGG - Intronic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1035675581 8:1453268-1453290 GGGGAGAAGCAGGAGGAGCCTGG + Intergenic
1040974876 8:53178825-53178847 GTGCAGAGGCAGATAGAGCAGGG + Intergenic
1042166384 8:65950022-65950044 GAGCTGAAGTATAATGAGCCAGG + Intergenic
1042467544 8:69145078-69145100 GTACAAAATGAGAATGAGCCTGG + Intergenic
1042996957 8:74711213-74711235 GTGCAGATGCACAGAGAGCCAGG - Intronic
1043729834 8:83662778-83662800 GTGTAGAAAGAGAATGAGACGGG + Intergenic
1043924968 8:86026470-86026492 GTGCAGAAGGAGAGTGAGTGGGG - Intronic
1045555869 8:103213862-103213884 GTGCACAGACAGAATGAACCTGG - Intronic
1047975405 8:130125117-130125139 GAGCAGAACCTGAATGAACCTGG - Intronic
1048941464 8:139404138-139404160 GTGCAGAAGCAGAGTGATGTGGG + Intergenic
1049662750 8:143827534-143827556 GAGCTGAAGCAGCATGAGACAGG + Intronic
1052069708 9:24067251-24067273 GTGCAAGGGCAGAAAGAGCCAGG + Intergenic
1052842356 9:33303473-33303495 GCCCAGAAGCAGCATGAGCCTGG - Intronic
1055837061 9:80455970-80455992 GTGCAGAAGTTGAATGTGTCAGG + Intergenic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1055938336 9:81624112-81624134 GTGCAGTAGTTGAAAGAGCCAGG - Intronic
1056043388 9:82690684-82690706 GTGCAAAAGCAACATGATCCTGG + Intergenic
1056475672 9:86948740-86948762 CTCCAGAAGCAGAGGGAGCCGGG + Intergenic
1058426937 9:104883408-104883430 GTGCACATGCATGATGAGCCGGG - Intronic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059783313 9:117552780-117552802 GTGCAGAAGCAGTTTGAATCTGG - Intergenic
1061632083 9:131878786-131878808 GGGCAGAATCACAAAGAGCCAGG - Intronic
1062324282 9:136004863-136004885 GTGCAGAATCACAAAGGGCCGGG + Intergenic
1187144068 X:16621501-16621523 GTGGAGAAGCAGGATGGTCCAGG + Intronic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1188841702 X:35025030-35025052 GAGCAGAAGGAGAAGCAGCCAGG + Intergenic
1188988440 X:36788996-36789018 GAGCAGAAGGAGAAGCAGCCAGG - Intergenic
1190221489 X:48515097-48515119 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190232137 X:48590460-48590482 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1194828936 X:98596931-98596953 GTGCAGAAGCAAAATGTGTTGGG - Intergenic
1196916156 X:120537009-120537031 ATGCAGAATCAGAATGTTCCGGG - Exonic
1197432047 X:126378021-126378043 GGGAATAGGCAGAATGAGCCTGG + Intergenic
1200155484 X:153972561-153972583 GCGCCGCAGCAAAATGAGCCGGG + Exonic
1200326821 X:155249159-155249181 GTGCTAGAGCAGAATGAGCCAGG - Intergenic