ID: 900678087

View in Genome Browser
Species Human (GRCh38)
Location 1:3900913-3900935
Sequence GGCGGGCGGGACGTCCGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900678081_900678087 -6 Left 900678081 1:3900896-3900918 CCGCCATGTTTGAGAGGGGCGGG 0: 1
1: 0
2: 2
3: 7
4: 90
Right 900678087 1:3900913-3900935 GGCGGGCGGGACGTCCGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 74
900678075_900678087 12 Left 900678075 1:3900878-3900900 CCTTTGGTGCGCCTGTGGCCGCC 0: 1
1: 1
2: 0
3: 7
4: 82
Right 900678087 1:3900913-3900935 GGCGGGCGGGACGTCCGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 74
900678076_900678087 1 Left 900678076 1:3900889-3900911 CCTGTGGCCGCCATGTTTGAGAG 0: 1
1: 2
2: 0
3: 11
4: 130
Right 900678087 1:3900913-3900935 GGCGGGCGGGACGTCCGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 74
900678083_900678087 -9 Left 900678083 1:3900899-3900921 CCATGTTTGAGAGGGGCGGGCGG 0: 1
1: 0
2: 3
3: 6
4: 90
Right 900678087 1:3900913-3900935 GGCGGGCGGGACGTCCGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900678087 Original CRISPR GGCGGGCGGGACGTCCGTGA GGG Intergenic
900204887 1:1427525-1427547 GCCGGGCGGGCCGTCAGTGGGGG - Intronic
900678087 1:3900913-3900935 GGCGGGCGGGACGTCCGTGAGGG + Intergenic
900971147 1:5993011-5993033 GGCGGGCGGGAGGACAGGGAAGG - Intronic
906295167 1:44645158-44645180 GGCGGGCAGGACAGCCCTGAGGG - Intronic
911115002 1:94237610-94237632 GGCGGGCGGTGCGGCCGTGGCGG - Intronic
920881153 1:209881484-209881506 GGTGTGAGGGACGTCTGTGAAGG - Intergenic
1068762946 10:60733179-60733201 GGCGGGCGGGAGGCCCGGGCCGG - Intronic
1077100410 11:819935-819957 GGCTGGCGGGAAGGCCGTGCGGG + Intronic
1078076684 11:8168718-8168740 GGCGGGCGAGACGGCGTTGAAGG - Intronic
1078318085 11:10308206-10308228 GGCGGGCAGGACGGACGTGCCGG + Intergenic
1084272998 11:68038980-68039002 GGCAGGCGGGACGACGGGGAGGG - Intergenic
1085485620 11:76860803-76860825 GGTGGGCGGGGCCTCCGTCAGGG + Intergenic
1085643767 11:78209630-78209652 GGCGAGAGAGAGGTCCGTGAAGG - Exonic
1092143714 12:6200737-6200759 GCCGGGCGGGACGGCCGCGACGG + Intronic
1092485911 12:8901802-8901824 GATGGGAGGGACTTCCGTGAAGG + Intergenic
1096489757 12:52007096-52007118 GGCGGGCGCGACTTCCGAGTCGG - Exonic
1096863760 12:54549311-54549333 GGCGGGCTGGACTTCGGTGTGGG - Intergenic
1104602298 12:130162165-130162187 GGCGGGCGGGACTGCCGGGGAGG + Intergenic
1110711895 13:78659140-78659162 GGTCGGCGGGACTTCCGTGTTGG - Exonic
1113451035 13:110409930-110409952 GGCGGGCGGGACGTGTGGGCCGG - Intronic
1113813191 13:113154254-113154276 GGGGGGCGGGGCGTCGGGGAGGG + Intergenic
1115545614 14:34462533-34462555 GGTGGGCGGGGCGTCAGTGCCGG + Intronic
1120881219 14:89416794-89416816 GGCGGGAGGCGCGTCCGAGACGG - Intronic
1128149786 15:65355644-65355666 GGGGGGCGGGACGCCCGCGTCGG - Intronic
1131121115 15:89823924-89823946 AGTGGGTGGGACATCCGTGATGG - Intergenic
1132365258 15:101252094-101252116 CGCGGGCGGGGCGCCCGAGAGGG - Intergenic
1132807486 16:1781904-1781926 GGCGGTCGGGCCGGGCGTGAGGG - Intronic
1133212889 16:4272898-4272920 GGCGGGCGGGAGGGGCGGGAGGG + Exonic
1137787902 16:51152391-51152413 GCCGGGGGGGAGGTCCGGGAGGG - Intergenic
1139511355 16:67430284-67430306 GGCCAGAGGGACGTCGGTGAAGG - Intergenic
1141647632 16:85376089-85376111 GGCGGGGGTGAGGACCGTGAGGG - Intergenic
