ID: 900676544

View in Genome Browser
Species Human (GRCh38)
Location 1:3890741-3890763
Sequence CCGGACCCGGCACTGTGTTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900676537_900676544 29 Left 900676537 1:3890689-3890711 CCCTGGCTCATTCTGCTTCTGCA 0: 1
1: 0
2: 5
3: 43
4: 394
Right 900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG 0: 1
1: 0
2: 0
3: 2
4: 58
900676538_900676544 28 Left 900676538 1:3890690-3890712 CCTGGCTCATTCTGCTTCTGCAC 0: 1
1: 0
2: 3
3: 26
4: 255
Right 900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG 0: 1
1: 0
2: 0
3: 2
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900676544 Original CRISPR CCGGACCCGGCACTGTGTTT TGG Exonic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
907427291 1:54388423-54388445 CCAGGCCAGGCACTGTGTGTGGG - Intronic
1066693661 10:38058792-38058814 CTGGTCCTGGCACTTTGTTTTGG - Exonic
1069776608 10:70930958-70930980 CAGGACCGGGAACTGTTTTTTGG - Intergenic
1071841286 10:89474351-89474373 CTGAACCAGGCAGTGTGTTTGGG - Intronic
1073270905 10:102263111-102263133 TGGGAGCCGGCACTGTGTGTGGG - Intronic
1075514015 10:123094974-123094996 CCCAGCCCGGCACTGGGTTTGGG - Intergenic
1083486889 11:62988683-62988705 CTGGGCCCGGAATTGTGTTTGGG + Intergenic
1089401760 11:118168489-118168511 CCGGCCCCGGCACTGCGCTAGGG - Intronic
1095680428 12:44968317-44968339 CAGTACCTGGCACTGTGCTTGGG - Intergenic
1101144625 12:101829841-101829863 CAGTACCTGGCACTGTGCTTGGG + Intronic
1102087059 12:110150365-110150387 CCGCACCCGGCCATGTTTTTAGG + Intronic
1102474655 12:113180821-113180843 CTGGGCCCAGCACTGTGGTTGGG - Intronic
1103580611 12:121912319-121912341 CCGTGCCCGGCGCTTTGTTTAGG + Intronic
1103597272 12:122031362-122031384 CAGGGCTTGGCACTGTGTTTTGG + Intronic
1105799164 13:23888911-23888933 CCGGACCCGACACTCTGGGTAGG + Intronic
1107857940 13:44633920-44633942 CCGCGCCCGGCCCTGTTTTTTGG - Intergenic
1123403261 15:20005956-20005978 CCGGACCTGGCAGTAGGTTTGGG - Intergenic
1123512599 15:21012610-21012632 CCGGACCTGGCAGTAGGTTTGGG - Intergenic
1124103093 15:26713473-26713495 CTGAACCCAGCATTGTGTTTCGG - Intronic
1127349684 15:58138185-58138207 CAGGGCCCGTCACTGTGATTTGG + Exonic
1128687360 15:69696698-69696720 CTGCATCAGGCACTGTGTTTGGG + Intergenic
1139915356 16:70424931-70424953 CTGGACCAGGCACTGTGGCTGGG + Intronic
1141709496 16:85689530-85689552 CCGGGCCCGGTGCTGAGTTTGGG - Intronic
1141767946 16:86071079-86071101 CTTGACCGGGCACTGTGCTTTGG - Intergenic
1142996194 17:3761914-3761936 CCGGAGCCACCACGGTGTTTTGG - Exonic
1143357669 17:6342591-6342613 CCTGACCCAGCCCTCTGTTTAGG - Intergenic
1146931833 17:36783169-36783191 CCGGACCCTGCACTGGCTTGGGG + Intergenic
1152282761 17:79395214-79395236 CCGGACCCAGCAATGTGTGGCGG + Intronic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1159948780 18:74463592-74463614 ACGTACCCGGCACTGTCTTCAGG + Intergenic
1161000415 19:1907922-1907944 CCGGAACAGGCACAGTGTTCAGG - Intronic
928263309 2:29787285-29787307 CAGCACCCAGCACTGTGTCTCGG - Intronic
932567006 2:72916836-72916858 CCGGTCGCGGCACCGTGTCTGGG + Intronic
937969264 2:127536737-127536759 CAGAACCCTGCACTTTGTTTAGG + Intronic
938068473 2:128294220-128294242 CCGGCCCTGGCACTGTGCTCTGG + Intronic
944511736 2:200472254-200472276 GCGGGCCTGGCCCTGTGTTTGGG + Intronic
948190876 2:236057600-236057622 CCTGACCCAACACTGCGTTTTGG + Intronic
1175393721 20:58644185-58644207 CGGGACCTGCCACTGTGGTTAGG + Intergenic
1175922035 20:62454719-62454741 TCCGACCCGGCCCTGAGTTTTGG + Intergenic
1179628516 21:42662270-42662292 CCGGACACGGCACCGTGCTGGGG - Intronic
1181615463 22:24051340-24051362 CCAGACCCGGGACTGTCTCTGGG - Intronic
1183327239 22:37200881-37200903 CTGGACTAGGAACTGTGTTTTGG + Intergenic
956450499 3:69370305-69370327 CTGCACCCGGCCCTGTGGTTGGG - Intronic
962935512 3:140076947-140076969 CCCGCCCAGGCACTGTGCTTTGG + Intronic
977723733 4:100270232-100270254 CCGTACCTGGCCTTGTGTTTTGG + Intergenic
991689661 5:69213882-69213904 CCTGACCCATCATTGTGTTTTGG + Intergenic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
1001276800 5:170357201-170357223 CCGGACCCTGCACTGTGGCTCGG + Intronic
1003311650 6:4974248-4974270 CCAGAACCGGCTCTGAGTTTGGG - Intergenic
1007709036 6:43810055-43810077 CTGGATCAGGCACTGTGTTTAGG - Intergenic
1013588953 6:111604363-111604385 CTGGACCAGTCACTGTGTGTGGG - Intronic
1024919427 7:54542379-54542401 CCCGAGCCGGCTCCGTGTTTAGG + Exonic
1029532909 7:101137247-101137269 GGGGACCCGGCACTGTCTGTGGG - Intronic
1049473891 8:142788104-142788126 CAGGCCCCGGCACTGTGTCAGGG - Intergenic
1056763070 9:89428324-89428346 CAGGGCCAGGGACTGTGTTTGGG - Intronic
1057895940 9:98908673-98908695 CCGGACAGGGCCTTGTGTTTAGG + Intergenic
1195168079 X:102239784-102239806 CCTGTCCCGCCACTGTATTTTGG - Intergenic
1195190778 X:102447303-102447325 CCTGTCCCGCCACTGTATTTTGG + Intronic
1198520303 X:137445730-137445752 CCAGACCTGGCACTGTGTGCTGG - Intergenic
1199826550 X:151505982-151506004 CCCCACTGGGCACTGTGTTTTGG + Intergenic