1142230580 16:88898364-88898386 GGCGGCCCGGGCGTCCCTGAGGG - Intronic
1142499741 17:325614-325636 GGCGGTGGGGACGTGGGTGAAGG - Intronic
1143174771 17:4949609-4949631 GGAGGGCGGGACGGGCGGGACGG + Intronic
1145090328 17:19980457-19980479 GGCGGGAGGGACGTAGGGGAGGG + Intergenic
1145784116 17:27582978-27583000 GGTGGGGGGGGCGTCCGTGGTGG - Exonic
1150778714 17:68101867-68101889 GGCGGGCGGGACGGGGGCGACGG - Intergenic
1152676642 17:81644802-81644824 GCCGAGCGGGACGGCCCTGAGGG + Intronic
1158435887 18:57435512-57435534 GGCGGACGGGGCGTGCGTGCGGG - Intergenic
1160988541 19:1851336-1851358 GGTGGGAGGGACGCCCGGGAGGG + Intergenic
1161504440 19:4636331-4636353 GGCGGGCGGGATCTGCGTGCGGG - Intergenic
1163756650 19:19110537-19110559 GAGGGGCGGGAGGGCCGTGAAGG - Intronic
1167716328 19:51144718-51144740 TGAGGGGGGGACGTCCCTGAGGG + Intronic
925420016 2:3703988-3704010 GGCGGGCGGCAAGTACGTGGCGG + Exonic
926283076 2:11466021-11466043 GGCGGGCGGGACGGCCTAGCCGG - Exonic
930136208 2:47905969-47905991 GCCGGGCGGGGCGGCCGCGAGGG + Intergenic
934846449 2:97663948-97663970 GGCGGGCGGGAGGACCGGGACGG + Exonic
937449921 2:121993491-121993513 GACGGGCAGGACATCCATGATGG - Intergenic
942313984 2:174682227-174682249 GGCGAGCGGGCCGCCCGGGAGGG + Intronic
943365293 2:186962428-186962450 CGCGGGCGGGCCGTCAGTGCTGG - Intergenic
948991707 2:241559002-241559024 GGCGGGCGTGGCGTCCGTGCCGG + Intronic
1169134657 20:3190082-3190104 GGAGGGCGGGGGGTCAGTGAAGG - Intergenic
1175936282 20:62515566-62515588 GGCGGGCTGGGCGTCAGTGCTGG + Intergenic
1179522440 21:41953970-41953992 CGCGGGCGGGACGCCCGGGGCGG - Intergenic
1180959371 22:19755653-19755675 GGCGGGAGGGAGGACGGTGAGGG + Intergenic
1182663912 22:31944035-31944057 GGCGGGCGGGACGGCTGGGGCGG + Intronic
1184697969 22:46150392-46150414 GGCGGGCGGGGCTTCCGGGTCGG + Intergenic
963598814 3:147359704-147359726 GGCGGACGGGACCTGCGTGTGGG - Intergenic
986062787 5:4207554-4207576 GGCGGGTGGGACCTCTGTCACGG - Intergenic
990699384 5:58459639-58459661 GGCGGGCGGGAGGTCTGTCCGGG - Intronic
998568492 5:143236805-143236827 GTAGGGGGGGACCTCCGTGAAGG - Intergenic
1004114130 6:12749862-12749884 GGCGGGGAGGACGCCCGGGAGGG - Intronic
1005916070 6:30352541-30352563 GGAGGGGGGGGCCTCCGTGATGG + Intergenic
1011277400 6:85643646-85643668 GGCGGGCGGGAGCTCGGTGGGGG - Intronic
1014439000 6:121452199-121452221 GGCGGGCGGGTCACCTGTGATGG - Intergenic
1015928837 6:138336353-138336375 TGCGGGCTGGAGGGCCGTGAAGG - Exonic
1018676808 6:166229435-166229457 GGCGGGCAGGACGCCCTTCAGGG + Intergenic
1019355240 7:575204-575226 AGCTGGCGGGACGTCCAAGATGG + Intronic
1020198169 7:6058787-6058809 GGCGGGCGGGCCGTCGGGTAAGG - Intronic
1033288549 7:140062454-140062476 AGCGGGCTGGAAGTGCGTGAGGG + Intronic
1041377263 8:57216979-57217001 GGCGGTAGGGACGTCCGCGGCGG + Intergenic
1048459941 8:134613413-134613435 GGGGGGCTGGACGTGGGTGAAGG + Intronic
1049311528 8:141936226-141936248 GGCTGGCTGGAGGTCAGTGAAGG - Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1061472158 9:130835310-130835332 GGCGCGCGGGGCGGCGGTGAGGG + Intronic
1061590791 9:131596345-131596367 GACGGGCCGGACGTCCGCGGAGG - Exonic
1061643751 9:131981961-131981983 GGCGGGCTGGACGTCAGGGGAGG - Intronic
1200162644 X:154017305-154017327 GGTGGTCGGGAAGTCCTTGAAGG + Intronic